Probing DNA Duplex Formation and DNA−Drug Interactions by the

The drug exhibits a strict requirement for binding to the 3' side of a .... At 25 MHz the 1:200 diluted 12-mer duplex DNA sample exhibits a Δf of −...
14 downloads 0 Views 74KB Size
Download PDF
8300

Langmuir 2001, 17, 8300-8304

Probing DNA Duplex Formation and DNA-Drug Interactions by the Quartz Crystal Microbalance Technique Lisa H. Pope,† Stephanie Allen, Martyn C. Davies, Clive J. Roberts,* Saul J. B. Tendler, and Philip M. Williams Laboratory of Biophysics and Surface Analysis, School of Pharmaceutical Sciences, The University of Nottingham, Nottingham, NG7 2RD, U.K. Received June 27, 2001. In Final Form: September 4, 2001 The detection of duplex formation for tethered films of 12-mer (d(CGCAAAAAAGCG)) and 34-mer ((d(GCGTTCATTGTGGTGATATGTGCGCAAAAAAGCG)) oligonucleotides and of subsequent small molecule (nogalamycin and berenil) binding is demonstrated using the quartz crystal microbalance (QCM) technique. The mass change sensitivity of the QCM technique is exploited to identify the binding of approximately two nogalamycin molecules per 12-mer duplex and seven nogalamycin molecules per 34mer duplex. These data are consistent with previous reports of steric hindrance between nogalamycin molecules blocking simultaneous binding to closely spaced 5′TpG and 5′CpG sites. No consistent or significant shifts in frequency or dissipation were observed on exposure of the 12-mer or 34-mer films to berenil. This observation suggests that berenil binding has the net result of displacing a mass equivalent of 12-20 water molecules. The effect of packing within the 12-mer duplex films has been investigated, revealing interduplex separations at different surface concentrations of DNA and a minimum interduplex distance of 2.6 nm. The films formed from the 34-mer are demonstrated to increase energy dissipation in the oscillated film compared to that for the 12-mer, and this is proposed to result from increased duplex length and possibly interduplex entanglement. This conclusion is supported by a rise in dissipation observed as the 34-mer duplex length increases due to nogalamycin intercalation.

Introduction The study of small ligands interacting with nucleic acids is a major area of research that has particular relevance in our understanding of drug-DNA interactions involved in chemotherapeutic applications.1-6 From these studies it is known that drug binding can have many distinct modes including intercalation, groove binding, and crosslinking. Besides the core techniques of X-ray crystallography and nuclear magnetic resonance spectroscopy in the characterization of binding modes,7,8 many other biophysical approaches have been utilized to elucidate DNA-drug interactions in relation to both sequence and structure. For example, surface plasmon resonance based technologies for biospecific interaction analysis have enabled monitoring of drug-DNA reactions in real time.9 In this study we exploit the quartz crystal microbalance (QCM) technique to study the interaction of two low * To whom correspondence should be addressed. Telephone: +44 (0)115 9515048. Fax: +44 (0)115 9515110. E-mail: clive.roberts@ nottingham.ac.uk. † Current address: Biophysical Techniques, Department of Applied Physics, University of Twente, P.O. Box 217, 7500 AE Enschede, The Netherlands. (1) Yang, X. L.; Wang, A. H. J. Pharmacol. Ther. 1999, 83, 181. (2) Zlatanova, J.; Yaneva, J.; Leuba, S. H. FASEB J. 1998, 12, 791. (3) Mulchandani, A.; Pan, S. T.; Chen, W. Biotechnol. Prog. 1999, 15, 130. (4) Rogers, K. R.; Mascini, M. Field Anal. Chem. Technol. 1998, 2, 317. (5) Horvath, J. J. In Affinity Biosensors: Techniques and Protocols; Rogers, K. R., Mulchandani, A., Eds.; Humana Press: Totowa, NJ, 1998; pp 161-172. (6) Danielsson, B.; Mecklenburg, M. In Biosensors for Direct Monitoring of Environmental Pollutants in Field; Nikolelis, D. P., Krull, U. J., Wang, J., Mascini, M., Eds.; Kluwer Academic Publishers: Boston, 1997; Vol. 38, pp 87-95. (7) Smith, C. K.; Davies, G. J.; Dodson, E. J.; Moore, M. H. Biochemistry 1995, 34, 415. (8) Billeter, M. Perspect. Drug Discovery Des. 1995, 3, 151. (9) Gambari, R.; Feriotto, G.; Rutigliano, C.; Bianchi, N.; Mischiati, C. J. Pharmacol. Exp. Ther. 2000, 294, 370.

