Environ. Sci. Technol. 2007, 41, 7383-7388
Prevalence of Multi-Antimicrobial-Agent Resistant, Shiga Toxin and Enterotoxin Producing Escherichia coli in Surface Waters of River Ganga SIYA RAM, POORNIMA VAJPAYEE, AND RISHI SHANKER* Environmental Microbiology Division, Industrial Toxicology Research Centre, Post Box 80, Mahatma Gandhi Marg, Lucknow-226001, U.P., India
The consumption of polluted surface water for domestic and recreational purposes by large populations in developing nations is a major cause of diarrheal disease related mortality. The river Ganga and its tributaries meet 40% of the water requirement for drinking and irrigation in India. In this study, Escherichia coli isolates (n ) 75) of the river Ganga water were investigated for resistance to antimicrobial agents (n ) 15) and virulence genes specific to shiga toxin (STEC) and enterotoxin producing E. coli (ETEC). E. coli isolates from the river Ganga water exhibit resistance to multiple antimicrobial agents. The distribution of antimicrobial agent resistance in E. coli varies significantly (χ2: 81.28 at df ) 24, p < 0.001) between the sites. Both stx1 and stx2 genes were present in 82.3% of STEC (n ) 17) while remaining isolates possess either stx1 (11.8%) or stx2 (5.9%). The presence of eaeA, hlyA, and chuA genes was observed in 70.6, 88.2, and 58.8% of STEC, respectively. Both LT1 and ST1 genes were positive in 66.7% of ETEC (n ) 15) while 33.3% of isolates harbor only LT1 gene. The prevalence of multi-antimicrobialagent resistant E. coli in the river Ganga water poses increased risk of infections in the human population.
Introduction Escherichia coli, an inhabitant of the gastrointestinal tracts of warm-blooded animals, has been widely used as an “indicator” of the microbiological quality of surface water and groundwater (1). Certain strains of E. coli, responsible for enteric and diarrheal diseases, urinary tract infections, and sepsis/meningitis, are classified into 11 recognized pathotypes on the basis of their distinct virulence properties and clinical symptoms (2, 3). The most prevalent pathotypes of E. coli responsible for diarrheal diseases include enterohemorrhagic or shiga toxin producing E. coli (EHEC or STEC) and enterotoxigenic E. coli (ETEC) (2). The contamination of drinking or recreational waters with such E. coli pathotypes has been associated with waterborne disease outbreaks and mortality (4, 5). Surface waters are the main source for irrigation, recreational, drinking, and other domestic purposes in the developing world (4, 6, 7). The potential sources of fecal * Corresponding author phone: 91+ 0522-2613786/2614118/ 2627586 extn.237; fax : 91+ 0522-2611547; e-mail: rishishanker1@ rediffmail.com. 10.1021/es0712266 CCC: $37.00 Published on Web 09/22/2007
2007 American Chemical Society
contamination of surface water resources in developing countries are domestic and wild animal defecation, malfunctioning of septic trenches, stormwater drainage, municipal wastes, and industrial effluents (8). The human activities on the banks of rivers, ponds, and lakes also contribute to contamination of surface waters by multiple drug resistant E. coli harboring virulence genes (9-12). Multiplication and survival of pathogenic E. coli in aquatic environments is facilitated by addition of nutrients in the form of pollutants, proliferation of algae, and macrophytes due to eutrophication of water bodies (13, 14). Surface water bodies in south Asia are facing numerous threats originating from anthropogenic activities due to rapid population growth and industrialization. Although aquatic environment plays a significant role in survival of pathogenic E. coli (14), most studies have targeted E. coli isolates of clinical origin for determination of resistance to antimicrobial agents and virulence determination (10, 15). Only a few studies describe the prevalence of virulence genes harboring multipleantimicrobial-agent resistant E. coli in surface waters in south Asia (4, 10, 15). The river Ganga (traveling 2510 km across the Indian subcontinent) and its tributaries meet 40% of the water requirement for drinking and irrigation in India (16). Organic pollution from domestic sewage (2460 million liters per day (mLd) of waste directly and 4570 mLd of mostly untreated raw sewage through its tributaries from 223 cities/towns), industrial effluents, hazardous chemicals from non-point sources of agriculture and health sectors, and inadequate cremation procedures along the banks have serious impacts on physicochemical and microbiological water quality of the river. High density of coliform bacteria has been reported in the river Ganga throughout its course from Himalaya to Bay of Bengal (17). However, no attempt has been made to determine occurrence of representative diarrheagenic E. coli, STEC and ETEC, associated with fecal pollution of water resources. Hence, in this study, E. coli isolated from selected locations of the river Ganga were investigated for susceptibility to antimicrobial agents and the presence of virulence genes specific to STEC and ETEC.
