Properties of Native and Site-Mutagenized Cellobiohydrolase II

Chapter 18

Properties of Native and Site-Mutagenized Cellobiohydrolase II 1

1,4

1,5

1,6

2

C. Barnett , L. Sumner , R. Berka , S. Shoemaker , H. Berg , M. Gritzali , and R. Brown Downloaded by UNIV OF CALIFORNIA SAN DIEGO on June 9, 2015 | http://pubs.acs.org Publication Date: December 11, 1993 | doi: 10.1021/bk-1993-0516.ch018

3

3

1

Genencor International, Inc., 180 Kimball Way, South San Francisco, CA 94080 Biology Department, Memphis State University, Memphis, TN 38152 Food Science and Human Nutrition Department, University of Florida, Gainesville, FL 32611 2

3

The cellulase system of Trichoderma reesei (also T. longibrachiatum) comprises endoglucanases, cellobiohydrolases and β-D-glucosidases which act synergistically to convert cellulose to glucose. Although cellobiohydrolase I (CBH I) is the most abundant component, cellobiohydrolase II (CBH II) is required for optimum rates of conversion of crystalline cellulose. The three dimensional structure of the catalytic core of C B H II recently reported by Swedish and Finnish investigators (1) has made it possible to interpret more precisely the results of experiments regarding structure-function relationships. Changes in activity and specificity due to site specific mutagenesis have been used to study the putative active site of C B H II to confirm the essentiality of specific amino acid residues and the effect on the substrate specificity and kinetics of reaction using model substrates. In this study, C B H II genes were expressed in Aspergillus awamori and the properties of the resulting enzymes were examined. The results indicate a multi-site enzyme with activity on polymeric and soluble substrates dependent on specific amino acid residues.

The cellulase system of Trichoderma reesei has been the subject of intense study over the past twenty years because of its ability to depolymerize cellulose, the most abundant component of plant derived materials and agricultural wastes. Advances in cellulase manufacturing making available lower cost commercial cellulases, as well as increased pressure to reduce the amount of solid waste have heightened interest in 4

Current address: Tufts Medical School, Tufts University, Boston, MA 02215 Current address: Novo Nordisk Biotech, Inc., Davis, CA 95616 Current address: Department of Food Science and Technology, California Institute of Food and Agricultural Research, University of California, Davis, CA 95616

5

6

0097-6156/93/0516-0220$06.00/0 © 1993 American Chemical Society

In Biocatalyst Design for Stability and Specificity; Himmel, M., et al.; ACS Symposium Series; American Chemical Society: Washington, DC, 1993.

Downloaded by UNIV OF CALIFORNIA SAN DIEGO on June 9, 2015 | http://pubs.acs.org Publication Date: December 11, 1993 | doi: 10.1021/bk-1993-0516.ch018

18.

BARNETTETAL.