molecular weight drugs binding to short duplex sequences in an intercalative (nogalamycin) and groove binding manner (berenil). Under ideal conditions, the QCM technique can detect mass changes of 1 ng‚cm-2. On the basis of the work of Sauerbrey,10 at 25 MHz each shift of 1 Hz in the resonant frequency of the crystal corresponds to a mass change of 3.5 ng‚cm-2. This remarkable mass sensitivity has been exploited to study a variety of DNA based interactions, including the detection of single basepair mismatches during peptide nucleic acid-DNA hybridization,11 doxorubicin-DNA binding,12 immobilization of DNA via a self-assembled monolayer of intercalative molecules,13 and enzymatic cleavage of nucleic acids.14 To achieve detection of doxorubicin binding to DNA (23-mer) through a mass change, doxorubicin was conjugated with a 200 kDa dextran polymer, and the DNA surface coverage approached 90%. Other work of note includes the detection of RNA hybridization15 and peptide-RNA binding (12 and 40 amino acids in length).16 Here we demonstrate the direct detection of binding of a 772 Da molecule (nogalamycin) without the need for amplification of mass through such a conjugation approach. The key to the application of the QCM technique to the study of biomolecular interactions is the formation of suitably immobilized biomolecular films. A number of methods have been employed to bind DNA to surfaces for use in sensing devices such as surface plasmon resonance sensors, acoustic wave devices, electrochemical sensors, (10) Sauerbrey, G. Z. Phys. 1959, 155, 206. (11) Wang, J.; Nielson, P. E.; Jiang, M.; Cai, X.; Fernandes, J. R.; Grant, D. H.; Ozsoz, M.; Beglieter, A.; Mowat, M. Anal. Chem. 1997, 69, 5200. (12) Yang, M.; Yau, H. C. M.; Chan, H. L. Langmuir 1998, 14, 6121. (13) Higashi, N.; Takahashi, M.; Niwa, M. Langmuir 1999, 15, 111. (14) Wang, J.; Jiang, M.; Palecek, E. Bioelectrochem. Bioenerg. 1999, 48, 477. (15) Su, H. B.; Chong, S.; Thompson, M. Langmuir 1996, 12, 2247. (16) Furtado, L. M.; Su, H. B.; Thompson, M.; Mack, D. P.; Hayward, G. L. Anal. Chem. 1999, 71, 1167.

10.1021/la0109821 CCC: $20.00 © 2001 American Chemical Society Published on Web 12/01/2001

DNA Duplex Formation and DNA-Drug Interactions

Langmuir, Vol. 17, No. 26, 2001 8301

mycin has bulky sugar groups at either end of a planar aglycon chromophore, the DNA must either transiently open or flex along the helix axis to allow insertion of the chromophore between the base pairs. The binding process hence induces gross conformational deformations to the DNA helix, which in turn means that binding kinetics are slow.7,25,26 Berenil (1,3-bis(4′′-amidinophenyl)triazene) is an aromatic diamidine antitrypanosomal agent (Figure 1b), with a marked preference for AT rich sequences of DNA. It interacts via at least two hydrogen bonds and electrostatic interactions.27 The biological action of berenil, like other minor grove binding drugs, remains to be fully described, but evidence exists to suggest that it competes with regulatory proteins.28 The binding of berenil results in stabilization of the double helix and a consequential increase in melting temperature. Berenil can exhibit both minor groove binding and intercalation properties;29 however, in the 12-mer sequence chosen here, which consists of six AT base pairs flanked by three GC base pairs, the predominant mode of binding is expected to be with the central AT region of a narrow minor groove. Figure 1. Structures of (i) nogalamycin and (ii) berenil.

