Profiling Protein Markers Associated with Lymph Node Metastasis in

Profiling Protein Markers Associated with Lymph Node Metastasis in Prostate Cancer by DIGE-based Proteomics Analysis Jun Pang,†,‡ Wei-Peng Liu,†,‡ Xiao-Peng Liu,†,‡ Liao-Yuan Li,† You-Qiang Fang,† Qi-Peng Sun,† Shao-Jun Liu,§ Ming-Tao Li,§ Zu-Lan Su,| and Xin Gao*,† Department of Urology, The Third Affiliated Hospital, Sun Yat-sen University, Guangzhou, 510630, China, Proteomics Center, Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou, 510080, China, and Department of Pathology, The Third Affiliated Hospital, Sun Yat-sen University, Guangzhou, 510630, China Received June 15, 2009

Current predictive tools and imaging modalities are not accurate enough for preoperative diagnosis of lymph node metastatic prostate cancer (LNM PCa). Proteomic analysis is introduced to screen potential biomarkers for early detection of LNM PCa. In our initial study, protein samples from localized and LNM PCa as well as benign prostatic hyperplasia tissues were analyzed using two-dimensional fluorescence difference in gel electrophoresis (2-D DIGE) coupled with MALDI-TOF/TOF MS. We identified 58 proteins that were differentially expressed in the LNM PCa group relative to the localized PCa group. Six of these proteins, e-FABP5, MCCC2, PPA2, Ezrin, SLP2, and SM22, are functionally relevant to cancer metastasis. Expression of these proteins was therefore further validated in tissue samples from the original cohort and also from a larger, independent cohort of patients using real time PCR, Western blotting, and immunohistochemistry staining. In addition, the serum levels of e-FABP5 were also examined by ELISA. Relative to localized PCa tissues, LNM PCa tissues had increased expression of e-FABP5, MCCC2, PPA2, Ezrin, and SLP2 and decreased expression of SM22. Patients with LNM PCa had significantly higher levels of serum e-FABP5. This study presents evidence that increased expression of e-FABP5, MCCC2, PPA2, Ezrin, and SLP2 and decreased expression of SM22 are useful diagnostic markers for the existence of LNM PCa. Keywords: biomarker • lymph node metastasis • prostate cancer • proteomics

Introduction

a low probability of success in the setting of lymph node metastasis.3-5

Prostate cancer (PCa) is the most common solid organ malignancy affecting men and the second leading cause of cancer death in the United States.1 An estimated 30% of PCa patients suffer from recurrent disease after radical prostatectomy or radiation. The 5-year cancer-specific survival rate is close to 100% in men with localized PCa but is only 34% in men with distant metastasis.1 In contrast, it appears that a high proportion of men initially presenting with seemingly localized cancer have undetectable metastases that eventually progress to life-threatening metastatic tumors. PCa often migrates through the lymphatic route, depositing tumor cells into pelvic lymph nodes.2 The status of the pelvic lymph nodes provides important information regarding tumor staging, prognosis, and the decision of management because a curative approach has

Conventional staging methods such as imaging techniques and histopathological procedures are of limited value in staging patients with pelvic lymph node metastasis because these methods often fail to detect early, low-volume occult PCa metastases. Prostate specific antigen (PSA) screening was suggested to be responsible for a decline in the percentages of positive lymph nodes from 40 to 8%.3 However, when more sensitive methods such as RT-PCR and immunohistochemical (IHC) approaches were used, the percentage of positive lymph nodes appeared to remain at 15-20%.2,6 Moreover, using the sentinel lymph node detection method, the percentage of lymph node involvement was actually much higher.4,7 Thus, the incidence of pelvic lymph node metastasis in patients with PCa may be underestimated by the current diagnostic methods.3,5 Developing diagnostic biomarkers for predicting pelvic lymph node metastasis holds considerable potential for improving the treatment modalities and survival rates of PCa patients.

* To whom correspondence should be addressed. Xin Gao, Department of Urology, the Third Affiliated Hospital, Sun Yat-sen University, Tianhe Road 600, Guangzhou, 510630, China. Telephone: +86-20-85252990. Fax: +86-2085253336. E-mail: [email protected]; [email protected]. † Department of Urology, The Third Affiliated Hospital, Sun Yat-sen University. ‡ These authors contributed equally to this work. § Zhongshan School of Medicine, Sun Yat-sen University. | Department of Pathology, The Third Affiliated Hospital, Sun Yat-sen University.

216 Journal of Proteome Research 2010, 9, 216–226 Published on Web 11/07/2009

Unfortunately, before surgery, it is difficult to determine the metastasis of lymph nodes using currently available biomarkers, such as prostate specific membrane antigen (PSMA), alphamethylacyl-CoA racemase (AMACR/P504s), basal cell-specific cytokeratin antibody (34βE12), and p63 because they are not necessarily lymph node metastatic markers.8,9 Recently, several 10.1021/pr900953s

 2010 American Chemical Society

research articles

Proteomics Analysis of Prostate Cancer a

Table 1. Clinicopathological Data of PCa Patients Included in Proteomic Study pt no.

a

age

PSA

GS

TNM

1 2 3 4 5 6 7

61 70 70 68 64 67 55

71.79 15.86 65.3 62 82 16.6 45.4

5+4 3+4 5+4 4+4 4+4 4+5 4+5

8 9 10 11 12 13 14 15 16 17

67 70 65 72 65 71 69 70 72 77

32.76 4.42 9.55 36.6 9.54 21.83 27.06 7.04 14.38 54.2

Localized prostate cancer without LNM 3+3 T2bN0M0 Y 3+4 T2cN0M0 Y 2+3 T2cN0M0 Y 3+4 T2aN0M0 Y 3+3 T2bN0M0 Y 3+4 T2bN0M0 Y 3+4 T2bN0M0 Y 3+5 T2cN0M0 Y 3+4 T2cN0M0 Y 3+4 T2bN0M0 Y

Prostate cancer with LNM T3aN1M0 T3aN1M0 T3bN1M0 T3cN1M0 T2cN1M0 T3bN1M0 T3cN1M0

2D-DIGE

RT-PCR

WB

IHC

Y Y Y Y Y Y Y

Y Y Y Y Y Y Y

Y Y Y Y Y Y Y

Y Y Y Y Y Y Y

Y Y Y Y Y Y Y Y Y Y

Y Y Y Y Y Y Y Y Y

Y Y Y Y Y Y Y Y Y Y

Pt, Patient; GS, Gleason sorce; Y, yes.

studies have demonstrated that proteomics is a powerful approach to identify novel biomarkers for the early detection of PCa.10,11 However, these studies focused primarily on the localized disease and castration-resistant metastatic PCa. To date, only few studies have evaluated the protein profiles of lymph node metastatic PCa (LNM PCa). This is partly due to the fact that PCa patients with clinical lymph node involvement rarely undergo radical prostatectomy; however, some recent reports argue that extended pelvic lymph node dissection after radical prostatectomy is useful to treat patients with high-risk and LNM PCa and provides additional benefits for patient survival.12-14 In this study, we used two-dimensional fluorescence difference in gel electrophoresis (2-D DIGE) coupled with MALDITOF/TOF MS analysis to identify differentially expressed proteins in LNM PCa compared with localized PCa. Six of the identified proteins were further confirmed by RT-PCR, Western blotting, and IHC analysis to evaluate their values in predicting pelvic lymph node metastasis in PCa patients.

