Progestins and Antiprogestins Affect Gene Expression in Early

Apr 4, 2012 - Mixture effects of levonorgestrel and ethinylestradiol: Estrogenic biomarkers and hormone receptor mRNA expression during sexual program...
8 downloads 9 Views 2MB Size
Download PDF
Article pubs.acs.org/est

Progestins and Antiprogestins Affect Gene Expression in Early Development in Zebrafish (Danio rerio) at Environmental Concentrations Sara Zucchi,† Sara Castiglioni,‡ and Karl Fent†,§,* †

University of Applied Sciences Northwestern Switzerland, School of Life Sciences, Gründenstrasse 40, CH−4132 Muttenz, Switzerland ‡ Department of Environmental Health Sciences, Mario Negri Institute for Pharmacological Research, Via G. La Masa 19, 20156 Milan, Italy. § Swiss Federal Institute of Technology (ETHZ), Department of Environmental Sciences, CH−8092 Zürich, Switzerland S Supporting Information *

ABSTRACT: Progesterone (P4) and synthetic progestins (gestagens) from contraceptives and hormone therapy occur in treated wastewater and surface water, and they may have adverse effects on aquatic organisms. Little is known about the molecular and reproductive effects of P4 and synthetic progestins in fish, and effects of the antiprogestin mifepristone (RU486, an abortive) are unknown. We aimed at elucidating effects on the hormone system by quantitative determination of transcriptional changes of target genes induced by 2, 20, and 200 ng/L P4, RU486, norethindrone (NET), and levonorgestrel (LNG). We exposed zebrafish embryos for 144 h post fertilization (hpf) to these compounds and analyzed expressional changes of ar, esr1, vtg1, hsd17ß3, and progesterone (pgr), mineralo- (mr), and glucocorticoid (gr) receptors, each at 48, 96, and 144 hpf. Concentrations of NET and LNG were constant during exposure, while P4 and RU486 decreased. P4 and RU486 were the most potent steroids. Significant up to 4-fold induction of pgr, ar, mr, and hsd17b3 occurred at 2 ng/L P4 and higher, while RU484 inhibited pgr expression. NET and LNG modulated some transcripts mainly above 2 ng/ L. The expressional chances occurring at environmental levels may translate to negative interference with differentiation of brain and gonads, and consequently reproduction.

■

INTRODUCTION Progesterone (P4) and synthetic analogs (called gestagenes, progestogens, or progestins) find application in medicine (such as hormone therapy) and contraceptives. Synthetic progestins include a broad range of steroids with progesterone-like activity, derived from different parent structures.1 Whereas P4 is only used in medicine, progestins find application in contraception. They ensure the prevention of fertilization by inhibiting ovulation. In oral contraceptives, the progestins with high gonadotropic potency are usually combined with estrogen (mostly ethinylestradiol, EE2), while minipills contain progestins only. In comparison to androgens and estrogens, very little attention is given to the environmental fate and effects of P4 and progestins, and consequently, environmental hazards and risks remain unclear. The synthetic progestins used for contraception are structurally related either to testosterone (T) (estranes and gonanes) or to P4 (pregnanes and 19-norpregnanes).1 Progestins are often classified by generation, based on their introduction; the first generation includes estrane such as norethisterone or norethindrone (NET), the second generation gonanes including levonorgestrel (LNG) and norgestimate, and © 2012 American Chemical Society

the third generation, gonanes including desogestrel, gestodene, and drospirenone (DRSP). In addition, antiandrogens including drospirenone, cyproterone acetate (CA), chlormadinone acetate, and dienogest (DNG) are applied. Newer progestins bind more specifically to the progesterone receptor (PGR) and minimize side-effects related to interactions with the androgen (AR), estrogen (ER), or glucocorticoid receptor (GR). Thus some progestins are used since a long period of time such as medroxyprogesterone acetate (MPA), gestodene, NET and LNG, and some are new (DRSP, dienogest, trimegestone), all used by millions of women. In addition to the progestagenic activity of progestins and their metabolites, they can exhibit estrogenic, antiandrogenic, and androgenic activity. For instance, LNG displays progestogenic and androgenic activity, whereas metabolites also show estrogenic activity.2 Metabolites of NET also show estrogenic activity.3 Received: Revised: Accepted: Published: 5183

January 21, 2012 April 4, 2012 April 4, 2012 April 4, 2012 dx.doi.org/10.1021/es300231y | Environ. Sci. Technol. 2012, 46, 5183−5192