and quartz crystal microbalance electrodes. When considering the choice of immobilization method, the final desired coverage, molecular orientation, and point of DNA attachment are important factors. Direct physical adsorption,17 complexation,18 cross-linking,19 and direct covalent attachment17,18,20 have all been employed. Here we have chosen to immobilize C16-alkanethiol functionalized single-stranded oligonucleotides via their 5′ ends. A mixed self-assembled monolayer is prepared using undecanol-thiol molecules as spacer molecules in order to control surface coverage and molecular orientation. Force spectroscopy studies using the atomic force microscope have shown that for this type of functionalized surface the immobilized oligonucleotide is able to hybridize with its complementary strand.21 The use of short alkanethiol linkages has the added benefit of placing the DNA strands close to the quartz crystal microbalance sensor surface; hence, viscoelastic decoupling and a resultant loss in mass sensitivity are avoided.22 Nogalamycin, an antitumor anthracycline (Figure 1a), has a binding mode whereby the two end groups align one in each groove of the DNA double helix while the central drug chromophore is intercalated between adjacent base pairs.23 The sequence selectivity of the nogalamycin-DNA interaction has been studied by X-ray crystallography and NMR spectroscopy, 7,24-26 which reveal a distinct preference for binding at 5′TpG and 5′CpG sites. The drug exhibits a strict requirement for binding to the 3′ side of a pyrimidine and the 5′ side of a purine.26 Since nogala(17) Henke, L.; Krull, U. J. Can. J. Anal. Sci. Spectrosc. 1999, 44, 61. (18) Kato, K.; Ikada, Y. Biotechnol. Bioeng. 1996, 51, 581. (19) Huang, E.; Zhou, F. M.; Deng, L. Langmuir 2000, 16, 3272. (20) Watterson, J. H.; Piunno, P. A. E.; Wust, C. C.; Krull, U. J. Langmuir 2000, 16, 4984. (21) Pope, L. H.; Davies, M. C.; Laughton, C. A.; Roberts, C. J.; Tendler, S. J. B.; Williams, P. M. Euro Biophys. Lett. 2001, 30, 53. (22) Fawcett, N. C.; Craven, R. D.; Zhang, P.; Evans, J. A. Anal. Chem. 1998, 70, 2876. (23) Egli, M.; Williams, L. D.; Frederick, C. A.; Rich, A. Biochemistry 1991, 30, 364. (24) Smith, C. K.; Brannigan, J. A.; Moore, M. H. JMB 1996, 263, 237. (25) Searle, M. S.; Bicknell, W. European J. Biochemistry 1992, 31, 45. (26) Williams, H. E. L.; Searle, M. S. J. Mol. Biol. 1999, 290, 699.

Materials and Methods Preparation of DNA Functionalized Gold QCM Surfaces and Drug Solutions. The functionalized gold surfaces were prepared using the technique described by Noy et al.30 where gold-thiol chemistry is employed to covalently attach singlestranded oligonucleotides. Mixed self-assembled monolayers (SAMs) of oligonucleotides tethered to alkanethiols and alcoholthiols were generated by this procedure. Films of undiluted oligonucleotides tethered to alkanethiols were also produced for comparison purposes. Single-stranded oligonucleotides of sequence d(CGCAAAAAAGCG) were tethered to the gold substrate via hexadecanethiol. A 34-mer olignonucleotide ending in the same sequence (d(GCGTTCATTGTGGTGATATGTGCGCAAAAAAGCG)) was also immobilized in a similar manner for comparison with the undiluted 12-mer film. The alkane chains served to generate enough conformational freedom to promote recognition of and binding with the complementary partner molecule in duplex formation. The mixed SAM of oligonucleotides with undecanol-thiol molecules was employed to space the oligonucleotides over the surface (1 in 200 dilution of surface functionality). The oligonucleotides were attached via their 5′ ends. Following cleaning in piranha solution and oxygen plasma treatment (10 W for 30 s), QCM gold substrates were incubated overnight in a solution containing 1 µM hexadecanediol-5′thiophosphate oligonucleotides (solid-phase synthesis and FPLC purification by Oswel Research Products Ltd, University of Southampton, U.K.), 200 µM undecanol-thiol, 75% ethanol, and 40 mM tris buffer (pH 7). We have subsequently shown by high resolution X-ray photon spectroscopy (XPS) on similarly prepared gold substrates that there are no competitive binding effects between the alcohol-thiol molecules and the oligonucleotide-thiol molecules in the generation of the mixed SAM.21 Following incubation, the functionalized QCM surfaces were rinsed in deionized water to remove loosely bound material, stored in 20 mM Tris buffer (pH 7), and used on the same day for QCM experiments. For duplex formation studies, a nonthiolated complementary sequence was prepared at 1 µM in 20 mM TrisHCl, 10 mM MgCl2, pH 7 buffer. Similar solutions of noncomplementary oligonucleotides (d(AAAAAAAAAAAA) and d(AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA)) were prepared as controls for the 12-mer and 34-mer experiments, respectively. For drug binding studies, berenil and nogalamycin (27) Schmitz, H.-U.; Hu¨bner, W. Biophys. Chem. 1993, 48, 61. (28) Chang, S.-Y.; Welch, J.; Rauscher, F. J.; Beerman, T. A. Biochemistry 1994, 33, 7033. (29) Pilch, D. S.; Kirolos, M. A.; Liu, X.; Plum, G. E.; Breslauer, K. J.Biochemistry 1995, 34, 9962. (30) Noy, A.; Vezenov, D. V.; Kayyem, J. F.; Meade, T. J.; Lieber, C. M. Chem. Biol. 1997, 4, 519.