Materials and Methods Sample Collection and Quantitative Enumeration of Coliforms. For isolation of coliform population, water samples (1 L) were collected 30 cm below water surface, in sterile, glass bottles from left, mid, and right bank of the river at five selected sites (Figure 1), stored in ice, and transported to the laboratory for analysis within 6 h by membrane filtration method (18). Quantitative enumeration of total and fecal coliforms at selected sites was done as per APHA (18) using the Multiple Tube Fermentation Technique. Isolation and Identification of E. coli. For isolation of E. coli, combined water samples for each sampling site were prepared by mixing 500 mL water from left, mid, and right side samples of the river Ganga. The combined water samples (100 mL) from each site were filtered in duplicate through a membrane filter (cellulose nitrate filter of 0.45 µm pore size). Each membrane filter was aseptically removed by sterile forceps, cut into 4 pieces, placed in 25 mL Erlenmeyer flasks containing 10 mL of MacConkey broth, and incubated at 35 ( 1 °C for 24 h at 220 rpm on a rotary shaker (INNOVA 4230, New Brunswick, NJ). A loopful of culture from MacConkey broth tubes was then streaked on Levine EMB (Eosin methylene blue) agar plates and incubated overnight at 35 ( 1 °C. For further study, 25 blue-black colonies with metallic sheen growing on EMB agar plates were randomly selected VOL. 41, NO. 21, 2007 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
7383
relation between the virulence genes detected in E. coli isolates at five sampling locations.
Results
FIGURE 1. Location of sampling sites along the bank of the river Ganga in vicinity of Kanpur city for collection of water samples. from each site. These isolates were screened for indole production, methyl red, Voges-Proskauer, and Simmons citrate tests. The isolates confirmed as E. coli were maintained at -70 °C in Luria Bertani (LB) broth supplemented with 15% (v/v) glycerol. Determination of Susceptibility to Antimicrobial Agents. Fifteen isolates from each site, confirmed as E. coli by biochemical tests, were selected randomly for determination of susceptibility to antimicrobials. The sensitivity of isolated organisms to 15 antimicrobials belonging to 6 classes (Supporting Information, Table S1) was determined by an agar diffusion test using antimicrobial-impregnated paper discs (Hi-Media Ltd., India) as described by Clinical and Laboratory Standards Institute (19). In brief, pure culture colonies (3-4) were transferred into tubes containing 5 mL of LB broth and incubated at 35 ( 1 °C for 4-6 h on a rotary shaker at 220 rpm to yield a uniform suspension of 106 cells per mL. The inoculum was streaked on sterile Mueller Hinton agar plates (90 mm diameter) using a sterile cotton swab. The discs for four antimicrobials were applied aseptically, 30 mm apart, on Mueller Hinton Agar plates. The plates were incubated immediately at 35 ( 1 °C for 16-20 h. The diameters of zones showing inhibition were measured to the nearest mm and recorded. The data for antimicrobial agent resistance of each bacterial isolate has been reported as resistant (R), intermediate (reduced susceptibility), or sensitive (S) based on Clinical and Laboratory Standards (19) Institute break points. This test was performed in triplicate for each E. coli strain and antimicrobial agent. E. coli ATCC 25922 was used as negative control in each experimental set. Determination of Virulent Gene Profile. Fifteen isolates from each site earlier selected for determination of susceptibility to antimicrobials were selected for detection of virulence genes. The virulence genes profile was generated by PCR amplification of stx1, stx2, eaeA, chuA LT1, ST1, hly A genes using gene specific primers (Table 1). The DNA template for genes located on chromosome (stx1, stx2, eaeA, chuA) was genomic DNA. The genes encoded by plasmids were amplified using total DNA (boiled cell lysate). Statistical Analyses. The statistical methods used in this study were adopted from Seigal and Catellan (22). For statistical analysis, intermediates (isolates with reduced susceptibility) were classified together with resistant isolates (23). Five sampling sites were designated as five groups. Chi Square test was performed for each antimicrobial agent to analyze the distribution of antimicrobial agent resistant E. coli between the groups. The groups were also compared using Chi Square test for significant variation in number of multiple-antimicrobial-agent resistant E. coli. The Spearman correlation (rs) analysis was performed to determine cor7384