Environmental Science & Technology

■

Among progestins P4 finds highest consumption in Switzerland (www.imshealth.com) and France2 due to medical applications, and synthetic progestins sum up to about 30% of the total consumption in Switzerland. Synthetic progestins are used in contraception (and some of them also in medicine) in the following order of decreasing consumption: DRSP, CA, MPA, NET, chlormadinone, DNG, megestrol, desogestrel, and LNG. Also in the U.K., progestins are used in much greater amounts than estrogens, whereas androgens are used in similar amounts than estrogens.4 In the aquatic environment, P4 and synthetic progestins originate from mainly two sources, excretion by humans and livestock, and therefore, wastewater and runoff from agricultural land give the major environmental inputs. P4, synthetic progestins, and some metabolites have been detected in runoff, surface and groundwater with elevated levels downstream of farms and agricultural land. P4 occurred up to 350 ng/L in spring runoff,5 and is elevated in wastewater from dairies (as milk contains P4). Progestins are also excreted at high concentrations from hormone-implanted cattle, and these steroid hormones can persist in the soil for several months.6 The fate of progestins in the environment is marginally known. P4 shows degradation in wastewater treatment plants (WTP) and is less persistent than the synthetic progestins.2,7 However, natural excretion and medical use result in contamination of aquatic systems in the ng/L range. In surface and groundwater, levels of synthetic progestins vary between 98%). For chemical analysis, progestins were dissolved in methanol at concentration of 1 mg/mL and subsequently diluted to 10 ng/μL (stock solutions). Standard mixtures, containing all of the substances to be analyzed, were prepared by diluting stock solutions in methanol to concentrations of 1, 0.1, and 0.01 ng/μL, and were used for method validation and analytical quantification of each substance. All stock solutions were stored at −20 °C in the dark, a safe conservation method. Fresh working solutions were prepared before each analytical run. For solid-phase extraction Bakerbond SPE C18 cartridges (200 mg/3 mL) (J. T. Baker, Deventer, The Netherlands) were used. Chromatographic analysis was performed using an XTerra MS C18 3.5 μm, 2.1 × 100 mm column acquired from Waters (Waters Corp., Milford, MA). All solvents used were of reagent grade or higher. Acetone and methanol were from Carlo Erba reagents (Italy). Acetonitrile for LC−MS, acetic acid and ammonium hydroxide solution (25%) were from Fluka (Buchs, Switzerland). HPLC grade Milli-Q water was obtained with a MILLIRO PLUS 90 apparatus (MILLI-PORE, Molshelm, France). Chemical Analysis. Solid-Phase Extraction. Aqueous samples were stored at −20 °C in the dark until analysis to prevent analyte’s degradation. Solid-phase extraction (SPE) of progestogens from environmental matrices has usually been performed by means of octadecyl (C18) silica bonded phases.19,20 Thus, we used Bakerbond SPE columns octadecyl (C18). Different aliquots of samples (20−200 mL) were prepared for extraction depending on progestogen concentrations, each aliquot was spiked with 2 ng of IS and the pH was adjusted to 7 with 25% ammonium hydroxide. Cartridges were conditioned before use by washing with 6 mL methanol and 3 mL Milli-Q water. Samples were then passed through the cartridges under vacuum, at a flow rate of 10 mL/min. Cartridges were vacuum-dried for 10 min and eluted with 3 mL of methanol. The eluates were dried under a gentle nitrogen stream. Liquid Chromatographic−Tandem Mass Spectrometry (HPLC−MS/MS). Dried samples were redissolved in 100 μL of Milli-Q water: methanol 70:30, centrifuged for 2 min at 2500 rpm (Megafuge 1.0, Heraeus Instruments) and transferred into glass vials for instrumental analysis. The HPLC system consisted of two Series 200 pumps and a Series 200 auto sampler (Perkin-Elmer, Norwalk, CT). The MS system was an API 3000 triple quadrupole mass spectrometer equipped with a turbo ion spray source (Applied Biosystems−Sciex, Thornhill, Ontario, Canada). The chromatographic separation was performed by gradient elution using acetic acid 0.05% in Milli-Q water as solvent A and acetonitrile as solvent B at a flow rate of 200 μL/min. The analysis started with 60% of eluent A, followed by a 10-min linear gradient to 70% of eluent B, a 1-min linear gradient to 100% of eluent B, a 2-min isocratic washing step with eluent B and a 1-min linear gradient to 100% of eluent A, which was finally maintained for 7 min to equilibrate the column. The 5184

dx.doi.org/10.1021/es300231y | Environ. Sci. Technol. 2012, 46, 5183−5192

Environmental Science & Technology

Article

Table 1. Primer Sequences for Quantitative Real-Time PCR Analysis and Sourcesa target gene