8302

Langmuir, Vol. 17, No. 26, 2001

solutions at 50 µM were prepared in 20 mM Tris-HCl, 10 mM MgCl2, pH 7 buffer (berenil exhibits two positive charges at pH 7). At concentrations less than 10 mM, berenil has been shown not to self-associate.31 All solutions were filtered prior to use. QCM Apparatus and Experimental Protocol. QCM is a mass detection technique, in which changes in the resonant frequency (f) of a quartz crystal are monitored as material becomes bound to its surface.10,32 Recently, an extended version of the QCM, “QCM-D”, was developed, where the damping of the crystal oscillation in liquid, that is, the energy dissipation factor (D), could also be measured in order to detect changes in the viscoelastic properties of surface-immobilized molecules.33 The combined information from simultaneously recorded changes in f and D makes the QCM-D technique a powerful technique to study viscoelastic monolayers, biofilms, and small proteins in liquid. The QCM-D measurements were performed utilizing a Q-Sense D300 measurement system (Q-Sense AB, Gothenburg, Sweden). The QCM-D sensor crystals consisted of 14 mm diameter, 5 MHz AT-cut quartz crystals, which were gold coated. In liquid environments, the limit for the mass sensitivity was on the order of 5 ng‚cm-2, and the dissipation factor (D) was approximately 3 × 10-7 for the unloaded 5 MHz crystal. The crystal resonant frequency shift (∆f) and the dissipation factor (∆D) of the oscillator were measured simultaneously at the fundamental resonant frequency (5 MHz) and at a number of overtones including 25 MHz (used for the data presented here). All samples were introduced into an axial flow chamber (QAFC 301) which comprised a T-loop to thermally equilibrate the sample (0.5-0.6 mL) at 23 ( 0.1 °C for 2 min, before they were introduced into the measurement chamber. This resulted in small pressure changes observable in the D and f traces as the samples were introduced into the T-loop. Repeated measurements of the effects discussed in this paper revealed consistent frequency and dissipation shifts. A steady baseline was acquired prior to starting all measurements. The sequence of injections into the QCM cell for an experimental run was as follows: 0.5 mL of noncomplementary oligonucleotide (control), flush with buffer, 0.5 mL of complementary oligonucleotide, flush with buffer, 1 mL of berenil solution, flush with buffer (last two steps repeated in the diluted film case to confirm zero observed shift), 1 mL of nogalamycin solution.