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 41, NO. 21, 2007
Quantitative Analysis of Coliforms and Identification of E. coli. The river Ganga water samples collected from all the sites have high MPN/100 mL values for total coliforms and fecal coliforms. (Supporting Information, Table S-2). The 15 surface water samples collected from 5 sites of the river Ganga yielded 210 isolates on Levine EMB agar. The equal number (n ) 25 at each site) of randomly selected isolates, screened by various biochemical tests confirmed 98 isolates as E. coli. Susceptibility to Antimicrobial Agents. The distribution of antimicobial agent resistance in E. coli varies significantly (χ2: 81.28 at df ) 24, p < 0.001) among the sites (Figure 2). E. coli isolated from site #2 were resistant to 5-7 antimicrobial agents followed by sites #3 and 4 which exhibited resistance to 1-4 and 0-2 drugs, respectively. Isolates of sites #1 and 5 were resistant for 0-1 antimicrobial agent only. It was observed that 41.3, 6.7, and 24% of isolates were resistant to 1, 2, and 3 or more antimicrobial agents, respectively (Table 2). No resistance toward antimicrobial agents tested was observed in 28% of E. coli isolates. It was noted that 37% of isolates were resistant to cephalothin, a member of cephalosporins. Further, 20% of E. coli isolates were resistant to ampicillin, amoxycillin, and tetracycline (Table 2). Reduced susceptibility to piperacillin, cephalothin, amikacin, and neomycin was observed in 13, 49, 52, and 97% of E. coli isolates, respectively. Resistance to multiple antimicrobial agents (n ) 4-6) was observed in 5.3% E. coli isolates of site #2 that were resistant to ciprofloxacin (Tables 2 and 3). The five sampling sites of the river Ganga significantly (χ2, p < 0.001, df: 4 except for cephalothin χ2, p < 0.005) differed in distribution of E. coli isolates demonstrating resistance to ampicillin, amoxycillin, piperacillin, cephalothin, amikacin, and tetracycline (Table 2). Virulence Determinants of E. coli Isolates from Surface Water of the River Ganga. E. coli isolated from the river Ganga possess virulence genes specific for STEC and ETEC (Table 3 and Supporting Information, Figure S-3). Both stx1 and stx2 genes were present in 82.3% of STEC (n ) 17) while remaining isolates possess either stx1 (11.8%) or stx2 (5.9%) (Table 3). A very significant number of STEC isolates (70.6%) harbor eaeA gene. It was observed that hlyA and chuA genes were present in 88.2 and 58.8% of STEC isolates, respectively (Table 3). Both LT1 and ST1 genes were positive in 66.7% of ETEC (n ) 15) while 33.3% of isolates harbor only LT1 gene (Table 3). Results indicate that the occurrence of stx1 at different sampling locations was significantly correlated with the presence of stx2 (rs ) 0.949, p < 0.05, at df ) 5) and hlyA genes (rs ) 0.900, p < 0.05, at df )5). Further, another virulence gene chuA (responsible for heme transport in STEC) has an insignificant (p > 0.05, at df )5) positive correlation with stx1 and stx2. The analysis of data for virulence associated genes in ETEC revealed that the occurrence of LT1 is not associated with ST1 across the river Ganga (rs ) 0.707, p > 0.05 at df )5).
Discussion The river Ganga exhibits high fecal coliform density at selected sites. The MPN/100 mL values of fecal bacteria recorded at all the sampling stations exceeded the standards set by regulatory authorities for surface water reservoirs to be used for drinking and recreational purposes (16, 24). The antimicrobial agents resistance profile observed during the present study reflects that river Ganga is a reservoir of
TABLE 1. PCR Primers Used in the Amplification of Virulence Genes Specific for STEC and ETEC in Surface Water Isolates of E. coli gene
stx1a stx2a eae Aa hlyAa chuAa LT1c ST1c
name of the primer
primer sequence (5′- 3′)
stx1 - Fa stx1 - Ra stx2 - Fa stx2 - Ra eaeA - Fa eaeA - Ra hlyA:‘F’a hlyA:‘R’a chuA - Fa chuA -Ra LT1 - Fb LT1 - Rb ST1 - Fb ST1 - Rb
TGCCGGACACATAGAAGGAAACT AGAGGGGATTTCGTACAACACTGG GGAGTTCAGTGGTAATACAATG GCGTCATCGTATACACAGG GAAGCCAAAGCGCACAAGACT CTCCGCGGTTTTAGCAGACAC GCTATGGGCCTGTTCTCCTCTGC ACCACTTTCTTTCTCCCGACATCC ATCGCGGCGTGCTGGTTCTTGTC TCGTCATTCGGCGCGGTTTCAC TCTCTATGTGCATACGGAGC CCATACTGATTGCCGCAAT CTTTCCCCTCTTTTTAGTCAG TAACATGGAGCACAGGCAGG
annealing (°C)
product size (bp)
48
267
45
149
44
413
50
224
50
370
49
322
49
175
a Designed for this study. b Primers for LT1 and ST1 were adopted from Olive 1998 (20) and Kong et al., 1998 (21), respectively. c Positive controls: E. coli MTCC-723 (LT1 and ST1), E. coli ITRC-18(stx1, stx2, hlyA, eaeA and chuA).