Native and Site-Mutagenized CeUobiohydrolase II

developing cellulase-based conversion processes. One such process is the development and commercialization of a cellulase-based simultaneous-saccharification fermentation process for the production of fuel ethanol. This process is based on mixed feedstocks, including renewable and waste materials, and is generating a clean burning transportation fuel. Ethanol is being used today as an octane enhancer and as a transportation fuel. In the future its use can significantly reduce our dependence on petroleum based fuels. The cost and efficiency of cellulases remain major considerations in their use in commercial processes. Cellulases are about a hundred times less efficient than amylases and though much of the reason for this is due to differences in the substrates, it is felt that the cellulases can be improved to increase both the rate and extent of depolymerization. Examination of the cellulase system of T. reesei shows it to consist of at least five distinct enzymes that act synergistically to depolymerize crystalline forms of cellulose to give glucose and cellobiose as the major products. Among the five enzymes are three categories of hydrolytic activities. The endoglucanases, E G I and E G Π are β-glucan glucanohydrolases (EC 3.2.1.4.) and randomly cleave internal |M,4-glucosidic linkages in cellulose. The exocellobiohydrolases, C B H I and C B H Π are p-l,4-glucan cellobiohydrolases (EC 3.2.1.91) and degrade cellulose from the ends of the cellulose polymer chains. C B H I, when acting upon cellulose, releases primarily cellobiose with some glucose; C B H Π, however, is unique among the endoglucanases and cellobiohydrolases in that it releases almost entirely cellobiose from the hydrolysis of cellulose. The β-glucosidase or cellobiase (EC 3.2.1.21) converts cellobiose and other cellooligosaccharides to glucose. The genes encoding the two endoglucanases, egll (2) and egl3 (5), and two cellobiohydrolases, cbhl (4) and cbh2 (5-6) have been cloned and their nucleotide sequences determined. Furthermore, cbhl and cbhl have been expressed in Saccharomyces (7) and cbhl and egll have been expressed in Aspergillus nidulans (8). Although well characterized at the genetic and biochemical level, the active site residues and their respective roles have yet to be determined for any of the cellulase enzymes. Chen et al. (5) suggested a model for C B H Π based on homology to the catalytic mechanism of T4 lysozyme (9) where residues equivalent to the aspartic acid at position 175 and the glutamic acid at position 184 are involved in catalysis. At about the same time, Knowles et al. (6) suggested that the glutamic acid at position 244 is implicated in catalysis. More recendy, the three-dimensional structure of the catalytic core of C B H Π was reported (7). This study strongly implicated two aspartyl residues (Asp 175 and Asp 221) in the catalytic mechanism as well as several tryptophanyl residues in an extensive binding site. The structure proposed a "tunnel" into which a P~l,4-glucan chain could enter with the consequent addition of HjO to alternate glycosidic bonds and the release of α-cellobiose as product molecules. To test the validity of these hypotheses and to identify the active site residues in C B H Π by site-directed mutagenesis, we have developed an expression system combining Aspergillus awamori, a fungus with a relatively low background for cellulolytic activity and no cellobiohydrolase, and the expression vector pGPT-pyrG (10). Using this heterologous expression system, we have identified one residue essential to the catalytic mechanism of C B H Π and a second residue which seems to affect the catalytic activity of C B H Π. Neither of these alterations of the C B H Π


2

222

BIOCATALYST DESIGN F O R STABILITY AND SPECIFICITY

protein resulted in a loss of binding to cellulose in cell walls, thus indicating the significance of the cellulose binding domain (CBD) in the substraterenzyme association.


Materials and Methods

Fungal Strains. Aspergillus awamori strain (A. niger var. awamori) GC12 was derived from strain UVK143 (a glucoamylase hyper-producing mutant of strain N R R L 3112) by parasexual crossing of the following auxotrophic mutants: A. awamori GC5 (pyrG5\ a uridine requiring auxotroph isolated by selection on 5-fluoro-orotic acid (77) following mutagenesis of UVK143f with ultraviolet light (this mutant is deficient in the enzyme orotidine 5'-monophosphate decarboxylase); A. awamori GC3 (argB3), which is an arginine requiring auxotroph isolated by filtration enrichment (72) following nitrosoguanidine mutagenesis of UVK143f (mis mutant is specifically deficient in the enzyme ornithine carbamoyl transferase). The resultant double auxotroph (pyrG argB) was designated strain GC12. y

Bacterial Strains, Cloning Vectors and Plasmids. Escherichia coli JM101 (75) was used for propagation of all plasmids. The cloning vectors pUC218 and pUC219 are chimeric D N A phage-plasmid molecules derived from pUC18 and pUC19, respectively (74), with the insertion of the restriction sites Xhol, BgUl, and Clal in the polylinker between the BamHl and the Xbal sites. These vectors contain the intergenic region of the bacteriophage M l 3 (75) and when used in conjunction with the helper phage M13/K07, generate single stranded D N A for use as template for site directed oligonucleotide mutagenesis (7(5) and for sequencing. Construction of pGPT-cbh2. In order to create sites to easily remove the coding region of cbh2> oligonucleotide mutagenesis primers 30 base pairs in length were synthesized to insert a BgKl site 24 nucleotides upstream of the methionine at the translation start site and an Nhel site 21 nucleotides downstream of the stop codon in both the intronless and genomic copies of the cbh2 gene (Figure 1). ι