Results and Discussion Duplex Formation. At 25 MHz oscillation frequency for the 1:200 diluted 12-mer oligonucleotide samples, no shift was observed following their exposure to the solution of the noncomplementary sequence. Besides acting as a control for specific base recognition, this result demonstrates that no significant nonspecific adsorption of the noncomplementary sequence occurs. However, a ∆f of -19 Hz is observed (Figure 2) following exposure to the solution of the complementary sequence, demonstrating the specificity of binding. The molecular weight of the d(CGCTTTTTTGCG) is 3672, and the mass of the water associated with the formed duplex as observed in X-ray crystallography studies is 1278. While use of X-ray data to estimate the number of water molecules is not without problems, such as dependence upon resolution of data and effects of crystal packing, it nevertheless remains the best current estimate that can be made. There is much less data available on the level of associated water with single stranded DNA. However, a gravimetric study by White et al. suggests that 1.4 water molecules per nucleotide could be expected for the immobilized d(CG(31) Pilch, D. S.; Kirolos, M. A.; Breslauer, K. J. Biochemistry 1995, 34, 16107. (32) O’Sullivan, C. K.; Guilbault, G. G. Biosens. Bioelectron. 1999, 14, 663. (33) Rodahl, M.; Ho¨o¨k, F.; Krozer, A.; Brzezinski, P.; Kasemo, B. Rev. Sci. Instrum. 1995, 66, 3924.

Pope et al.

Figure 2. Frequency and dissipation shifts against time for 1:200 diluted 12-mer oligonucleotide samples exposed to berenil (50 µM) and nogalamycin (50 µM). A ∆f of -19 Hz was observed following introduction of the complementary sequence. No shift was observed for the noncomplementary sequence. A ∆f of -10 Hz is observed on binding of nogalamycin. No consistent or significant shifts in frequency or dissipation were observed on exposure to berenil. Arrows marked b indicate a buffer wash. The frequency shift at around 80 min was due to the passage of a bubble over the sensor surface.

CAAAAAAGCG) prior to duplex formation.34 Hence, an estimate of molecular weight change on duplex formation is 4644 per duplex. Therefore, to obtain an estimate of the number of duplex molecules formed, we need to relate the observed frequency shift directly to a mass change. This is possible through the approach pioneered for air based experiments by Sauerbrey.35 However, some justification for employing this approach is needed, bearing in mind the potential limitations of this model to measurements performed in a liquid environment. The very low dissipation shifts observed here suggest that the covalently bound oligonucleotides form a fairly rigid film at the surface,35 as required for the valid application of the Sauerbrey equation. Furthermore, the dimensions of the oligonucleotides employed here fall well within the layer thickness range where the Sauerbrey relation is likely to hold,35 and hence we use this approach here. Therefore, the shift of -19 Hz observed on duplex formation, which corresponds to a mass increase of 67.3 ng‚cm-2, gives an estimate of 8.7 × 1012 for the number of duplex strands formed per square centimeter. This correlates well with previously reported surface densities determined from radioactive labeling studies of 5 × 1012 cm-2 where the same immobilization protocol, albeit on flat gold as opposed to a relatively rough QCM surface, was employed.30 The calculated surface density can alternatively be expressed as an average separation distance between duplex molecules of 3.4 nm, compared with the duplex molecular width of 2 nm. At 25 MHz oscillation frequency for the undiluted 12mer oligonucleotide samples, a ∆f of -32 Hz is observed upon hybridization with the complementary DNA strand (Figure 3). Following the previous discussion, this frequency shift corresponds to a mass change of 113.3 ng‚cm-2, which gives an estimate of 1.5 × 1013 duplex strands per cm2 and an average separation distance between duplex molecules of 2.6 nm. Clearly, the use of the undiluted oligonucleotide does not produce a corresponding increase in mass change after duplex formation, as might be expected compared to the case of the 1:200 diluted sample, but only an approximate 60% increase in (34) White, A. P.; Reeved, K. K.; Snyder, E.; Farrell, J.; Powell, J. W.; Mohan, V.; Griffey, R. H.; Sasmor, H. Nucleic Acids Res. 1996, 24, 3261. (35) Ho¨o¨k, F.; Rodahl, M.; Kasemo, B.; Brzezinski, P. Proc. Natl. Acad. Sci. U.S.A. 1998, 95, 12271.