Patients and Methods Patients and Tissue Preparation. For 2-D DIGE proteome analysis, 17 cases of PCa who underwent radical prostatectomy and standard bilateral lymphadenectomy and 10 cases of benign prostatic hyperplasia (BPH) were collected from the Third Affiliated Hospital of Sun Yat-sen University, China. The study was approved by the Ethical Committee of the Third Affiliated Hospital of Sun Yat-sen University. Informed consent was obtained from each patient. The PCa samples were divided into two groups of localized PCa (N ) 10) and LNM PCa (N ) 7) according to the postoperative pathological examinations of pelvic lymph nodes. No patients received neoadjuvant or adjuvant therapy. The clinicopathological data of the tumor samples are summarized in Table 1. Fresh PCa and BPH tissues were obtained immediately after the surgery, and snap-frozen in liquid nitrogen and then stored at -80 °C until use. A modified manual microdissection method was used to obtain pure tumor tissue.15 Briefly, tumor specimens were embedded and sectioned using a cryostat microtome (Cryocut 1800, Leica, Germany) at -20 °C. Frozen sections (5 µm) were subsequently

cut and fixed in ethanol and then stained. Tumor areas on frozen sections (5 µm) were identified with hematoxylin and eosin staining and were marked. The tumor in the embedded tissue was then dissected according to the marked tumor area (3-6 mm in diameter) using a small needle. Frozen sections from the top and bottom of the dissected tissues were stained with hematoxylin and eosin to evaluate the purity of the tumor mass. Microdissected tissue samples were immediately snapfrozen in liquid nitrogen and then stored at -80 °C. Only manually microdissected specimens containing at least 95% tumor tissue were used for protein extraction. With regard to confirmatory studies of selected differentially expressed proteins, real time RT-PCR, Western blotting, and IHC staining were further performed in tissue samples from the original cohort and also from a larger, independent cohort of patients. In total, 58 cases of PCa (localized PCa, N ) 38; LNM PCa, N ) 20) and 30 cases of BPH were recollected. The clinicopathological characteristics of additional PCa patients were shown in Supplementary Table 1, Supporting Information. None of these patients received preoperative hormonal and radiation therapy, and none had secondary cancers. All specimens were handled and made anonymous according to the ethical and legal standards. Altogether, real time RT-PCR was performed on 16 localized PCa tissues, 16 LNM PCa tissues, and 16 BPH tissues. Western blotting was performed on 9 localized PCa tissues, 9 LNM PCa tissues and 9 BPH tissues. Paraffin-embedded specimens from 48 cases of localized PCa, 27 cases of LNM PCa and 30 cases of BPH were used to validate the expression of selected differently expressed proteins by IHC methods. Serum samples were obtained from 70 additional patients at the initial diagnosis, including 20 cases of localized PCa, 20 cases of LNM PCa and 30 cases of BPH for ELISA assay. Serum samples of 22 PCa patients (11 patients with localized PCa and 11 with LNM PCa) were taken both before and one week after surgery. Protein Sample Labeling with CyDye. Tissue (approximately 0.1 g) was homogenized in lysis buffer (7 M urea, 2 M thiourea, 30 mM Tris, 4% (w/v) CHAPS, 40 mM DTT, 0.6 mM PMSF). The supernatant was collected, purified with a 2-D Clean-up Kit (GE Healthcare BioSciences, Little Chalfont, UK), quantified Journal of Proteome Research • Vol. 9, No. 1, 2010 217

research articles with the 2-D Quant Kit, and labeled with CyDye DIGE Fluors following the Ettan DIGE user manual and as described previously.16,17 Briefly, equal amount of the protein sample in the same group were mixed and divided into four equal portions (50 µg each). Then, the latter labeled with 400pmol Cy3 or Cy5 according to the experimental design (Supplementary Table 2, Supporting Information). A pooled sample consisting of equal amounts of all samples was used as the pooled internal standard and labeled with Cy2. After incubating on ice for 30 min in the dark, the labeling reaction was stopped with 10 mM lysine. For each gel, Cy2-,Cy3- and Cy5- labeled proteins (50 µg each) were mixed and set to 450 µL with rehydration buffer (7 M urea, 2 M thiourea, 4% (w/v) CHAPS, 40 mM DTT, 1% IPG buffer (pH 4-7), 0.002% (w/v) Bromophenol blue). Two-Dimensional Electrophoresis. The labeled protein mixture of each gel was applied to Immobiline DryStrip strips (24 cm, pH 4-7; GE Healthcare). Isoelectric focusing (IEF) were performed with an Ettan IPGphor II apparatus (GE Healthcare) as follow steps: 30 V for 12 h, 500 V for 1 h, 1000 V for 1 h, and 10 000 V for up to a total of 85 000 Vh. After IEF, the proteins were reduced and alkylated by successive 15 min treatments with equilibration buffer containing 2% (w/v) DTT followed by 2.5% (w/v) iodoacetamide. The proteins then resolved in 12.5% SDS-PAGE gels using an Ettan DALTsix instrument (GE Healthcare). In order to facilitate MS analysis, 500 µg unlabeled pool protein sample was run in parallel on a preparative gel and stained by Deep Purple staining (GE Healthcare) according to the manufacturer’s instructions. Gel Image Acquisition and Analysis. Gels image were acquired on a Typhoon 9400 scanner (GE Healthcare) and analyzed using DeCyder Software (V6.0, GE Healthcare) as described previously.16,17 The protein expression patterns of LNM PCa tissue were compared with those of localized PCa and BPH tissue, respectively. The ratios of protein abundance that increased or decreased more than 1.5-fold (t-test and ANOVA, P < 0.01)16,18 were considered significant changes. The corresponding protein spots were selected in the stained preparative gel for spot picking. MALDI-TOF/TOF MS analysis. The selected protein spots in the preparative gels were automatically picked up and handled in an Ettan Spot Handling Workstation (GE Healthcare). Briefly, the spots were washed with 15 mM ammonium bicarbonatence and 50% methanol, and then digested in trypsin solution (0.02 µg/mL; sequencing grade; Promega, Madison, WI) at 37 °C for 2 h. The tryptic peptides were extracted with 50% (v/v) ACN and 0.5% (v/v) TFA, then dissolved in 5 mg/mL R-cyano-4-hydroxycinnamic acid (Amersham Bioscience) in 50% (v/v) ACN and 0.1% (v/v) TFA and spotted on the MS sample plate. MS analysis was performed using an ABI 4800 MALDI-TOF/TOF MS (Applied Biosystems, Foster City, CA) operating in positive ion reflector mode. Monoisotopic peak masses were acquired in a mass range of 900-4,000 Da, with a signal-to-noise ratio (S/N) >200. Five of the most intense ion signals, excluding common trypsin autolysis peaks and matrix ion signals, were selected as precursors for MS/MS acquisition. The peptide mass fingerprint (PMF) combined MS/MS spectra were searched against the NCBInr database using GPS ExplorerTM software (Version 3.6, Applied Biosystems) and MASCOT version 2.1 (Matrix Science). The searching parameters were set as follows: Homo sapiens, trypsin cleavage (one missed cleavage allowed), carbamidomethylation as fixed modification, methionine oxidation as 218