24 nucleotides Bgin

ι Met

- - - AGATCTCCCTCTGTGTATTGCACCATG (A) I

ι Stop

21 nucleotides

ι Nhel

TAAGGCTTTCGTGACCGGGCTAGC- - I (TCA)

Genomic or Intronless cbh2 gene Figure 1 Nucleotide Sequence of 5' and 3' cbhl Regions These sites were used to ligate the full length coding regions of both forms of cbh2 into the Bglll and Xbal sites of the expression vector pGPT-pyrG (77). This vector uses the A. awamori glucoamylase (glaA) promoter and the A. niger glaA terminator


18. BARNETT ET AL.



as transcriptional and translational controls for the expression of C B H Π. Also included on the vector is the A. nidulans pyrG, which complements the uridine auxotrophy of our GC12 strain and serves as a selectable marker for identification of transformants on solid media containing no uridine. The entire promoter-coding region-terminator cassette can be liberated from vector sequences by restriction digestion with Clal to yield a 5.0 kb fragment Transformation Procedure for A . awamori. A. awamori strain GC12 was protoplasted as described (18) and transformed by an electroporation technique described by Ward et al. (79). The number of transformants ranged from 5-15 per microgram of D N A . Culture conditions. A. awamori C B H Π transformants were grown in liquid medium containing 1 g/L Bacto Peptone (Difco), 20 g/L malt extract (Difco), 1 g/L yeast extract (Difco), 6 g/L NaN0 , 0.52 g/L KC1, 34 g/L KH2P0 , 1.0 g/L MgSO *7H 0, 50 g/L maltose, 1 g/L trace elements (1.0 g/L, FeS(V7H 0, 8.8 g/L ZnS0 *7H 0, 0.4 g/L CuS(V5H 0 0.15 g/L MnSO *4H 0,0.1 g/L N a ^ A - l O H A 50 mg/L [ΝΗΛ,Μο,Ο* •4H 0), 10 mL/L met-bio solution (50 g/L L-methionine, 200 mg/mL d-biotin), 0.1% Tween 80, 50 mg/mL streptomycin. A l l cultures were inoculated with conidia to a final concentration of l x l O conidia/mL of culture medium and grown for 4 days at 37°C on a rotary shaker (New Brunswick Scientific Company, Inc.) at 200 rpm. Cultures were filtered through miracloth and filtrates collected for enzyme characterization. 3

4

2

2

4

4

4

2

2

2

2

6

Construction of CBH Π Expression Vectors. Native and site-specific variants of C B H Π in pJC218 were excised with BgKL and Nhel and ligated into BglUPCbal cut pGVT-pyrG vector. These were used to transform E. coli JM101 and selected for on medium containing 50 mg/mL carbenicillin. Isolation and Characterization of Nucleic Acids. A. awamori D N A and R N A were isolated as described previously (20). D N A samples from transformants were digested with an appropriate restriction enzyme, fractionated on 0.5% agarose gels and blotted to Nytran (Schleicher & Schuell, Keene, NH) nylon membrane. The membranes were hybridized in 50% formamide, 5X SSPE, 200 mg/mL sheared and denatured (95°C) salmon sperm D N A and with nick translated pGVT-cbh2 plasmid (lxlO cpm/mL). After overnight incubation at 42°C, the membranes were washed at 55°C in 2 X SSC, as described by Davis et al. (27) Total R N A from selected A. awamori transformants was fractionated electrophoretically on 1% agarose gels containing 2% formaldehyde and subsequendy blotted to Nytran in 20X SSPE. The membranes were hybridized with a nick translated cbhl coding region fragment. Hybridization and washing conditions were the same as described above for D N A hybridization. 6

Site Specific Mutagenesis. Oligonucleotide-directed site spécifie mutagenesis was accomplished according to the method described by Carter (16). The precise nucleotide sequence of the genetic modifications were confirmed using the Sanger di-deoxy sequencing method (22).