DNA Duplex Formation and DNA-Drug Interactions

Figure 3. Frequency and dissipation shifts against time for undiluted 12-mer oligonucleotide samples exposed to berenil (50 µM) and nogalamycin (50 µM). A ∆f of -32 Hz was observed following introduction of the complementary sequence. No shift was observed for the noncomplementary sequence. A ∆f of -22 Hz is observed on binding of nogalamycin. No consistent or significant shifts in frequency or dissipation were observed on exposure to berenil. Arrows marked b indicate a buffer wash.

Figure 4. Frequency and dissipation shifts against time for undiluted 34-mer oligonucleotide samples exposed to berenil (50 µM) and nogalamycin (50 µM). A ∆f of -70 Hz was observed following introduction of the complementary sequence. No shift was observed for the noncomplementary sequence. A ∆f of -50 Hz is observed on binding of nogalamycin. No consistent or significant shifts in frequency or dissipation were observed on exposure to berenil. Arrows marked b indicate a buffer wash.

binding. We propose that this observation is due to steric hindrance between the tethered oligonucleotide strands, which have a length of ∼4 nm and a width of ∼2 nm and hence prohibit packing at densities greater than one duplex per 2.7 nm. Support for this supposition can be found from the frequency shift of 70 Hz observed for hybridization of the undiluted 34-mer (MW 10562) with its complementary strand (Figure 4). Allowing for increases in associated water, this corresponds to 1.1 × 1013 duplex strands per square centimeter with an average separation of 3.0 nm (duplex length including alkane tether is 11.6 nm). Clearly the length of the duplex has relatively little effect on packing density. In addition to the frequency shift on duplex formation, it was noted that a change in the dissipation factor also occurred. Within the limits of detection for the 12-mer samples (∆D ) 2 × 10-7 and -4 × 10-8 for the diluted and undiluted films, respectively), a relatively clear shift (∆D ) 1.1 × 10-6) is observed for the 34-mer film. The effects observed for the 12-mer film are too small to confidently be assigned to the hybridization process. However, the increase in dissipation observed for the 34-mer indicates the formation of a more energy dissipative viscoelastic layer. This may be due to the increase in duplex length on berenil binding resulting in increased energy losses through chain entanglement of the closely packed longer 34-mer duplex molecules. While speculative, support for this proposal can be drawn from comparison with the work of Kim et al.,36 who show a relationship between energy (36) Kim, J. M.; Chang, S. M.; Muramatsu, H. Polymer 1999, 40, 3291.

Langmuir, Vol. 17, No. 26, 2001 8303

Figure 5. Schematic representations of the sites for binding of nogalamycin to the (i) 12-mer and (ii) 34-mer duplexes. One strand of the duplex is shown for clarity; the arrowhead represents the direction in which the nogalose sugar points down the minor groove (adapted from ref 26). Shaded regions indicate areas of steric hindrance to simultaneous binding at nearby sites.