Journal of Proteome Research • Vol. 9, No. 1, 2010

Pang et al. variable modification, peptide mass tolerance set at 75 ppm, fragment tolerance set at 0.2 Da. The criteria of successfully identified protein follows as: ion score confidence interval (C.I.%) for PMF and MS/MS data g95%, peptide count (hit) g4 and at least two peptides of distinct sequence were identified in MS/MS analysis. Real Time PCR. Total RNA was extracted after homogenization of tissue samples using TRIzol (Invitrogen, Carlsbad, CA), DNase digestion (RNase free DNase set; Qiagen, Valencia, CA), and on-column clean up with the RNeasy MinElute kit (Qiagen, Valencia, CA). Total RNA (2 µg) was reverse transcribed with the Superscript II RNase H-reverse transcriptase kit (Invitrogen) for cDNA synthesis using random hexamer primers. The cDNA was then used as a template for real-time RT-PCR. PCR primers were as follows: epidermal fatty binding protein 5 (e-FABP5, forward: GAAACCACAGCTGATGGCAGAA, reverse: GCTGAACCAATGCAC CATCTGT), Ezrin (forward: AGCGCATCACTGAGGCAGAG, reverse: GCCGCA GCGTCTTGTACTTG), Stomatinlike protein 2 (SLP2, forward: GCTGAACAGATA AATCAGGCAGCA, reverse: GCTCGGCCACAGTCAGTGAA), methylcrotonoyl Coenzyme A carboxylase 2 (MCCC2, forward: TTTGTCCAGTTATGCTGCCAA AGA, reverse: GGCACCATCCTTGGCAATTC), inorganic pyrophosphatase 2 isoform 1 precursor (PPA2, forward: TGCTATGGCCCTGTACCACAC, reverse: TCTTAAAGAAGAGGCGGTAATTCTG), and GAPDH (forward: GCACCGTCA AGGCTGAGAAC, reverse: TGGTGAAGACGCCAGTGGA). GAPDH was used as a reference and internal control. PCR amplification was performed in a final reaction volume of 20 µL containing 2 µL of the template, 0.4 µL of ROX reference Dye (50×), 10 µL of SYBR PREMIX Ex Taq (2×) (Takara), and 0.8 µL of the genespecific forward and reverse primer mixture. The cycling conditions were: one cycle of 10 s at 95 °C, 40 cycles of 5 s at 95 °C and 31 s at 60 °C, and one cycle of 15 s at 95 °C and 1 min at 60 °C. All reactions were carried out in an ABI PRISM 7000 Sequence Detector Thermocycler (Applied Biosystems). All quantitative PCR reactions were performed in triplicate and repeated at least twice. The ∆Ct for gene-specific mRNA expression was calculated relative to the Ct (threshold cycle) of GAPDH. The ∆∆Ct was calculated by normalizing to the average ∆Ct of the 16 BPH tissue samples. Relative mRNA expression was calculated using the formula 2(-∆∆Ct).19 Western Blotting. In total, 60 µg of each protein sample was subjected to Western blotting analysis using the following antibodies: anti-eFABP5 (1:3000; monoclonal antibody, R&D systems, Inc., Minneapolis, MN), anti-MCCC2 (1:1000; polyclonal antibody, PTG, Inc., Chicago, IL), anti-PPA2 (1:1500; polyclonal antibody, Abnova Co. Taipei, Taiwan), anti-SLP2 (1: 1000; monoclonal antibody, PTG, Inc., Chicago, IL), anti-Ezrin (1:10000; monoclonal antibody, Abcam, Cambridge, UK), and antitransgelin (SM22, 1:750; polyclonal antibody, Santa Cruz Biotechnology Inc., Santa Cruz, CA), respectively. GAPDH was used as a loading control in all blotting membranes (antiGAPDH, 1:1000; monoclonal antibody, Cell Signaling Technology, MA). Every blotting membrane was arranged with 9 samples (3 cases per group) and a PageRuler prestained protein ladder (Fermentas Inc., MD). The size of molecular weight of the target protein was showed with the prestained protein ladder. According to different molecular weight of the detected proteins (eFABP5, 15KD; MCCC2, 62KD; PPA2, 37KD; SLP2, 39KD; Ezrin, 69KD and SM22, 22KD), 2-3 rounds of immunodetections were finished on the same Western blot membrane. In brief, one membrane was used to detect PPA2 and MCCC2, one membrane was used to detect SLP2 and eFABP5,

research articles

Proteomics Analysis of Prostate Cancer and another membrane was used to detect Ezrin and SM22 in a sequence. After the first round of immunodetection was finished, the blotting membrane was only rinsed three times in TBS, reblocked and incubated with the second primary antibody to begin next round of immunoblotting. After finishing 2 rounds of immunodetections of target proteins, these blotting membranes were treated with stripping buffer (2% SDS, 100 mM beta- mercaptoethanol, 50 mM Tris, pH 6.8) at 50 °C for 30 min with gentle shaking and rinsed three times in TBS. Then, the blotting membranes were reblocked and incubated with anti-GAPDH antibody to show loading controls. Immunoreactive proteins were visualized using the ECL Western blotting system (Pierce Biotechnology, Rockford, MD). Images were scanned by an ImageMaster II scanner (GE Healthcare) and analyzed using ImageQuant TL software (v2003.03, GE Healthcare). Background binding was subtracted out, and the band signals were expressed as relative protein amounts compared to GAPDH. Immunohistochemistry (IHC). IHC was performed using the DAKO En-Vision System (Dako Diagnostics, Zug, Switzerland). Antigen retrieval was performed in a pressure-cooker with 6.5 mM citrate buffer (pH 6.0), and endogenous peroxidase activity was blocked with 2.5% hydrogen peroxide in methanol for 30 min at room temperature. Nonspecific binding was blocked with 3% bovine serum albumin (BSA) in phosphate-buffered saline for 10 min. The slides were incubated with the antibodies at the following dilutions: E-FABP5 (1:50), MCCC2 (1:100), PPA2 (1:100), SLP2 (1:100), Ezrin (1:100), and SM22 (1:50). The negative controls were processed in a similar manner except that normal rabbit serum was used instead of the primary antibodies. Peroxidase-labeled polymer and substrate-chromogen were then employed to visualize the staining of the protein of interest. Following a hematoxylin counterstaining, positive immunostaining was scored by two experienced pathologists in a blinded fashion. Any discrepant scores were re-examined by both pathologists to achieve a consensus score. Tumor specimens were scored in a semiquantitative manner with the following scale: (0) less than 10% positive staining cells; (1+) 10-25%; (2+) 25-50%; (3+) more than 50%. Cases with scores of 2+ or 3+ were designated as “positive,” whereas cases with scores of 0 or 1+ were designated as “negative”.20,21 ELISA. Blood samples (3 mL) were collected in glass tubes without additive and allowed to clot at room temperature for 60 min. Serum was separated by centrifugation at 2,000 rpm for 20 min. Aliquots of serum (150 µL) were stored at -80 °C. An e-FABP5 ELISA kit was used to assess serum e-FABP5 levels according to the manufacturer’s instructions (USCN Life Science & Technology Co., MO). The microtiter plate provided in this kit was precoated with an e-FABP5-specific antibody. Briefly, standards or serum samples were added to the appropriate microtiter plate with a biotin-conjugated polyclonal antibody preparation specific for e-FABP5, and the equivalent sample diluent as sample well was added to one blank well and used as a control. Avidin conjugated to horseradish peroxidase (HRP) was added to each well and incubated. A TMB (3,3′5,5′ tetramethyl-benzidine) substrate solution was then added to each well. The enzyme-substrate reaction was terminated by the addition of sulfuric acid solution, and color change was measured spectrophotometrically at a wavelength of 450 nm. The background signal obtained from the control well was subtracted from all measurements. The concentration of e-FABP5 in the samples was then determined by comparing the optical density (OD) of the samples to the standard curve.

Statistical Analysis. The Student’s t-test and one-way ANOVA were used to calculate significant differences in the relative abundance of individual protein spot features among the three groups in the 2-D DIGE analysis. The differences in Western blotting and real time RT-PCR results among groups were compared by one-way ANOVA followed by NewmanKeuls test. Pearson χ2 test were conducted to compare IHC results and Kruskal-Wallis nonparametric test to compare the serum e-FABP5 values. The SPSS 16.0 software package (SPSS, Chicago, IL) was used to conduct the statistical analyses, and a two-tailed P value of less than 0.05 was considered statistically significant.

Results 2D-DIGE Analysis and MS/MS Identification. After 2-D DIGE analysis, a total of 2108 spots were well matched across all the gels using DeCyder software analysis. A representative 2-D DIGE gel image is shown in Figure 1. After visual reviewing, 70 protein spots with high abundance and that showed significantly altered expression in localized PCa vs LNM PCa were selected for MALDI-TOF/TOF MS analysis. A total of 58 differentially expressed proteins, including 35 that were upregulated and 23 that were down-regulated in the LNM PCa tissues, were successfully identified, and are listed in Table 2. Several spots were identified as containing the same protein. For example, spots 2384, 2412, and 2413 were each identified as containing the SM22 protein, a marker of smooth muscle. The same protein in several spots may represent different protein modifications that may be of biological relevance. For this reason, not all differentially expressed proteins were selected for MS/MS identification. For example, based on previous proteomic profiles and our preliminary tests (data not shown), cytoskeletal proteins were not selected. Another nine proteins differently expressed between the BPH and localized PCa group were also successfully identified (Table 3). The identified proteins are involved in all aspects of tumor progression and metastasis. These proteins were grouped into different functional classes: (1) cytoskeletal proteins (14 proteins, 12 down-regulated, and 2 up-regulated), (2) signal transduction proteins (7 proteins), (3) metastasis-related proteins (5 proteins), (4) molecular chaperones (5 proteins), (5) energy metabolism proteins (7 proteins), (6) carrier proteins (4 proteins), (7) enzymes (6 proteins, including hydrolase transferases and lyases), and (8) other proteins (e.g., nuclear regulating proteins and proteins of unknown function). Confirmatory Studies of Differentially Expressed Proteins by Real time RT-PCR and Western Blotting. Real time RT-PCR and Western blotting results confirmed our MALDI-TOF/TOF MS findings that the expression of five proteins, e-FABP5, MCCC2, PPA2, SLP2, and Ezrin, was significantly higher in LNM PCa tissue than in localized PCa tissue. Western blotting results also confirmed that the expression level of SM22 was significantly decreased in LNM PCa tissues. Representative results are presented in Figure 2. IHC Analysis of BPH, Localized and LNM PCa Tissues. Representative images of the IHC staining of different proteins in the individual groups are presented in Figure 3A. The positive percentages of e-FABP5, MCCC2, PPA2, SLP2, Ezrin, and SM22 expression in LNM PCa, localized PCa, and BPH tissue are listed in Figure 3B. Semiquantitative analysis revealed that the LNM PCa group had significantly higher positive percentages of e-FABP5, MCCC2, PPA2, SLP2, and Ezrin, but had significantly lower expression of SM22, relative to the localized PCa group. Journal of Proteome Research • Vol. 9, No. 1, 2010 219

research articles

Pang et al.