FIGURE 2. Occurrence and distribution of multi-antimicrobial-agents resistance in E. coli isolated from water collected from different sampling sites of the river Ganga. χ2: 81.28 at df ) 24, p < 0.001. multiple-antimicrobial-agent resistant E. coli. In this study, 24% of isolates exhibited resistance to 3 or more antimicrobial agents. A comparison of the antimicrobial agent resistance pattern of various E. coli isolates recovered from 5 sampling sites reveal that the sites #2 and 3 harbor E. coli which were resistant to multiple antimicrobial agents. These sites are highly polluted due to recurring fecal pollution from nearby urban residential area and cremation practices (18, 25). E. coli isolates from urban areas/point sources have resistance to more antibiotics than rural/nonpoint source isolates possibly due to greater exposure to antibiotics (26). In the present study, ciprofloxacin-resistant isolates exhibited resistance to 6-7 antimicrobial agents. Resistance to multiple antimicrobial agents in ciprofloxacin-resistant E. coli has been reported in isolates of clinical and surface water origin (12, 27). E. coli isolates (26.6%) in our study were resistant to tetracycline. The resistance to antimicrobials of tetracycline class has been reported frequently in surface water isolates of E. coli (4, 7, 10, 12). The occurrence of plasmid encoded tetracycline resistance among pathogenic E. coli in the river Ganga water may enhance the possibility of horizontal gene transfer in susceptible bacteria (28). Both humans and animals are colonized by EHEC/STEC. The colonization of animals is asymptomatic while expression of stx genes leads to serious pathology in humans. The difference in Gb3 receptors distribution in both hosts is the key factor in disease outcome or hemorrhagic consequences (29). Population pressure and poor sanitation facilities have been responsible for increased presence of pathogenic organisms harboring virulence genes in surface waters of
developing countries (10). The presence of virulence markers stx1 and stx2 in 82.3% of STEC isolates indicates fecal pollution of animal and human origin in the river Ganga. It has been reported that the river Ganga receives untreated sewerage, slum wastewaters, hospital wastes, and carcasses due to inadequate cremation practices (17, 25). STECs have a high rate of attack and transmission in humans due to very a low infectious dose of 1-10 colony forming units (CFU) with a short incubation period of 3 h (3). The presence of STEC exhibiting both stx1and stx2 has been reported in human and cattle stool samples from India (15, 30, 31). Therefore, the consumption of STEC-contaminated water may lead to diarrheal diseases in humans (7). It has been suggested that the eaeA gene may be required for the expression of full virulence of STEC in humans leading to hemorrhagic colitis and hemolytic uremic syndrome (32). The presence of eaeA gene in 70.6% of STEC isolates along with stx1 or stx2 or both enhanced the risk of infection in humans. A plasmid encoded virulence gene (33), hlyA was observed to be the most prevalent gene in STEC isolates (88.2%) of the river Ganga. The chuA gene was present in 58.8% isolates of E. coli harboring either stx1/stx2 or both. The chuA gene encodes for a 69 kDa outer membrane protein responsible for heme uptake in STEC (34). ETEC cause travelers diarrhea by producing different combinations of heat labile (LT) and heat stable (ST) enterotoxins