dissipation in a polymeric film on a QCM sensor and the level of molecular entanglement within the film. Binding of Nogalamycin. At 25 MHz the 1:200 diluted 12-mer duplex DNA sample exhibits a ∆f of -10 Hz upon binding of nogalamycin (MW 772) (50 µM). Similarly, for the undiluted oligonucleotide films, frequency shifts of -22 Hz and -50 Hz are observed for the 12-mer and 34mer samples, respectively. These data correspond to mass increases of 35.4, 77.9, and 177.0 ng‚cm-2 for the diluted 12-mer, 12-mer, and 34-mer films, respectively. Taking the surface density of duplex molecules calculated previously and following the results of Williams et al.26 that indicate the association of an additional 31 water molecules per nogalamycin molecule, this mass increase corresponds to an average binding of 1.8 ( 0.1, 2.3 ( 0.1, and 7.3 ( 0.1 nogalamycins per duplex for the 1:200 12mer, 12-mer, and 34-mer films, respectively. Nogalamycin intercalates at 5′TpG and 5′CpG sites, of which there are three for the 12-mer and eight for the 34-mer duplexes. It should be noted, however, that the proximity of 5′TpG with one of the 5′CpG sites may prohibit simultaneous binding of a nogalamycin molecule at each site (see Figure 5(i)). Previously, X-ray crystallographic studies of terminal intercalation sites such as the 5′CpG site have shown the nogalose sugar lying in the minor groove (which would subsequently prohibit binding to the 5′TpG site). It has been noted, however, that this orientation may be due to crystal packing forces, and in solution the sugar would in fact extend from the end of the duplex.7 The observation made here based upon QCM data of 1.8 and 2.3 nogalamycin molecules per duplex for the diluted and undiluted 12-mer films is consistent with a steric hindrance of simultaneous binding to the closely spaced 5′TpG and 5′CpG sites and supports the model that the nogalase moiety lies within the minor groove. This is in agreement with NMR studies of DNA in solution where binding of nogalamycin to a central site within a 6-mer duplex also reveals minor groove binding of the drug rather than extension into solution.26 Similar steric hindrance arguments can be made for the 34-mer (see Figure 5(ii)), reducing the potential number of binding sites from eight to seven. Allowing for our assumptions concerning the role of water in the mass change process, the number of potential binding sites is in agreement with the average values of approximately seven nogalamycins per 34-mer duplex and approximately two nogalamycins per 12-mer duplex calculated from the QCM data. Although not the focus of this paper, it is possible using the QCM technique to investigate the kinetics of binding and unbinding. For the case of nogalamycin we noted that once bound it was very difficult to remove (data not shown). This is consistent with the previous observations7,25 which show that nogalamycin is difficult to remove from DNA due to the gross structural changes necessary. Since intercalation by each nogalamycin molecule will extend the double helix by 0.34 nm, we expect that the

8304

Langmuir, Vol. 17, No. 26, 2001

12-mer DNA increases from 4.08 to 4.76 nm in length (two nogalamycins per duplex) and from 11.56 to 13.94 nm for the 34-mer DNA (seven nogalamycins per duplex). In Figure 3 a clear increase in dissipation is observed on nogalamycin binding to the 34-mer film. This is consistent with the increase in dissipation observed and previously discussed when comparing the 34-mer duplex film to the 12-mer one. Binding of Berenil. No consistent or significant shifts in frequency or dissipation were observed on exposure of the 12-mer or 34-mer films to berenil solutions, despite an excess of 3 to 4 orders of magnitude of the number of berenil molecules in solution to bound duplex molecules. Nucleic acids require a level of both bound and associated water to maintain stability.37 Indeed water-DNA interactions are of comparable strength to the noncovalent forces within the double helix. This is particularly true of tightly bound water in the first DNA hydration shell.38 Considering X-ray crystallographic data of the duplex sequence studied here, with39 and without40 bound berenil, one can expect that binding of a single molecule of berenil will displace six water molecules from the minor groove spine of hydration.38 The water observed in crystal data is necessarily that which is essentially immobilized with respect to the duplex (i.e. in the first shell). Other hydration shells of more mobile but associated water can also be expected to be affected by drug binding.41 On the basis of the positive entropic contribution on binding of berenil to poly(dA)‚poly(dT), the release of bound water has also been proposed by Breslauer et al.42 Since it is known that binding of positively charged ligands to DNA induces the release of counterions and water, the observation of no detectable shift in the QCM signal suggests that berenil binding has a net result of displacing approximately its own mass in water and counterions. We can dispose of the argument that berenil is not binding to the immobilized DNA, since complementary studies on similar samples using single molecule force spectroscopy approaches (by probe microscopy43 and optical tweezers (data not shown)) demonstrate the binding of berenil. Berenil has a molecular weight of 284, equal to approximately 16 water molecules. From the data presented here, the sensitivity of the QCM can be estimated at 1.8 ng‚cm-2 mass change per frequency shift of 0.5 Hz; frequency changes below this level would not reliably be detected. For example, in the case of the undiluted 12-mer film (which is the most dense and hence “sensitive”), a molecular weight change per duplex of 68 (or approximately three to four water molecules) would not be detected. Hence, for the binding of a single berenil molecule per duplex to remain unobserved, a mass equivalent of between 12 and 20 molecules of water would need to be displaced per binding event. It is worth noting that larger dehydration effects are expected on drug binding to the poly(dA)‚poly(dT) homopolymer duplex compared to a poly(dAT)‚poly(dAT) alternating copoly(37) Westof, E., Ed. Water and Biological Macromolecules; Macmillan Press: London, 1993. (38) Drew, H. R.; Dickerson, R. E. J. Mol. Biol. 1981, 151, 535. (39) Brown, D. G.; Sanderson, M. R.; Garman, E.; Neidle, S. J. Mol. Biol. 1992, 226, 481. (40) Edwards, K. J.; Brown, D. G.; Spink, N.; Skelly, J. V.; Neidle, S. J. Mol. Biol. 1992, 226, 1161. (41) Kubinec, M. G.; Wemmer, D. E. J. Am. Chem. Soc. 1992, 114, 8739. (42) Breslauer, K. J.; Remeta, D. P.; Chou, W.-Y.; Ferrante, R.; Curry, J.; Zaunczkowski, D.; Snyder, J. G.; Marky, L. A. Proc. Natl. Acad. Sci. U.S.A. 1987, 84, 8922. (43) Krautbauer, R.; Pope, L. H.; Schrader, T. E.; Allen, S.; Gaub, H. E. Submitted to FEBS Lett.