GenBank number

sense primer (5′−3′)

antisense primer (5′−3′)

product size (bp)

pgrb arc esr1d vtg1e mrf grf hsd17b3g RpL13αh

NM_001166335 NM_001083123 NM_152959 AY034146 EF567113 EF567112 NM_200364.1 NM_212784

GGGCCACTCATGTCTCGTCTA CACTACGGAGCCCTCACTTGCGGA TGAGCAACAAAGGAATGGAG AGCTGCTGAGAGGCTTGTTA CCC ATT GAG GAC CAA ATC AC ACA GCT TCT TCC AGC CTC AG TTCACGGCTGAGGAGTTTG AGCTCAAGATGGCAACACAG

TCT CCA CTC TGA AAA TAT GTG GAC TTT GCCCTGAACTGCTCCGACCTC GTGGGTGTAGATGGAGGGTTT GTCCAGGATTTCCCTCAGT AGT AGA GCA TTT GGG CGT TG CCG GTG TTC TCC TGT TTG AT GGACCCAGGTAGGAATGG AAGTTCTTCTCGTCCTCC

96 237 163 94 106 116 121 100

a

pgr (progesterone receptor), ar (androgen receptor), ERalpha (esr1), vtg1 (vitellogenin 1), mr (mineralcorticoid receptor), gr (glucocorticoid receptor), hsd17b3 (hydroxysteroid 17-ß dehydrogenase-3) and RpL13α (Ribosomal protein L13a). bRef 27. cRef 43. dRef 44. eRef 45. fRef 46. gRef 47. hRef 48.

injection volume was 20 μL and the column was kept at room temperature. The MS analysis was done in the positive ion mode with a spray voltage of 5.2 kV, orifice skimmer voltage (DP) varied from 40 to 50 V and ring electrode voltage (FP) varied from 140 to 160 V. Mass spectrometer analyses were done in the multiple reaction monitoring (MRM) mode, measuring the fragmentation products of the protonated or deprotonated pseudomolecular ions of each drug and internal standard. The choice of fragmentation products for each substance and the optimization of energy collisions and other instrument parameters were performed in continuous-flow mode using standard solutions at concentration of 1 ng/μL. Additional information on the analytical method is given in the Supporting Information, SI, as well recoveries of progestogens, limits of quantification (LOQ) of the analytical method and instrumental repeatability (Table S1 of the SI). Embryo Exposure. At 2−4 h post fertilization (hpf), 150 blastula-stage embryos per replicate were randomly placed into 700 mL covered glass beakers containing 500 mL of reconstituted water with the appropriate concentration of progestins and RU486. Semistatic exposure experiments are performed as previously described for benzophenone-4.21 For each compound, four replicates at each concentration of 2, 20, and 200 ng/L, and four replicates of water control and solvent control (0.01% DMSO) were included. Each replicate (n = 4) consisted of 150 eggs. Each compound, analyzed separately, therefore consisted of a total of 150 eggs per replicate exposed up to 144 hpf. Every 24 h, lethal and sublethal effects were evaluated, and dead embryos removed. Old beakers were replaced every 24 h by new ones containing the appropriate compound concentration. At 48, 96, and 144 hpf, 45, 30, and 15 eleuthero-embryos, respectively, were removed. The embryos were pooled and stored in RNA later for further molecular analysis. RNA Isolation. Total RNA was extracted from pools of zebrafish eleuthero-embryo using the RNeasy Mini Kit (Qiagen, Basel, Switzerland). The samples were further treated with RNase free DNase (Qiagen, Basel, Switzerland) to purify the RNA from DNA contamination, and to subsequently remove DNase and divalent cations from the samples. RNA concentrations and quality was analyzed using a NanoDrop 1000 spectrophotometer (Nanodrop Technologies Inc. Wilmington DE, U.S.); the purity of every RNA sample was between 1.8 and 2.0 (260 nm/280 nm ratio). qRT-PCR Analysis. Total RNA from pooled zebrafish eleuthero-embryos, was reverse-transcribed according to our previous study.21 The cDNA was used to perform RT-PCR

based on SYBR-Green Fluorescence (FastStart Universal SYBR Green Master, Roche Diagnostics, Basel, Switzerland). Genespecific primers for progesterone receptor (pgr), androgen receptor (ar), estrogen receptor alpha (esr1), vitellogenin 1 (vtg1), mineralocorticoid receptor (mr), glucorticoid receptor (gr), and hydroxysteroid 17-ß dehydrogenase-3 (hsd17b3), were obtained from published zebrafish primers sequences (Table 1). The real-time PCR program included an enzyme activation step at 95 °C (10 min) and 40 cycles of 95 °C (30 s), 57−60 °C, depending on transcript target as shown in Table 1 (30 s) and 72 °C (30 s), followed by a melting curve analysis post run. The ΔCt values were calibrated against the control ΔCt values for all of the target genes. The relative linear amount of target molecules relative to the calibrator was calculated by 2−ΔΔCt. The ΔCt value was derived by subtracting the threshold cycle (Ct) value for the housekeeping gene (RpL13α), which served as an internal control, from the Ct value of the target gene, respectively. All reactions were run in duplicate using the Biorad CFX96 RealTime PCR Detection System (Biorad, Reinach, Switzerland). The mRNA expression level of the different genes was expressed as fold change (log2) according to the formula 2ΔCt(untreated sample)−ΔCt(treated sample) Data Analysis and Statistics. Data from qRT-PCR, were graphically illustrated with GraphPad Prism 5 (GraphPadSoftware, San Diego, CA, U.S.). The significance of differences in transcript levels was analyzed by one way analysis of variance (ANOVA) and Tukey posthoc test. Differences were considered significant at p ≤ 0.05. Results are given as mean ± standard error of mean (SEM).