along with one or more of the 22 colonizing factors (35). Genes for LT and ST enterotoxins (LT1, ST1) could be encoded together or separately on large variable plasmids called Ent plasmids (36). We observed the presence of both LT1 and ST1 genes in 66.7% of E. coli isolates while 33.3% harbored only LT1 gene. Similar observations have been reported on the presence of ST and LT enterotoxins in ETEC from surface waters in Bangladesh and South Africa (4, 7). It is likely that E. coli may transit between virulent and nonvirulent form by acquiring or losing virulence genes encoded by plasmid(s) making these forms indistinguishable from normal gut flora in individuals consuming river water for daily needs (37). Therefore, the presence of E. coli exhibiting plasmid encoded virulence genes (hlyA, LT1, and ST1) in the river Ganga water may lead to emergence of new pathogenic variants. The E. coli detected in our study are in culturable metabolic state. The plausible explanation could be either recent deposition from human and/or animal feces or metabolically active reproducing populations in river water. The survival and maintenance of E. coli populations in VOL. 41, NO. 21, 2007 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
7385
TABLE 2. Distribution of E. coli Resistant to Antimicrobial Agents in Surface Water at Five Sampling Sites of the River Gangaa number of E. coli isolates resistant to antimicrobials (with reduced susceptibility) sampling sitesb class Aminoglycosides
β-lactams Cephalosporins Fluoroquinolones Tetracycline
antimicrobial agent
#1 (n ) 15)
#2 (n ) 15)
#3 (n ) 15)
#4 (n ) 15)
#5 (n ) 15)
χ2c p value
Gentamicin Neomycin Streptomycin Amikacin Ampicillin Amoxycillin Piperacillin Ceftazidime Cephalothin Ciprofloxacin Tetracycline
0 (1) 0 (15) 0 (5) 0 (14) 0 (1) 1 (0) 0 (4) 0 (0) 6 (7) 0 (0) 0 (0)
0 (1) 0 (15) 8 (1) 0 (4) 15 (0) 15 (0) 15 (0) 1 (0) 14 (1) 4 (1) 15 (0)
0 (1) 1 (14) 0 (0) 2 (11) 0 (1) 0 (0) 4 (1) 0 (1) 3 (8) 0 (0) 0 (0)
0 (2) 1 (14) 0 (0) 0 (0) 0 (0) 0 (1) 0 (0) 0 (1) 1 (14) 0 (0) 0 (0)
0 (0) 0 (14) 0 (0) 0 (10) 0 (1) 0 (0) 0 (5) 0 (0) 4 (7) 0 (0) 0 (5)
2.14ns 4.05ns 29.33 38.95 59.65 61.74 34.52 2.08ns 10.53* 21.42 57.95
a All the E. coli isolates were sensitive to co-trimoxazole, nalidixic acid, norfloxacin, and chloramphenicol. b Sites: #1, Bithoor; #2, Bhairoghat; #3, Jajmau Bridge; #4, NanaraoGhat; #5, Shuklaganj. c χ2 significant at p < 0.001 (df )4); ns: not significant; *p < 0.05.
TABLE 3. Antimicrobial Resistance and Virulence Genes Detected in E. coli Isolated from Water at Five Sampling Locations of the River Ganga virulence genes sitea
isolateb
resistance to antimicrobial agents
#1
*R2A M2B M2D *M2E L2A *L2C *R3D M3C *M3D *M3E L3A *L3D R1A M1A M1B M1C M1E *L1A *L1B *L1C *L1D L1E M5A *M5C M5E *L5A L5B L5D R6C R6D *L6A *L6B
NRDc Ac NRD NRD Ch Ch Ac, T, S, A, Pc Ac, Ch, T, Cf, A, Pc Ac, Ch, T, Cf, S, A, Pc Ac, Ch, T, A, Pc Ac, Ch, T, A, Pc Ac, Ch, T, A, Pc Ac Ac, Ak, Pc Ac Ac, Pc Ac Ac Ac Ac, Ch, A, Pc Ac, Ac, Ch Ac, Ch Ac NRD Ac Ac Ac, N NRD Ch NRD NRD
#2
#3
#4
#5
stx1
stx2
eaeA
hlyA
chuA
LT1
ST1
+ + + + + + + + + + + + + + + + -
+ + + + + + + + + + + + + + + -
+ + + + + + + + + + + + -
+ + + + + + + + + + + + + + + -
+ + + + + + + + + + + + + -
+ + + + + + + + + + + + + + +
+ + + + + + + + + + -
a Sites: #1 Bithoor, #2 Bhairo ghat, #3 Jajmau Bridge, #4 Nana Rao ghat, #5 Shuklaganj. refers to sampling order on day of sample collection. c NRD ) No resistance detected.