Pope et al.

mer.44 For example, binding of a single netropsin molecule to the minor groove of DNA releases approximately 22 water molecules for poly(d(AT))‚poly(d(AT)) and approximately 40 for poly(dA)‚poly(dT).44 It is hence reasonable to suggest that the six base pair AT sequence within the 12-mer would promote dehydration effects, consistent with the proposal that significant water is displaced upon berenil binding. Conclusions We have demonstrated the potential of detecting duplex formation for short lengths of oligonucleotides and subsequent small molecule-DNA binding using the QCM technique, with a sensitivity sufficient to identify binding of approximately two nogalamycin molecules per 12-mer duplex. In addition, the effects of packing within the 12mer duplex films have been investigated, revealing interduplex separations at different surface concentrations of DNA and a minimum interduplex distance of 2.7 nm. Besides detection of mass changes, the QCM technique may be exploited to monitor changes in energy dissipation of the oscillated film. Here this has indicated that the films formed from the 34-mer are more energy dissipative than the 12-mer films, and this is proposed to result from increased interduplex interactions and entanglement for the longer DNA. This conclusion is also supported by the increase in dissipation observed upon nogalamycin intercalation into the 34-mer duplex, a process known to increase DNA length. For the binding of the intercalator nogalamycin to the DNA duplex films, an average of 1.8, 2.3, and 7.3 nogalamycins per duplex for the diluted 12-mer, 12-mer, and 34-mer films, respectively, was detected. This is consistent with previous reports of steric hindrance blocking simultaneous binding to closely spaced 5′TpG and 5′CpG sites. No consistent or significant shifts in frequency or dissipation were observed on exposure of the 12-mer or 34-mer films to berenil solutions. This observation suggests that binding of a single berenil molecule has the net result of displacing 12-20 water molecules from the DNA duplex. The interpretation of QCM data from real-time analysis of molecular recognition events remains a complex process due not to a limit in sensitivity but to the need for more complete theoretical approaches to the behavior of the sensor in liquids and the complex nature of the process occurring. Nevertheless, we believe that the technique offers significant potential, especially if exploited as part of a complementary tool with other biophysical approaches. The ability to monitor energy dissipation at the sensor surface aids data interpretation of complex events. Acknowledgment. We respectively thank Dr. Mark Searle, Department of Chemistry, University of Nottingham, and Prof. Steve Neidle, Chester Beatty Laboratories, The Institute of Cancer Research, London, U.K., for the supply of the nogalamycin and berenil samples. L.H.P. thanks the BBSRC for postdoctoral funding. The undecanol-thiol was a kind gift from Stephan Vansteenkiste, University of Gent, Gent, Belgium. The authors would like to thank Dr. Charles Laughton for useful comment, Scientific and Medical Products Ltd (Cheshire, U.K.) for the kind loan of the Q-Sense D300 measurement system, and John Booth of Scientific and Medical Products Ltd for his comment and advice in carrying out these experiments. LA0109821 (44) Chalikian, T. V.; Breslauer, K. J. Biopolymers 1998, 48, 264.