Figure 1. Proteomics analysis of PCa tissues. (A) Representative gel image of proteins differentially expressed in localized PCa and LNM PCa tissues. Proteins extracted from the tissues were labeled with Cy3 and Cy5, respectively. An internal standard comprised of proteins from a combination of the BPH, localized, and LNM PCa groups was labeled with the Cy2 and included in all gels. IPG strips (4-7) were used for IEF prior to standard SDS-PAGE (12.5% polyacrylamide) for the second dimension. The green spots indicate downregulated proteins, while the red spots indicate up-regulated proteins in LNM PCa group relative to the localized PCa group. The yellow arrow indicates the identified proteins that showed significantly altered expression in the localized and LNM PCa groups. The number in the figure corresponds to that presented in Table 2. (B) Functions of the identified proteins differentially expressed in localized and LNM PCa. The functions are categorized primarily according to the MeSH Tree Structure.

Serum e-FABP5 Levels. We determined the levels of serum e-FABP5 in 20 patients with localized PCa, 20 patients with LNM PCa, and 30 patients with BPH by ELISA. Figure 4A shows that the serum levels of e-FABP5 in the LNM PCa patients were significantly higher than those in the localized PCa and BPH patients. We also compared the levels of e-FABP5 in 22 PCa patients (11 with localized PCa; 11 with LNM PCa) at their initial diagnosis and one week after surgery. As shown in Figure 4B, levels of serum e-FABP5 were significantly decreased in PCa patients after surgery.

Discussion It is generally accepted that patients with pelvic lymph node metastasis have a reduced chance of PSA progression-free survival.22 Therefore, precise lymph node staging is necessary for assessing the risk of progression and planning the appropriate treatment. A major limitation of routine imaging analysis (such as CT and MRI scans) in the evaluation of pelvic lymph 220


node metastases is that the method depends on the enlargement of lymph nodes as the criterion for metastasis. The problem is that metastases may also be present in normal-sized nodes that might not be detected by CT or MRI.23 Moreover, it is not yet possible to determine the sites of microscopic foci of cancer cells by imaging analysis alone. Given that the ability of clinical markers is limited, the focus has shifted to molecular markers. In fact, various reports have shown that a higher sensitivity for detecting micrometastatic cancer cells in surgically removed pelvic lymph nodes obtained from radical prostatectomies can be achieved by several molecular and histological techniques using a profile of prostate-specific gene expression. To date, however, none of these methods have been introduced into clinical practice due to certain limitations, such as a high false-positive rate and complicated procedures.24 Protein profiles of specific stages may be more accurate in reflecting the status of disease progress. Recently, many efforts were made to identify novel metastasis- associated proteins by

research articles

Proteomics Analysis of Prostate Cancer Table 2. Differential Proteins between Localized PCa and LNMPCa Identified by MALDI-TOF/TOF MS master no.a

ratiob

protein scored

peptide count

MW/pI (kDa)

452

–2.15

collagen, type VI, alpha 1 precursor

gi|87196339

510

19

109.6/5.2

462

–3.47

vinculin isoform meta-VCL

gi|7669550

332

28

124.3/5.5

712

–1.99

FLNA protein

gi|15779184

145

14

89.3/5.9

863

–2.15

gelsolin isoform b

gi|38044288

181

13

80.8/5.5

917

2.4

ezrin

gi|46249758

231

21

69.3/5.9

918

–2.04

transferrin

gi|4557871

399

26

79.2/5.9

927

–2.15

transferrin

gi|4557871

474

27

79.2/6.8

1103

2.76

lamin B1

gi|5031877

395

29

66.6/5.1

1128

2.22

gi|156416003

269

15

73.6/7.1

1129

1.86

gi|156416003

270

15

73.6/7.1

1151

–2.06

succinate dehydrogenase complex, subunit A, flavoprotein precursor succinate dehydrogenase complex, subunit A, flavoprotein precursor lamin A/C transcript variant 1

gi|57014043

237

22

74.3/6.7

1201

–1.63

archain

gi|11863154

172

13

57.6/5.9

1226

1.94

gi|14517632

209

10

58.4/6.3

1234

–1.86

acute morphine dependence related protein 2 Dihydropyrimidinase-like 3

gi|24659471

149

11

62.3/6.0

1281

5.27

methylcrotonoyl Coenzyme A carboxylase 2 (beta)

gi|11545863

252

12

61.8/7.6

1351

1.90

3-oxoacid CoA transferase 1 precursor

gi|4557817

131

13

56.5/7.1

1364 1380 1388 1469

2.74 2.22 1.82 4.19

CCT2 CCT2 CCT2 keratin 8

gi|48146259 gi|48146259 gi|48146259 gi|4504919

82 181 280 466

8 9 11 28

57.7/6.0 57.7/6.0 57.7/6.0 53.6/5.5

1573

3.66

lamin A/C transcript variant 1

gi|57014045

177

17

55.0/6.5

1601

2.95

Chain A, X-ray Structure Of The Human mitogen activated protein kinase kinase 2 (Mek2)in A Complex

gi|56966000

93

8

39.8/6.3

1606

–2.38

mutant desmin

gi|23506465

563

24

53.5/5.2

1732

–2.89

gi|149758067

210

7

38.1/5.3

1790

2.10

PREDICTED: similar to actin, alpha 1, skeletal muscle isoform 2 Stomatin (EPB72)-like 2

gi|14603403

163

11

38.6/6.8

protein name

accession no.c

protein location/functionse

Cytoskeletal Protein/a major structural component of microfibrils within the extracellular space Cytoskeletal Protein/cell–cell and cell–matrix junctions, anchoring F-actin Cytoskeletal Protein/Anchors various transmembrane proteins to the actin cytoskeleton and serves as a scaffold for a wide range of cytoplasmic signaling proteins Cytoskeletal Protein/sever actin filaments and forms a cap on the newly exposed filament end, increasing the motility and androgen receptor coregulator Metastasis related protein/ membrane cytoskeletal cross-linker, cell adhesion, motility, cell survival and tumor metastasis Carrier Proteins/transport iron; regulated E-cadherin and beta-catenin in PCa Carrier Proteins/transport iron; regulated E-cadherin and beta-catenin in PCa nuclear matrix proteins, tumor dedifferentiation Energy Metabolism/ oxidoreductase of the mitochondrial respiratory chain Energy Metabolism/ oxidoreductase of the mitochondrial respiratory chain Nuclear stability, chromatin structure and gene expression. Others/play a fundamental role in eukaryotic cell biology, involved in vesicle structure or trafficking Others/function unknown Cytoskeletal Proteins/regulates F-actin bundling and cell migration Energy Metabolism/a heterodimer that catalyzes the carboxylation of 3-methylcrotonyl-CoA to form 3-methylglutaconyl-CoA Energy Metabolism/a homodimeric mitochondrial matrix enzyme that plays a central role in extrahepatic ketone body catabolism Molecular Chaperones Molecular Chaperones Molecular Chaperones Cytoskeletal Proteins/epithelial marker, maintaining cellular structural integrity, signal transduction and cellular differentiation. Nuclear stability, chromatin structure and gene expression Signaling transduction/protein kinase plays a critical role in mitogen growth factor signal transduction of MAPK1/ERK2 and MAPK2/ERK3 Cytoskeletal Protein/intermediate filament protein occurring exclusively in muscle and endothelial cells. Cytoskeletal Protein/unknown Novel metastasis related protein/ promotion of cell growth, cell adhesion, and tumorigenesis in esophageal squamous cell carcinoma and lymph node metastasis

Journal of Proteome Research • Vol. 9, No. 1, 2010 221

research articles

Pang et al.