tropical and subtropical fresh waters due to the combination of high temperatures and the availability of nutrients has been documented (14). Recently, the ability of E. coli to persistently colonize fresh water habitats even in temperate regions has been demonstrated (38). Further, a strong positive correlation of river water temperature and nutrient concentration to number of viable cells has been reported (14, 39). The riverine environment in India is conducive to microbial growth due to warm humid conditions with cyclic 7386
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 41, NO. 21, 2007
b
*ETEC. The number embedded in isolate identity
periods of wet and dry weather and eutrophication. Hence, the close contact of the human population with surface water in Gangetic plains will enrich the environmental gene pool of E. coli isolates that may serve as reservoirs of virulence genes and lead to emergence of new pathogenic variants. During the present study, STEC isolates (stx1 and stx2 or stx1/ stx2 positive) from river Ganga water were found to be resistant to 0-6 antimicrobial agents. The isolates were resistant to amoxycillin (80%), cephalothin (29.4%), piper-
acillin (23.5%), tetracycline (11.8%), and ciprofloxacin (5.9%). Some other studies have also reported resistance for two or more antimicrobial agents in STEC isolates from humans, cattle, and food (40, 41). The availability of antimicrobials over the counter without prescription, treatment without clinical identification of pathogen, the use of sub-therapeutic doses, insufficient adherence to antibiotic policy, and international travel are among the factors that contribute to the emergence and spread of multi-antimicrobial-agent resistant E. coli, decreased effectiveness of antimicrobials in infections, and high treatment costs (4, 10, 12, 42). The administration of antimicrobial agents in management of STEC infections may cause disease progression by release of shiga toxins in vivo through bacterial cells lysis finally resulting in host cell death (43). Hence, the dissemination of resistance to antimicrobial agents among STEC isolates may have potential negative clinical implications for therapeutic advancement recommending antimicrobial therapy combined with oral administration of shiga toxin binding or inactivating agents in STEC infections (44). Resistance to multiple antimicrobials agents in ETEC from surface waters has been reported (4). Our observations indicate that 66.7, 33.3, and 26.7% of ETEC isolates were resistant to amoxycillin, cephalothin, and tetracycline, respectively. The resistance to amoxycillin was found associated with resistance to cephalothin in 26.7% of ETEC. The resistance to tetracycline and cephalothin has been reported frequently from animal and surface water ETEC isolates (4, 12, 23). Detection of multi-antimicrobial-agent resistant ETEC and STEC in surface waters of the river Ganga is alarming. Other than pilgrims, the human population may be at great risk of contracting infections due to use of the river water daily for bathing, washing laundry, and cooking. Therefore, increased surveillance of surface waters and development of prevention strategies for protection of public health is necessary. The drug resistance and virulence gene profiles of E. coli in surface waters will prove useful in development of molecular tools and risk assessment strategies for identification of the emerging virulent strains causing diarrheal diseases in the human population, particularly children.
Acknowledgments We are thankful to Dr. C. M. Gupta, Director, Industrial Toxicology Research, Centre, Lucknow, for providing the necessary facilities for this study. We are grateful to the Council of Scientific and Industrial Research (CSIR) for providing financial support for the study in the Network Project: SMM-05. The financial assistance to S.R. (Senior Research Fellow) and P.V. (Young Scientist) from CSIR and Department of Science and Technology, Government of India, New-Delhi, respectively, is sincerely acknowledged. ITRC manuscript number 2538.
Supporting Information Available Description of sampling sites, names of the antimicrobial agents tested, quantitative enumeration of coliform bacteria at selected sites, methodology for PCR primer designing, isolation of DNA, and PCR amplification of virulence genes including gel pictures. This material is available free of charge via the Internet at http://pubs.acs.org.