223

224

BIOCATALYST DESIGN FOR STABILITY AND SPECIFICITY


Antibody Analysis. Screening transformants for the presence of recombinant C B H Π was done using an enzyme linked immunosorbent assay. (Shoemaker and Sumner, unpublished data.) Western blot analysis was carried out as described by Towbin et al. (25). Enzyme Purification and Analysis of rCBH Π Enzymes. One liter cultures of the A. awamori transformants (cDNA type) which expressed C B H Π enzymes were concentrated twenty fold and diafiltered into 5 m M phosphate buffer at pH = 7.8. The r C B H Π protein was purified by FPLC (Pharmacia) using a Mono Q anion exchange column equilibrated in 5 m M phosphate buffer at pH = 7.8. Flow-through fractions containing r C B H Π were collected and were incubated in 1% phosphoric acid-swollen cellulose (PSC) for 1 hour at 45°C. The samples were centrifuged at 2500xg to remove PSC. Production of reducing sugars, expressed as cellobiose equivalents, was determined according to the method of Nelson and Somogyi (24-25). The designation of the C B H Π enzymes used in the kinetic and binding studies is given in Table I.

Table I. Recombinant C B H Π (rCBH Π) Enzymes* Enzyme rCBH rCBH rCBH rCBH rCBH rCBH

Designation

Π (from native cDNA) Π (Glu 184 to Gin 184) II (Asp 173, 175 to Asn 173, 175) Π (Asp 173 to Asn 173) Π (Asp 175 to Asn 175) Π (Glu 244 to Gin 244)

rCBH Π E184Q D173N/D175N D173N D175N E244Q

Y C B H Π refers to the Aspergillus gene product which is derived from native and genetically modified Trichoderma C B H Π genes. C B H Π purified directiy from T. reesei cultures is designated as C B H Π or native C B H Π.

Reaction Product Analysis. Reaction supernatants were analyzed by H P L C using a Bio-Rad HPX65A column at 80 C. Glucose and cellobiose (Sigma) were used as standards. e

Kinetic Studies. The enzymatic hydrolysis of Avicel or PSC was carried out in 50 m M pH 5.0 sodium acetate buffer at 40°C after which the reaction was stopped by exposure to boiling water for 5 minutes. Following centrifugation of the incubation mixtures, the supernatants were analyzed for reducing sugar by the Nelson-Somogyi method (24-25). The model substrate, methylumbelliferyl-P-D-cellobioside ( M U Q , was used in studies of specificity and kinetics of the purified native and recombinant forms of C B H Π. These studies were carried out at 40°C in 50 m M pH 5.0 sodium acetate buffer and the extent of reaction determined by measuring absorbance at 346 nm (2(5).


18.

BARNETT ET AL.



Ultrastructure Analysis. The enzyme-linked colloidal gold labelling technique of Berg et al. (27) without poststaining was used to compare the binding affinities of native and recombinant C B H Π forms (native—purified, recombinant—wild type; D173N/D175N; and E184Q) with identical sections of Casuarina branchlet parenchyma cell wall material. The same ratio of protein to gold was used to make each of the probes, which were then diluted similarly to give working solutions according to standard procedures (27).