Table 2. Continued master no.a

ratiob

protein name

accession no.c

protein scored

peptide count

MW/pI (kDa)

1791

2.25

Heterogeneous nuclear ribonucleoprotein C (C1/C2), hnRNP

gi|14250048

91

6

33.6/4.9

1838

2.01

Heterogeneous nuclear ribonucleoprotein C (C1/C2)

gi|14250048

204

9

33.6/4.9

1896

2.62

SEC13 homologue (S. cerevisiae)

gi|52632407

209

7

36.3/5.3

1957

–2.68

Chain A, human B lactate dehydrogenase complexed with NAD+ and Hydroxy-1,2,5-Oxadiazole-3-Carbox

gi|49259209

280

7

36.8/5.8

1963 1986

4.70 –2.6

HSPC124 splicing factor, arginine/ serine-rich 1 isoform 1

gi|6841470 gi|5902076

110 243

9 6

36.9/5.6 27.8/10.3

2049

3.79

Enoyl Coenzyme A hydratase 1, peroxisomal

gi|16924265

306

9

36.1/8.4

2120

2.39

gi|443382

110

9

30.4/5.1

2137

2.49

Chain A, Structure Of Inositol Monophosphatase the Putative Target Of Lithium Therapy cathepsin D preproprotein

gi|4503143

158

6

45.0/6.1

2139

2.16

chloride intracellular channel 4

gi|7330335

112

4

28.9/5.4

2173

2.54

endoplasmic reticulum protein 29 isoform 1 precursor

gi|5803013

202

6

29.0/6.7

2187

3.47

heat shock 27 kDa protein 1

gi|4504517

340

7

22.8/5.8

2196

4.62

Chain A, Native Human Lysosomal Beta-Hexosaminidase Isoform B

gi|30749651

359

10

58.4/6.3

2209

2.12

thioredoxin peroxidase, peroxiredoxin 4

gi|5453549

254

6

30.7/5.8

2220

–2.04

gi|15928913

169

8

21.1/5.5

2253

–2.78

Unknown (protein for IMAGE:3906970) ubiquitin carboxy-terminal hydrolase L1

gi|4185720

86

5

23.3/5.3

2257

–3.32

Chain A, Ligand-Free Human Glutathione S-Transferase M2–2

gi|4557966

98

7

25.7/6.0

2277

4.19

gi|2392338

93

5

20.8/5.1

2279

4.56

Chain A, Human Glyoxalase I With Benzyl-Glutathione inhibitor Chain A, Human Glyoxalase I With Benzyl-Glutathione inhibitor

gi|2392338

83

4

20.8/5.1

2305

–2.85

gi|2554831

89

5

23.5/5.4

2331 2340

3.15 2.46

gi|13129018 gi|5453559

130 100

8 6

21.2/5.0 18.5/5.2

2368

2.49

gi|18203882

146

7

20.1/5.5

2377

–4.25

regulatory myosin light chain long version

gi|33338062

322

6

19.9/4.8

2384

–13.98

smooth muscle protein (SM22)

gi|177175

240

11

22.5/8.5

222

Chain A, Crystal Structure Of Human Glutathione S-Transferase P1-1 Complexed With (9r,10r)-9 hypothetical protein LOC79017 ATP synthase, H+ transporting, mitochondrial F0 Ferritin, light polypeptide



Signal transduction/N-Ras gene translational regulation, regulating telomere length, breast cancer metastasis Signal transduction/N-Ras gene translational regulation, regulating telomere length, breast cancer metastasis Signal transduction/regulating of the metaphase/anaphase transition and maintaining genomic stability during mitosis energy metabolism/A tetrameric enzyme that, along with the coenzyme NAD+, catalyzes the interconversion of lactate and pyruvate Others/unkown function Signal transduction/protein binds to pre-mRNA transcripts and components of the spliceosome, activate or repress splicing depending on the location of the pre-mRNA binding site energy metabolism/peroxisomal enzyme catalyzes the reaction of fatty acid beta-oxidation cycle Others/Unknown function Metastasis related protein/ intracellular proteinase involved tumor invasion, metastasis and proliferation of cancer cells Signal transduction/regulate fundamental cellular processes Molecular chaperone/ endoplasmic reticulum secretion factor, escort chaperone and in protein folding molecular chaperone and Signal transduction/regulating proliferation and apoptosis of tumor cells Hydrolases/catalyzes the hydrolysis of N-acetylglucosamine or N-acetylgalactosamine residues from glycosidic linkages Signal tranduction/ oxidoreductases, antioxidant enzyme regulator of NF-kappaB Others/Unknown function Hydrolases/deubiquitinating enzyme, regulating of cell cycles, tumor invasion and progression and metastasis Transferases/enzymes that catalyze the cross-linking of proteins, apoptosis and metastasis of PCa Lyases/a detoxifying enzyme; tumor apoptosis resistance Lyases/catalysis and formation of S-lactoyl-glutathione from methylglyoxal condensation and reduced glutatione Transferases/cellular protection against redox-mediated damage, tumor invasion and progression Others/unkown Energy metabolism/Mitochondrial ATP synthase Carrier Proteins/iron binding protein. Cytoskeletal Proteins/signal transduction, motility and regulating the invasiveness of metastatic cancer cells Cytoskeletal Proteins/cell motility, tumor invasion and progression and signal transduction

research articles

Proteomics Analysis of Prostate Cancer Table 2. Continued master no.a

ratiob

accession no.c

protein scored

peptide count

MW/pI (kDa)

2400

–6.16

haptoglobin-related protein precursor

gi|3337391

87

5

39.3/6.6

2402

2.99

nonmetastatic cells 1, protein (NM23A) expressed in isoform a

gi|38045913

327

6

19.8/5.4

2412 2413

–5.08


gi|177175

124

7

22.5/8.5

–3.30


gi|177175

173

8

22.5/8.5

2428

3.84

keratin-10

gi|307086

65

9

46.4/5.1

2451

2.23

gi|4507793

112

4

17.1/6.1

2468

20.86

gi|4557581

131

5

15.5/6.6

2483

–2.46

ubiquitin-conjugating enzyme E2N fatty acid binding protein 5 (psoriasis-associated) Chain A, X-ray Crystal Structure Of Human Galectin-1

gi|42542977

250

4

14.8/5.3

protein name


Others/bind and remove potentially toxic free hemoglobin (Hb) from the circulation metastasis related protein/cell adhesion and migration, suppressor of cancer metastasis Cytoskeletal Proteins/smooth muscle marker Cytoskeletal Proteins/smooth muscle marker Cytoskeletal Proteins/smooth muscle marker Others/DNA postreplication repair Carrier Proteins/fatty acid binding protein, tumor Cytoskeletal Proteins/smooth muscle

a Number generated by DeCyder 2-D Differential Analysis Software V6.0. b Decreased or increased ratio of LNMPCa comparison to localized PCa. “–” mean decreased expression of protein in LNMPCa group. c Accession number of NCBInr database. d Protein with a protein score C.I% over 95% is considered successfully identified. e Protein function is mainly categorized according to MeSH Tree Structure.