Literature Cited (1) Anderson, K. L.; Whitlock, J. E.; Harwood, V. J. Persistence and differential survival of fecal indicator bacteria in subtropical waters and sediments. Appl. Environ. Microbiol. 2005, 71, 30413048. (2) Kaper, J. B.; Nataro, J. P.; Mobley, H. L. Pathogenic Escherichia coli. Nat. Rev. Microbiol. 2004, 2, 123-140.
(3) Kuhnert, P.; Boerlin, P.; Frey, J. Target genes for virulence assessment of Escherichia coli isolates from water, food and the environment. FEMS Microbiol. Rev. 2000, 24, 107-117. (4) Begum, Y. A.; Talukder, K. A.; Nair, G. B.; Qadri, F.; Sack, R. B.; Svennerholm, A. M. Enterotoxigenic Escherichia coli isolated from surface water in urban and rural areas of Bangladesh. J. Clin. Microbiol. 2005, 43, 3582-3583. (5) Bruneau, A.; Rodrigue, H.; Isma¨el, J.; Dion, R.; Allard, R. Outbreak of E. coli O157:H7 associated with bathing at a public beach in the Montreal- Centre region. Can. Commun. Dis. Rep. 2004, 30, 133-136. (6) Ashbolt, N. J. Microbial contamination of drinking water and disease outcomes in developing regions. Toxicology 2004, 198, 229-238. (7) Obi, C. L.; Green, E.; Bessong, P. O.; De-Villiers, B.; Hoosen, A. A.; Igumbor, E. O.; Potgieter, N. Gene encoding virulence markers among Escherichia coli isolates from diarrhoeic stool samples and river sources in rural Venda communities of South Africa. Water SA 2004, 30, 37-42. (8) Ahmed, W.; Neller, R.; Katouli, M. Host species-specific metabolic fingerprint database for Enterococci and Escherichia coli and its application to identify sources of fecal contamination in surface waters. Appl. Environ. Microbiol. 2005, 71, 44614468. (9) Lin, J.; Biyela, P. T.; Puckree, T. Antibiotic resistance profiles of environmental isolates from Mhlathuze river, Kwazulu- natal (RSA). Water SA 2004, 30, 23-28. (10) Qadri, F.; Svennerholm, A. M.; Faruque, A. S. G.; Sack, R. B. Enterotoxigenic Escherichia coli in developing countries: epidemiology, microbiology, clinical features, treatment and prevention. Clin. Microbiol. Rev. 2005, 18, 465-483. (11) Edge, T. A.; Hill, S. Occurrence of antibiotic resistance in Escherichia coli from surface waters and fecal pollution sources near Hamilton, Ontario. Can. J. Microbiol. 2005, 51, 501-505. (12) Ram, S.; Shanker, R. Plasmid and drug resistance of sorbitol non- fermenting cefixime-tellurite resistant Escherichia coli isolates from Gomti river. Bull. Environ. Contam. Toxicol. 2005, 75, 623-628. (13) Olapade, O. A.; Depas, M. M.; Jensen, E. T.; McLellan, S. L. Microbial communities and fecal indicator bacteria associated with Cladophora mats on beach sites along Lake Michigan shores. Appl. Environ. Microbiol. 2006, 72, 1932-1938. (14) Winfield, M. D.; Groisman, E. A. Role of non-host environment in the life styles of Salmonella and Escherichia coli. Appl. Environ. Microbiol. 2003, 69, 3687-3694. (15) Khan, A.; Das, S. C.; Ramamurthy, T.; Sikdar, A.; Khanam, J.; Yamasaki, S.; Takeda, Y.; Nair, G. B. Antibiotic resistance, virulence gene, and molecular profiles of shiga toxin-producing Escherichia coli isolates from diverse sources in Calcutta, India. J. Clin. Microbiol. 2002, 40, 2009-2015. (16) Central Pollution Control Board. Annual Report 2001-2002. Chapter V: Air and Water Quality Monitoring Network; 2002; http://www.cpcb.nic.in/oldwebsite/ar2002/ar1- 2ch5.htm. (17) Central Pollution Control Board. National Water Quality Monitoring at a Glance; 2005; http://www.cpcb.nic.in/oldwebsite/wq-2005/watmain2005.htm. (18) American Public Health Association. Standard Methods for the Examination of Water and Wastewater, 19th ed.; American Public Health Association: Washington, DC, 1998. (19) Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; Fifteenth informational supplement M100-S15; Clinical and Laboratory Standards Institute: Wayne, PA, 2005. (20) Olive, T. M. Detection of enterotoxicogenic Escherichia coli after polymerase chain reaction amplification with a thermostable DNA polymerase. J. Clin. Microbiol. 1989, 27, 261-265. (21) Kong, R. Y. C.; So, C. L.; Law, W. F.; Wu, R. S. S. A sensitive and versatile multiplex PCR system for the rapid detection of enterotoxigenic (ETEC), enterohaemorrhagic (EHEC) and enteropathogenic (EPEC) strains of Escherichia coli. Mar. Pollut. Bull. 1999, 38, 1207-1215. (22) Seigal, S.; Catellan, N. J., Jr. Nonparametric Statistics for Behavioral Sciences; McGraw Hill: NewYork, 1987. (23) Boerlin, P.; Travis, R.; Gyles, C. L.; Reid-Smith, R.; Janecko, N.; Lim, H.; Nicholson, V.; McEwen, S. A.; Friendship, R.; Archambault, M. Antimicrobial resistance and virulence genes of Escherichia coli from swine in Ontario. Appl. Environ. Microbiol. 2005, 71, 6753-6761. (24) World Health Organization. Guidelines for Safe Recreational Water Environments; Vol. 1, Coastal and Fresh waters; ISBN 92 4 154580; 2003. VOL. 41, NO. 21, 2007 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