Results and Discussion

Expression of CBH Π in A. awamori. Intronless and genomic forms of r C B H Π and the specific genetic variants D173N/D175N, E184Q, D173N, D175N, and E224Q were introduced into the expression vector pGVT-pyrG as outlined in the previous section. These plasmids were used to transform A. awamori GC12. A l l transformants were picked to fresh minimal medium in the absence of uridine twice successively and inoculated into the medium described in the previous section. The addition of maltose as a carbon source was necessary to induce transcription from the glaA promoter. Duplicate samples of ten transformants, from both the genomic and intronless constructions were analyzed by an immunochemical method (ELISA). Approximately 70-80% of the transformants tested showed the presence of secreted C B H Π. The maximum expression among the genomic transformants was determined to be 25 mg/mL and the intronless transformants reached a maximum expression level of 40-50 mg/mL (data not shown). Total chromosomal D N A was isolated from selected high producing transformants and from selected low producing transformants. Equal amounts of D N A from each transformant were cut with the restriction endonuclease C/αΙ, fractionated on 0.5% agarose gels, blotted to Nytran and hybridized with the nick translated pGPT-CBH Π. The autoradiogram given in Figure 2 shows that in each selected transformant, pGVT-cbh2 has integrated into the host genome. In this figure the letter C denotes intronless clones and the letter G denotes genomic clones. The end lanes (pl8CB and p l G l ) are purified controls cut with C/αΙ, a restriction enzyme that separates the G A M - C B H Π expression unit from the vector D N A . The lane denoted Uc is A. awamori untransformed D N A as a negative control. Five micrograms of genomic D N A isolated from various transformants and a negative control were run on 0.5% agarose, blotted and probed with nick translated genomic pGPT-c&A2 plasmid. The high producing intronless transformants, c l and cJ, contain full length tandem integrants as seen by the restriction pattern consistent with the plasmid control. They also show different copy numbers which is consistent with circular plasmid integration into the chromosome. The intronless transformants with undetectable levels of expression of C B H Π show a restriction pattern that is markedly different from the control plasmid. This is due to an uneven recombination event resulting in the loss of either the promoter portion of the coding region and resulting in undetectable levels of C B H Π expression. The high producing genomic transformants, gC and gW, do not show a restriction pattern that is consistent with a full length tandem integration as the restriction pattern does not contain the same size fragments as the control.


22

226

BIOCATALYST DESIGN FOR STABILITY AND SPECIFICITY

This is the result of uneven recombination into the chromosome while maintaining the integrity of the expression cassette. Northern blot analysis of the high producing transformants c l , gC and gW, probed with the BglR-Nhel coding region fragment is given in Figure 3. In this case, total A. awamori R N A was subjected to electrophoresis on a 3% agarose/formaldehyde gel (panel A). The gel was transferred to a nylon membrane filter (Nytran R). The membrane was probed with P labelled intronless Bglll-Nhel fragment and visualized by autoradiogram (panel B). Lanes Gc, Gw and Cj are individual transformants (G is genomic and C is intronless). Lane Uc is an untransformed control and M is a Bethesda Research Labs (BRL) R N A ladder. Northern analysis shows that ample mRNA is being produced from the glaA promoter in both the intronless and the genomic C B H Π producing transformants.


32

Analysis of r C B H Π. Analysis of culture supernatants of selected transformants by SDS polyacrylamide gel electrophoresis (SDS-PAGE) with silver staining (Figure 4A) and western blot analysis (Figure 4B) show rCBH Π as a broad heterogeneous band and of a lower mobility, compared to native C B H Π. The lanes in both gels designated Cqf, Gqb, Cqa, Cg, Gb, C f and Ga are individual transformants. The lane designated M W are protein molecular weight markers. The C B H Π lane is purified C B H Π from T. reesei and the Uc is untransformed A. awamori supernate as a negative control. This is indicative of hyperglycosylation by the host, A. awamori. The purified rCBH II gave a similar pattern upon gel analysis (data not shown). Reaction products analyzed by H P L C confirmed that the reaction product is greater than 95% cellobiose (data not shown). The F P L C procedure allowed the concentration and purification of native and recombinant forms of C B H Π. The enzymatic properties of these enzymes were compared using phosphoric acid-swollen cellulose (PSC) as substrate. The reaction products were analyzed by HPLC and confirmed as cellobiose (>95%). A comparison of specific activities using either PSC or Avicel (0.1% w/v) is shown in Table Π. Table Π. Specific Activities of C B H II Enzymes Specific Activity (mmol glc equiv/min/mg protein) Avicel PSC

C B H Π Enzyme-

Native C B H Π 4.9 0.13 Recombinant C B H Π r C B H Π-1 0.09 3.9 r C B H Π-2 5.4 0.14 E184Q 0.17 5.9 D173N/D175N 0.19

Properties of Native and Site-Mutagenized Cellobiohydrolase II

Recommend Documents