Table 3. Differential Proteins between Localized PCa and BPH Identified by MALDI-TOF/TOF MS master no.a

ratiob

accession no.c

protein scored

peptide count

MW/pI (kDa)

907

2.03

transglutaminase 2 isoform a

gi|39777597

432

21

78.4/5.1

1414

–2.08

keratin 5

gi|18999435

406

23

62.5/7.6

2096

4.18

TPM1 protein

gi|29792232

125

7

32.7/5.0

2321

2.28

FTH1 protein

gi|42490866

285

8

21.3/5.1

2491

3.81

S100 calcium binding protein A9

gi|4506773

156

6

13.2/5.7

1986

2.07

splicing factor, arginine/ serine-rich 1 isoform 1

gi|5902076

243

6

27.8/10.3

1606

–2.03

mutant desmin

gi|23506465

563

24

53.5/5.2

1953

2.16

chromatin modifying protein 4B

gi|28827795

138

5

24.9/4.8

2465

–2.02

histone cluster 2, H2bf

gi|66912162

123

4

13.9/10.3

protein name


Enzymes/acts as a monomer, involved in apoptosis Cytoskeletal Proteins/associated with the Keratin –14 the internal stratified epithelium Cytoskeletal Proteins/found in the thin filaments of muscle fibers; represent novel androgen-regulated gene Carrier Proteins/iron binding protein Carrier Proteins/function in the inhibition of casein kinase and altered expression of this protein is associated with the disease cystic fibrosis Others/functions in both constitutive and alternative pre-mRNA splicing Cytoskeletal Protein/intermediate filament protein occurring exclusively in muscle and endothelial cells. Carrier Proteins/components of ESCRT-III, involved in degradation of surface receptor proteins and formation of endocytic multivesicular bodies Others/factor involved and their roles in HOX gene regulation

a Number generated by DeCyder 2-D Differential Analysis Software V6.0. b Decreased or increased ratio of localized PCa comparison to BPH. “–” mean decreased expression of protein in localized PCa. c Accession number of NCBInr database. d Protein with a protein score C.I% over 95% is considered successfully identified. e Protein function is mainly categorized according to MeSH Tree Structure.

gene microarray and proteomics methods.21 For protein profiles of PCa metastasis, most investigations have been based on animal models of localized disease or castration-resistant PCa.25 DIGE-based proteomics has the advantages of adequate sensitivity, high reproducibility, wide linear dynamic range, and minimized experimental variation over conventional proteomics because of internal standards and fluorescence labeling.26 In the present study, we took advantage of DIGE-based proteomics to identify stage-specific markers that reflect the status of LNM PCa. Metastasis is a complex multistage process that is not completely understood. It includes three critical steps: migration from the original site, degradation of the surrounding extracellular matrix (ECM), and invasion of secondary organs.27

In the present study, we identified 58 proteins that are differentially expressed in LNM PCa and localized PCa tissues. These proteins are functionally involved in the processes of tumor progression and metastasis, including cytoskeleton dynamic regulation, signal transduction, metastasis suppression, and energy metabolism. Of these proteins, we validated five up-regulated proteins (e-FABP5, MCCC2, PPA2, SLP2, and Ezrin) and one down-regulated protein (SM22) using real time RT-PCR, Western blotting, and immunohistochemistry. All validation analyses demonstrated that the expression levels of e-FABP5, MCCC2, PPA2, SLP2, and Ezrin were significantly higher in LNM PCa tissues than in localized controls, while SM22 was significantly lower in LNM PCa tissues, which is consistent with our proteomic findings. Journal of Proteome Research • Vol. 9, No. 1, 2010 223

research articles

Figure 2. Protein expression of e-FABP5, MCCC2, PPA2, SLP2, Ezrin, and SM22 in BPH tissue and localized and LNM PCa tissues. (A) Protein expression identified by Western blotting. There are three representative samples in each group. The protein expression levels of e-FABP5, MCCC2, PPA2, SLP2, and Ezrin are significantly increased in the LNM PCa tissues, while the expression level of SM22 is significantly decreased in the LNM PCa tissues. GAPDH is used as an internal loading control. (B) Quantification of gene expression levels of e-FABP5, MCCC2, PPA2, SLP2, and Ezrin by real time RT-PCR. One-way ANOVA analysis revealed that there were significant differences in gene expression levels among the groups (P < 0.01 or P < 0.05). Furthermore, the differences between the groups determined by the Newman-Keuls test were also significant, with P values less than 0.05 (*P < 0.01, compared to the BPH group; #P < 0.05, compared to the localized PCa group). The real time RT PCR is carried out in triplicate and repeated twice for each target to evaluate its repeatability and reproducibility. The mean, standard deviation and coefficient of variation (CV) were calculated for each set of replicates to determine intrabatch and interbatch variation. All ranges of CV values were shown on the top of each column for quantification of five genes expression levels (CV1: intrabatch variation; CV2: interbatch variation).

E-FABP5 is a member of the fatty acid binding protein family that comprised of highly conserved cytoplasmic proteins with functions in fatty acid uptake, transportation, and metabolism.28 E-FABP5 is overexpressed in PCa tissues and induce invasion and metastasis in prostate cell lines.29,30 Overexpression of e-FABP5 induces metastasis by up-regulating VEGF, which plays a crucial role in the metastatic cascade.31 MCCC2 is a nuclear-encoded, mitochondrial biotin-containing enzyme composed of biotin-containing R subunits and smaller β subunits. Its major metabolic role is in the mitochondrial catabolism of leucine and the catabolism of isoprenoids and the mevalonate shunt.32 PPA2 is localized to the mitochondria and is very similar to members of the inorganic pyrophosphatase (PPase) family. It contains the signature sequence essential for the catalytic activity of PPase, which catalyzes the hydrolysis of pyrophosphate into inorganic phosphate, an 224


Pang et al.

Figure 3. Immunohistochemical detection of e-FABP5, MCCC2, PPA2, SLP2, Ezrin, and SM22 in BPH tissue and localized and LNM PCa. (A) Representative images of the immunohistochemical staining of different proteins in the individual groups. The arrows indicate positive staining in the prostate glandular epithelium. (Insets) Amplifying images of positive staining under light microscope (×400). (B) Positive percentages of e-FABP5, MCCC2, PPA2, SLP2, Ezrin, and SM22 protein expression in BPH tissue (n ) 30), localized PCa (n ) 48), and LNM PCa (n ) 27). Relative to the localized PCa group, the LNM PCa group had significantly higher positive percentages of e-FABP5, MCCC2, PPA2, SLP2, and Ezrin, but had significantly lower expression of SM22 (P < 0.001, Pearson χ2 test).

important step in the phosphate metabolism of cells. PPase showed significant increased activities in tumor tissues of colorectal cancers33 and lung adenocarcinomas.34 To date, there have been only few studies on the involvement of MCCC2 and PPA2 in tumor metastasis. In the present study, we found that these energy metabolism-associated proteins showed significantly increased expression in LNM PCa tissues, suggesting an increased requirement for energy in rapidly growing tumors.34 Tumor metastasis may be triggered by an “energetic crisis” when the tumor exceeds the “carrying capacity” of the host organ. As a consequence, dissemination of clusters of cancer cells is set in motion.35 SLP-2 is a novel cancer-related protein that has been identified in esophageal squamous cell carcinoma, lung cancer, laryngeal cancer, and endometrial adenocarcinoma. It is

research articles

Proteomics Analysis of Prostate Cancer

Figure 4. Serum levels of e-FABP5. (A) Serum levels of e-FABP5 in BPH controls (n ) 30), localized PCa patients (n ) 20), and LNM PCa patients (n ) 20) were measured by ELISA. The background signal obtained from experiments without samples was subtracted from all measurements (P < 0.01, Kruskal-Wallis test). (B) ELISA results from 22 patients (localized PCa group, n ) 11; LNM PCa group, n ) 11) at the initial diagnosis and one week after surgical operation confirmed that surgical operation decreased the expression level of e-FABP5 in PCa patients (P < 0.01; Kruskal-Wallis test).