7387
(25) Babu, N. R.; Kumar, A. Environmental Management Plan for Kanpur Urban Area; 2002; http://www.gisdevelopment.net/ application/environment/conservation/envm0002.pf.htm (26) Webster, L. F.; Thompson, B. C.; Fulton, M. H.; Chestnut, D. E.; Vandolah, R. F.; Leight, A. K.; Scott, G. I. Identification of sources of Escherichia coli in South Carolina estuaries using antibiotic resistance analysis. J. Exp. Mar. Biol. Ecol. 2004, 298, 179-195. (27) Karlowsky, J. A.; Hoban, D. J.; Decorby, M. R.; Laing, N. M.; Zhanel, G. G. Fluroquinolone-resistant urinary isolates of Escherichia coli from out patients are frequently multi drug resistant: results from North American Urinary tract infection collaborative alliance - quinolone resistance study. Antimicrobiol. Agents Chemother. 2006, 50, 2251-2254. (28) Prescott, J. F.; Baggot, J. D.; Walker, R. D. Antimicrobial Therapy in Veterinary Medicine; Iowa State University Press: Ames, IA, 2000. (29) Spears, K. J.; Roe, A. J.; Gally, D. L. A comparison of enteropathogenic and enterohaemorrhagic Escherichia coli pathogenesis. FEMS Microbiol. Lett. 2006, 255, 187-202. (30) Kumar, H. S.; Karunasaga, I.; Karunasagar, I.; Teizou, T.; Shima, K.; Yamasaki, S. Characterization of shiga Toxin producing Escherichia coli (STEC) isolated from seafood and beef. FEMS Microbiol. Lett. 2004, 233, 173-178. (31) Wani, S. A.; Samanta, I.; Munshi, Z. H.; Bhat, M. A.; Nishikawa, Y. Shiga toxin producing Escherichia coli and enteropathogenic Escherichia coli in healthy goats in India: occurrence and virulence properties. J. Appl. Microbiol. 2006, 100, 108-113. (32) Boerlin, P.; McEwen, S. A.; Boerlin-Petzold, F.; Wilson, J. B.; Johnson, R. P.; Gyles, C. L. Associations between virulence factors of shiga toxin-producing Escherichia coli and disease in humans. J. Clin. Microbiol. 1999, 37, 497-503. (33) Mead, P.; Griffin, P. M. Escherichia coli O157:H7. Lancet 1998, 352, 1207-1212. (34) Law, D. Virulence factors of Escherichia coli O157 and other Shiga toxin-producing E. coli. J. Appl. Microbiol. 2000, 88, 729745. (35) Gaastra, W.; Svennerholm, A. M. Colonization factors of human enterotoxigenic Escherichia coli (ETEC). Trends Microbiol. 1996, 4, 444-452. (36) Smith, H. W.; Halls, S. The transmissible nature of the genetic factors in Escherichia coli that controls enterotoxin production. J. Gen. Microbiol. 1968, 52, 319-334.
7388
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 41, NO. 21, 2007
(37) Hacker, J.; Blum-Oehler, G.; Mu ¨ hldorfer, I.; Tscha¨pe, H. Pathogenicity islands of virulent bacteria: structure, function and impact on microbiological evolution. Mol. Microbiol. 1997, 23, 1089-1097. (38) Higgins, J. A.; Belt, K. T.; Karns, J. S.; Russell-Anelli, J.; Shelton, D. R. tir- and stx-positive Escherichia coli in stream waters in a metropolitan area. Appl. Environ. Microbiol. 2005, 71, 25112519. (39) Carrillo, M.; Estrada, E.; Hazen, T. C. Survival and enumeration of faecal indicators Bifidobacterium adolescentis and Escherichia coli in a tropical rain water shed. Appl. Environ. Microbiol. 1985, 50, 468-476. (40) Mora, A.; Blanco, J. E.; Blanco, M.; Alonso, M. P.; Dhabi, G.; Echeita, A.; Gonza´lez, E. A.; Berna´rdez, M. I.; Blanco, J. Antimicrobial resistance of shiga toxin (verotoxin) - producing Escherichia coli O157: H7 and non-O157 strains isolated from humans, cattlle, sheep and food in Spain. Res. Microbiol. 2005, 156, 793-806. (41) Cergole-Novella, M. C.; Nishimura, L. S.; Irino, K.; Vaz, T. M. I.; De Castra, A. F. P.; Lomil, L.; Guth, B. E. C. Stx genotypes and antimicrobial resistance profiles of shiga toxin - producing Escherichia coli strains isolated from human infections, cattle and foods in Brazil. FEMS Microbiol. Lett. 2006, 259, 234-239. (42) Okeke, I. N.; Edelman, R. Dissemination of antibiotic resistant bacteria across geographic borders. Clin. Infect. Dis. 2001, 33, 364-369. (43) Yoh, M.; Honda, T. The stimulating effect of fosfomycin, an antibiotic in common use in Japan, on production/release of verotoxin-1 from enterohaemorrhagic Escherichia coli O157: H7 in vitro. Epidemiol. Infect. 1997, 119, 101-103. (44) MacConnachie, A. A.; Todd, W. T. Potential therapeutic agents for the prevention and treatment of haemolytic uraemic syndrome in shiga toxin producing Escherichia coli infection. Curr. Opin. Infect. Dis. 2004, 17, 479-482.
Received for review May 24, 2007. Revised manuscript received August 15, 2007. Accepted August 20, 2007. ES0712266