■

RESULTS

Chemical Analysis. Results of mass spectrometric analysis of water samples at the beginning (T0) and before water renewal after 24 h (T24) of the experiments are shown in Table 2 and raw data are available in the SI (Table S2). LNG and NET remained constant during the experiment with concentrations very close to nominal both at T0 and T24. Levels of P4 at T24 decreased to 25 and 50% of the initial amount, respectively, for the lowest (2 ng/L) and higher (20−200 ng/L) levels. Mifepristone (RU486) concentrations were already lower at T0 and became nondectable (2−20 ng/ L), or dropped to 50% (200 ng/L) at T24. Due to lower exposure concentrations than nominal, in the following, we give both nominal and measured mean values, the latter in parentheses. Expression of Target Genes in Zebrafish EleutheroEmbryos. The progestins were not acutely toxic to the 5185

dx.doi.org/10.1021/es300231y | Environ. Sci. Technol. 2012, 46, 5183−5192

Environmental Science & Technology

Article

Table 2. Measured Progestin Concentrations at T0 and T24 and Mean (Bold Character) of the Experiments. Arithmetic Means Have Been Calculated for Norethindrone and Levonorgestrel (Stable Concentrations) and Geometric Means for Progesterone and RU486 (Decreasing Concentrations)a

Progesterone. P4 led to transient up-regulation of pgr, ar, and esr1 transcripts being significant at 96 hpf (Figure 2), and of mr, gr, and hsd17b3 being significant at 48 hpf (Figures S2 of the SI). Induction of pgr occurred at 2 (1.85) ng/L and higher at 96 hpf, but was not significant at 48 or 144 hpf (Figure 2A). Additionally, up-regulation of ar transcripts was significant at all concentrations at 96 hpf (up to 2.2 fold change) and 48 hpf, but not at 144 hpf (Figure 2B). The expression of esr1 was significantly up-regulated at 20 (14.9) and 200 (104.2) ng/L at 96 hpf (Figure 2C). Transcripts of vtg1 were slightly upregulated at all time points (Figure S2A of the SI), being significant at 144 hpf even at 2 (1.84) ng/L P4. In addition an overall up-regulation was observed for mr (Figure S2B of the SI), gr (Figure S2C of the SI), and for hsd17b3 (Figure S2D of the SI) transcripts, mainly at 48 hpf. Mifepristone. RU486 led to a down-regulation of pgr mRNA at all time points even at 2 (1.3) ng/L (Figure 3A); while a slight up-regulation for the ar was observed at 144 hpf at 200 (78.1) ng/L (Figure 3B). A dose-related and significant upregulation was observed for the hsd17b3 transcript at 48 hpf (Figure 3C), while it was down-regulated at 144 hpf at 20 (0.56) and 200 (78.1) ng/L. Transcripts of esr1 (Figure S3A of the SI) and vtg1 (Figure S3B of the SI) displayed similar mRNA levels except at 48 hpf where transcripts of vtg1 were significantly up-regulated at 2 (1.3) and 200 (78.1) ng/L. Transcripts of mr and gr (Figures S3C,D of the SI) showed significant up-regulation at 2 (1.3) ng/L and 200 (78.1) ng/L RU486 at 96 hpf, respectively. Norethindrone. Transcripts of pgr (Figure 4A), esr1 (Figure 4C), vtg1 (Figure S4A of the SI) and mr (Figure S4B of the SI) were up-regulated at 48 hpf, with significant up-regulation at 2 (2.15) ng/L for esr1 and mr, and at 20 (21.35) ng/L for pgr and vtg1. Transcripts of ar were minimally affected by NET (Figure 4B) showing significant down-regulation at 96 and 144 hpf at 200 (211.25) ng/L. The abundance of gr and hsd17b3 mRNA remained unaffected (Figure S4C,D of the SI).

concentrations progestins progesterone

mifepristone (RU486)

norethindrone

levonorgestrel

TEXPb

2 ng/L

20 ng/L

200 ng/L

T0 T24 mean T0 T24 mean T0 T24 mean T0 T24 mean

2.0 1.7 1.84 1.3