involved in regulating cell growth and cell adhesion.36,37 Decreased cell growth, cell adhesion, and tumorigenesis in SLP-2 antisense transfectants indicate that SLP-2 may be important in tumorigenesis.36,37 Ezrin is a key signaling molecule that regulates cell survival, adhesion migration, and invasion. Ezrin provides a functional link between the plasma membrane and the cortical actin cytoskeleton of the cell, and participates in crucial signal transduction pathways, which promotes cytoskeletal reorganization and subsequent morphogenetic alterations.38 Recent studies have identified Ezrin as a key component in tumor metastasis,38-40 which has essential roles in determining the metastatic fate.38 Most importantly, it is thought to be an integrator of signals between metastasis-associated cell surface molecules (Met receptor and CD44) and signal transduction components (Rho and Akt).41 A previous study has shown that Ezrin is associated with PCa invasion and progression through androgen regulation.42 In addition, the remodeling of actin cytoskeleton proteins plays a critical role in the motility and migration of metastatic malignant cells in the initial steps of metastasis. In the present study, 14 proteins (25%) critical to cytoskeleton regulation were identified as being differentially expressed in LNM PCa. Interestingly, most of these proteins (12/14), especially the actinrelated cytoskeletal proteins such as SM22, were downregulated in metastatic PCa. This may be the result of a concurrent dedifferentiation of surrounding smooth muscle cells (SMCs) during the development and progression of PCa.43 Indeed, tumor invasion and metastasis are increasingly associated with deregulation of the actin system. These altered cytoskeleton proteins may destroy the homeostasis of cell-cell and cell-matrix junctions and adhesions and increase motility, thus making tumor cells more efficient for invasion and metastasis. Down-regulation of SM22 in many cell lines is an early and sensitive marker that indicates the onset of transformation. Our data indicated that the expression of SM22 was down-regulated significantly in LNM PCa, suggesting that SM22 might be used as a prognosis marker. This study undoubtedly provides critical information regarding potential biomarkers such as e-FABP5, MCCC2, PPA2, SLP2, Ezrin, and SM22. However, tissue markers are not ideal for clinical use as obtaining clinically relevant tissue samples by biopsy can be inaccurate due to the heterogeneity of PCa and an associated sampling bias. Markers present in the peripheral circulation would be more directly applicable in the clinical

setting. In the present study, we found that the expression of e-FABP5 was increased 20-fold in LNM PCa tissues relative to that in localized PCa tissues. We then validated that the levels of serum e-FABP5 in LNM PCa patients were significantly higher than those in localized PCa patients (Figure 4A). Furthermore, after the primary and metastatic locus was removed following an extended pelvic lymph node dissection, serum e-FABP5 levels were significantly decreased in PCa patients (Figure 4B). This suggests that e-FABP5 may serve as an important metastasis-associated biomarker for PCa.

Conclusion Clinically aggressive PCa involves multiple steps and bears a set of protein “signatures” that are characteristic of metastatic diseases. We focused on the specific markers that might reflect the progression of PCa from a localized to lymph node metastatic disease. We identified and confirmed at least six differentially expressed proteins (e-FABP5, MCCC2, PPA2, SLP2, Ezrin, and SM22) that are associated with LNM PCa. The simultaneous detection of these proteins using tissue microarray techniques provides a valuable tool for the prediction of LNM PCa. Notably, the determination of serum e-FABP5 levels has the potential of predicting PCa and metastasis. These results may provide new clues to elucidate the mechanism of lymph node metastasis in PCa and the roles of these proteins in metastasis deserve further investigation.

Acknowledgment. We thank Prof. Quentin Liu (State Key Laboratory of Oncology in South China, Cancer Center, Sun Yat-Sen University) for providing excellent technical assistances. This work was supported by Chinese National Natural Science Foundation 30772178, Key Project of Guangdong Provincial Science and Technology Research 7117362, Key Project of Chinese Ministry of Health and Chinese National Hi-Tech Research and Development Program 2007AA021906. Supporting Information Available: Supplementary Tables 1 and 2. This material is available free of charge via the Internet at http://pubs.acs.org. References (1) Jemal, A.; Siegel, R.; Ward, E.; Hao, Y. P.; Xu, J. Q.; Murray, T.; Thun, M. J. Cancer statistics, 2008. CA. Cancer J. Clin. 2008, 58, 71–96. (2) Miyake, H.; Hara, I.; Kurahashi, T.; Inoue, T. A.; Eto, H.; Fujisawa, M. Quantitative detection of micrometastases in pelvic lymph nodes in patients with clinically localized prostate cancer by realtime reverse transcriptase-PCR. Clin. Cancer Res. 2007, 13, 1192– 1197. (3) Swanson, G. P.; Thompson, I. M.; Basler, J. Current status of lymph node-positive prostate cancer: Incidence and predictors of outcome. Cancer 2006, 107, 439–450. (4) Weckermann, D.; Dorn, R.; Trefz, M.; Wagner, T.; Wawroschek, F.; Harzmann, R. Sentinel lymph node dissection for prostate cancer: experience with more than 1,000 patients. J. Urol. 2007, 177, 916–920. (5) Sivalingam, S.; Oxley, J.; Probert, J. L.; Stolzenburg, J. U.; Schwaibold, H. Role of pelvic lymphadenectomy in prostate cancer management. Urology 2007, 69, 203–209. (6) Martinez-Pineiro, L.; Rios, E.; Martinez-Gomariz, M.; Pastor, T.; de Cabo, M.; Picazo, M. L.; Palacios, J.; Perona, R. Molecular staging of prostatic cancer with RT-PCR assay for prostate-specific antigen in peripheral blood and lymph nodes: comparison with standard histological staging and immunohistochemical assessment of occult regional lymph node metastases. Eur. Urol. 2003, 43, 342–350. (7) Jeschke, S.; Nambirajan, T.; Leeb, K.; Ziegerhofer, J.; Sega, W.; Janetschek, G. Detection of early lymph node metastases in

Journal of Proteome Research • Vol. 9, No. 1, 2010 225

research articles (8) (9) (10)

(11)

(12)

(13)

(14)

(15)

(16) (17)

(18)

(19) (20) (21)

(22)

(23)

(24)

226

prostate cancer by laparoscopic radioisotope guided sentinel lymph node dissection. J. Urol. 2005, 173, 1943–1946. Bradford, T. J.; Tomlins, S. A.; Wang, X.; Chinnaiyan, A. M. Molecular markers of prostate cancer. Urol. Oncol. 2006, 24, 538– 551. Mimeault, M.; Batra, S. K. Recent advances on multiple tumorigenic cascades involved in prostatic cancer progression and targeting therapies. Carcinogenesis 2006, 27, 1–22. Gretzer, M. B.; Chan, D. W.; van Rootselaar, C. L.; Rosenzweig, J. M.; Dalrymple, S.; Mangold, L. A.; Partin, A. W.; Veltri, R. W. Proteomic analysis of dunning prostate cancer cell lines with variable metastatic potential using SELDI-TOF. Prostate 2004, 60, 325–331. Rowland, J. G.; Robson, J. L.; Simon, W. J.; Leung, H. Y.; Slabas, A. R. Evaluation of an in vitro model of androgen ablation and identification of the androgen responsive proteome in LNCaP cells. Proteomics 2007, 7, 47–63. Wyler, S. F.; Sulser, T.; Seifert, H. H.; Ruszat, R.; Forster, T. H.; Gasser, T. C.; Bachmann, A. Laparoscopic extended pelvic lymph node dissection for high-risk prostate cancer. Urology 2006, 68, 883–887. Daneshmand, S.; Quek, M. L.; Stein, J. P.; Lieskovsky, G.; Cai, J.; Pinski, J.; Skinner, E. C.; Skinner, D. G. Prognosis of patients with lymph node positive prostate cancer following radical prostatectomy: long-term results. J. Urol. 2004, 172, 2252–2255. Bader, P.; Burkhard, F. C.; Markwalder, R.; Studer, U. E. Disease progression and survival of patients with positive lymph nodes after radical prostatectomy. Is there a chance of cure. J. Urol. 2003, 169, 849–854. Paris, P. L.; Andaya, A.; Fridlyand, J.; Jain, A. N.; Weinberg, V.; Kowbel, D.; Brebner, J. H.; Simko, J.; Watson, J. E.; Volik, S.; Albertson, D. G.; Pinkel, D.; Alers, J. C.; van der Kwast, T. H.; Vissers, K. J.; Schroder, F. H.; Wildhagen, M. F.; Febbo, P. G.; Chinnaiyan, A. M.; Pienta, K. J.; Carroll, P. R.; Rubin, M. A.; Collins, C.; van Dekken, H. Whole genome scanning identifies genotypes associated with recurrence and metastasis in prostate tumors. Hum. Mol. Genet. 2004, 13, 1303–1313. Jin, S.; Shen, J. N.; Guo, Q. C.; Zhou, J. G.; Wang, J.; Huang, G. 2-D DIGE and MALDI-TOF-MS analysis of the serum proteome in human osteosarcoma. Proteomics: Clin. Appl. 2007, 272–285. Fu, H.; Li, W.; Liu, Y.; Lao, Y.; Liu, W.; Chen, C.; Yu, H.; Lee, N. T.; Chang, D. C.; Li, P.; Pang, Y.; Tsim, K. W.; Li, M.; Han, Y. Mitochondrial proteomic analysis and characterization of the intracellular mechanisms of bis(7)-tacrine in protecting against glutamate-induced excitotoxicity in primary cultured neurons. J. Proteome Res. 2007, 6, 2435–2446. Jackson, D.; Rowlinson, R. A.; Eaton, C. K.; Nickson, J. A.; Wilson, I. D.; Mills, J. D.; Wilkinson, R. W.; Tonge, R. P. Prostatic tissue protein alterations due to delayed time to freezing. Proteomics 2006, 6, 3901–3908. Relative quantitation of gene expression. In: ABI’s User Bulletin No. 2. Applied Biosystems, 1997. Cui, Y.; Wu, J.; Zong, M.; Song, G.; Jia, Q.; Jiang, J.; Han, J. Proteomic profiling in pancreatic cancer with and without lymph node metastasis. Int. J. Cancer 2009, 124, 1614–1621. Pei, H.; Zhu, H.; Zeng, S.; Li, Y.; Yang, H.; Shen, L.; Chen, J.; Zeng, L.; Fan, J.; Li, X.; Gong, Y.; Shen, H. Proteome analysis and tissue microarray for profiling protein markers associated with lymph node metastasis in colorectal cancer. J. Proteome Res. 2007, 6, 2495–2501. Pound, C. R.; Partin, A. W.; Eisenberger, M. A.; Chan, D. W.; Pearson, J. D.; Walsh, P. C. Natural history of progression after PSA elevation following radical prostatectomy. JAMA 1999, 281, 1591–1597. Oyen, R. H.; Van Poppel, H. P.; Ameye, F. E.; Van de Voorde, W. A.; Baert, A. L.; Baert, L. V. Lymph node staging of localized prostatic carcinoma with CT and CT-guided fine-needle aspiration biopsy: prospective study of 285 patients. Radiology 1994, 190, 315–322. Lessard, L.; Karakiewicz, P. I.; Bellon-Gagnon, P.; Alam-Fahmy, M.; Ismail, H. A.; Mes-Masson, A. M.; Saad, F. Nuclear localization of nuclear factor-kappaB p65 in primary prostate tumors is highly predictive of pelvic lymph node metastases. Clin. Cancer Res. 2006, 12, 5741–5745.


Pang et al. (25) Taylor, B. S.; Varambally, S.; Chinnaiyan, A. M. Differential proteomic alterations between localised and metastatic prostate cancer. Br. J. Cancer 2006, 95, 425–430. (26) Gorg, A.; Weiss, W.; Dunn, M. J. Current two-dimensional electrophoresis technology for Proteomics. Proteomics 2004, 4, 3665– 3685. (27) Liotta, L. A. Tumor invasion and metastases--role of the extracellular matrix: Rhoads Memorial Award lecture. Cancer Res. 1986, 46, 1–7. (28) Jing, C.; Beesley, C.; Foster, C. S.; Rudland, P. S.; Fujii, H.; Ono, T.; Chen, H.; Smith, P. H.; Ke, Y. Identification of the messenger RNA for human cutaneous fatty acid-binding protein as a metastasis inducer. Cancer Res. 2000, 60, 2390–2398. (29) Morgan, E. A.; Forootan, S. S.; Adamson, J.; Foster, C. S.; Fujii, H.; Igarashi, M.; Beesley, C.; Smith, P. H.; Ke, Y. Expression of cutaneous fatty acid-binding protein (C-FABP) in prostate cancer: Potential prognostic marker and target for tumourigenicitysuppression. Int. J. Oncol. 2008, 32, 767–775. (30) Adamson, J.; Morgan, E. A.; Beesley, C.; Mei, Y.; Foster, C. S.; Fujii, H.; Rudland, P. S.; Smith, P. H.; Ke, Y. High-level expression of cutaneous fatty acid-binding protein in prostatic carcinomas and its effect on tumorigenicity. Oncogene 2003, 22, 2739–2749. (31) Jing, C.; Beesley, C.; Foster, C. S.; Chen, H.; Rudland, P. S.; West, D. C.; Fujii, H.; Smith, P. H.; Ke, Y. Human cutaneous fatty acidbinding protein induces metastasis by up-regulating the expression of vascular endothelial growth factor gene in rat Rama 37 model cells. Cancer Res. 2001, 61, 4357–4364. (32) Baumgartner, M. R.; Almashanu, S.; Suormala, T.; Obie, C.; Cole, R. N.; Packman, S.; Baumgartner, E. R.; Valle, D. The molecular basis of human 3-methylcrotonyl-CoA carboxylase deficiency. J. Clin. Invest. 2001, 107, 495–504. (33) Tomonaga, T.; Matsushita, K.; Yamaguchi, S.; Oh-Ishi, M.; Kodera, Y.; Maeda, T.; Shimada, H.; Ochiai, T.; Nomura, F. Identification of Altered Protein Expression and Post-Translational Modifications in Primary Colorectal Cancer by Using Agarose Two-Dimensional Gel Electrophoresis. Clin. Cancer Res. 2004, 10, 2007–2014. (34) Chen, G.; Gharib, T. G.; Huang, C. C.; Thomas, D. G.; Shedden, K. A.; Taylor, J. M.; Kardia, S. L.; Misek, D. E.; Giordano, T. J.; Iannettoni, M. D.; Orringer, M. B.; Hanash, S. M.; Beer, D. G. Proteomic analysis of lung adenocarcinoma: identification of a highly expressed set of proteins in tumors. Clin. Cancer Res. 2002, 8, 2298–2305. (35) Dattoli, G.; Guiot, C.; Delsanto, P. P.; Ottaviani, P. L.; Pagnutti, S.; Deisboeck, T. S. Cancer metabolism and the dynamics of metastasis. J. Theor. Biol. 2009, 256, 305–310. (36) Cui, Z.; Zhang, L.; Hua, Z.; Cao, W.; Feng, W.; Liu, Z. Stomatinlike protein 2 is overexpressed and related to cell growth in human endometrial adenocarcinoma. Oncol. Rep. 2007, 17, 829–833. (37) Zhang, L.; Ding, F.; Cao, W.; Liu, Z.; Liu, W.; Yu, Z.; Wu, Y.; Li, W.; Li, Y.; Liu, Z. Stomatin-like Protein 2 Is Overexpressed in Cancer and Involved in Regulating Cell Growth and Cell Adhesion in Human Esophageal Squamous Cell Carcinoma. Clin. Cancer Res. 2006, 12, 1639–1646. (38) Yu, Y.; Khan, J.; Khanna, C.; Helman, L.; Meltzer, P. S.; Merlino, G. Expression profiling identifies the cytoskeletal organizer ezrin and the developmental homeoprotein Six-1 as key metastatic regulators. Nat. Med. 2004, 10, 175–181. (39) Curto, M.; McClatchey, A. I. Ezrin: a metastatic detERMinant. Cancer Cell 2004, 5, 113–114. (40) Elliott, B. E.; Meens, J. A.; SenGupta, S. K.; Louvard, D.; Arpin, M. The membrane cytoskeletal crosslinker ezrin is required for metastasis of breast carcinoma cells. Breast Cancer Res. 2005, 7, 365–373. (41) Hunter, K. W. Ezrin, a key component in tumor metastasis. Trends. Mol. Med. 2004, 10, 201–204. (42) Chuan, Y. C.; Pang, S. T.; Cedazo-Minguez, A.; Norstedt, G.; Pousette, A.; Flores-Morales, A. Androgen induction of prostate cancer cell invasion is mediated by ezrin. J. Biol. Chem. 2006, 281, 29938–29948. (43) Wong, Y. C.; Tam, N. N. Dedifferentiation of stromal smooth muscle as a factor in prostate carcinogenesis. Differentiation 2002, 70, 633–645.

PR900953S

Profiling Protein Markers Associated with Lymph Node Metastasis in

Recommend Documents