Proteome Analysis of an Attenuated Francisella tularensis dsbA

Oct 5, 2009 - Center of Advanced Studies and Institute of Molecular Pathology, Faculty of Military Health Science UO, 500 01 Hradec Kralove, Czech ...
0 downloads 0 Views 1MB Size
Download PDF
Proteome Analysis of an Attenuated Francisella tularensis dsbA Mutant: Identification of Potential DsbA Substrate Proteins Adela Straskova,†,+ Ivona Pavkova,*,‡,+ Marek Link,‡ Anna-Lena Forslund,§ Kerstin Kuoppa,§ Laila Noppa,§ Michal Kroca,| Alena Fucikova,‡ Jana Klimentova,‡ Zuzana Krocova,‡ Åke Forsberg,§,⊥ and Jiri Stulik‡ Center of Advanced Studies and Institute of Molecular Pathology, Faculty of Military Health Science UO, 500 01 Hradec Kralove, Czech Republic, Swedish Defence Research Agency, Division of NBC-Defence, 901 82 Umea, Sweden, Central Military Health Institute, Centre of Biological Defence, 561 66, Techonin, Czech Republic, and Department of Molecular Biology, Umeå University, 901 87 Umeå, Sweden Received June 30, 2009

Francisella tularensis (F. tularensis) is highly infectious for humans via aerosol route and untreated infections with the highly virulent subsp. tularensis can be fatal. Our knowledge regarding key virulence determinants has increased recently but is still somewhat limited. Surface proteins are potential virulence factors and therapeutic targets, and in this study, we decided to target three genes encoding putative membrane lipoproteins in F. tularensis LVS. One of the genes encoded a protein with high homology to the protein family of disulfide oxidoreductases DsbA. The two other genes encoded proteins with homology to the VacJ, a virulence determinant of Shigella flexneri. The gene encoding the DsbA homologue was verified to be required for survival and replication in macrophages and importantly also for in vivo virulence in the mouse infection model for tularemia. Using a combination of classical and shotgun proteome analyses, we were able to identify several proteins that accumulated in fractions enriched for membrane-associated proteins in the dsbA mutant. These proteins are substrate candidates for the DsbA disulfide oxidoreductase as well as being responsible for the virulence attenuation of the dsbA mutant. Keywords: Francisella tularensis • virulence factor • DsbA • VacJ • lipoprotein • oxidoreductase activity • 2-DE • shotgun proteomics

Introduction The Gram-negative facultative intracellular coccobacillus Francisella tularensis (F. tularensis), causative agent of the zoonotic disease tularemia, is one of the most infectious pathogens known.1 F. tularensis is further divided into four subspecies of which two, the highly virulent subsp. tularensis (type A) and the moderately virulent subsp. holarctica (type B), are mostly associated with human disease. Because of the high infectivity and high potential for aerosol transmission, F. tularensis has been designated a Category A agent of bioterrorism.1 The availability of genomic information and molecular tools has facilitated various screening studies where several putative virulence determinants have been identified.2-8 Further studies where these genes were targeted by specific mutagenesis confirmed the role of these genes in viru* To whom correspondence should be addressed. Ivona Pavkova, Institute of Molecular Pathology, FMHS UO, Trebesska 1575, 500 01 Hradec Kralove, Czech Republic. Tel: ++420495518833. Fax: ++420495495513018. E-mail: [email protected]. † Center of Advanced Studies, Faculty of Military Health Science UO. + These authors contributed equally to the work. ‡ Institute of Molecular Pathology, Faculty of Military Health Science UO. § Swedish Defence Research Agency. | Central Military Health Institute. ⊥ Umeå University.

5336 Journal of Proteome Research 2009, 8, 5336–5346 Published on Web 10/05/2009

lence.2,7,9-13 Despite this recent progress, much remains to be understood about the molecular basis of F. tularensis pathogenicity in order to promote development of therapeutics, diagnostic and prophylactic tools against tularaemia. In a recent study, we demonstrated that expression of several lipoproteins differed between the type A and type B strains.14 Among these homologues of virulence were factors described in other Gram-negative bacterial pathogens. One of the hypothetical lipoprotein encoding genes, FTL__1096 (LVS nomenclature), was found to encode one domain with high homology to the disulfide oxidoreductase DsbA family of proteins. DsbA has been found to be important for the function of many membrane or secreted proteins including several with designated function in virulence of several Gram-negative bacteria.15 Another lipoprotein encoded by FTL__1637 showed similarity to the lipoprotein VacJ previously verified to be important for virulence of Shigella flexneri.16 In addition, using a bioinformatic approach, we were able to identify another gene, FTL__0765, that encoded a VacJ-like lipoprotein. Interestingly, this gene appears to be nonfunctional in type A strains like Schu S4 and FSC053, while it most likely is functional in most type B strains. It is not clear if this gene is actually expressed as we were unable to detect this lipoprotein in our recent proteome analysis.14 10.1021/pr900570b CCC: $40.75

 2009 American Chemical Society

research articles

Proteome Analysis of an Attenuated F. tularensis dsbA Mutant Table 1. Strains and Plasmids Used in This Study strains/plasmids

genotype/phenotype

source/reference

Strains F. tularensis FSC155 FSC670 FSC668 FSC667 E. coli Top10

Subsp. holarctica; Live Vaccine Strain; LVS; ATCC29684 Russia FSC155/ in frame deletion of FTL_0765 FSC155/ in frame deletion of FTL_1637 FSC155/ in frame deletion of FTL_1096

40 This study This study This study Invitrogen

S17-1λpir

F- mcrA ∆(mrr-hsdRMS-mcrBC), φ80lacZ∆M15 ∆lacX74 recA1 deoR araD139 (∆ara-leu)7697 galU galK rpsL (Smr) endA1 nupG recA, thi, pro, hsdR-M+, TpR, SmR

pCR4.0-TOPO pDM4

Plasmids TOPO-cloning vector. AmpR, KmR Suicide plasmid. sacB; mobRP4; oriR6K; CmR

41 Invitrogen 42

Table 2. (A) Sequences of Primers Used for Creation of F. tularensis LVS Deletion Mutantsa; (B) Sequences of Primers A-G Used for RT-PCR Performed To Verify That the In-Frame Deletion of FTL_1096 Had No Impact on Neighboring Genes gene

FTL_1096

FTL_0765

FTL_1637

primer designation

A B C D A B C D A B1 C1 D A B C D E F G

a

5′-3′ sequence

(A) Primers for Mutant Creation GCATGTCTCGAGTATCTTAATCGTCCAGTTAATGT GCTTCAACACTCTTAGTCATTCTAAATTTACTCC AGAATGACTAAGAGTGTTGAAGCTTAATTAGATTAA GCATGTGAGCTCTAAATCTATGACTTTTGATGTTGT GCATGTCTCGAGCTGAGATGGCTGGTGAAGCA AGCAACCTGGTTTCTTAACTTCATATCTATACAATTT ATGAAGTTAAGAAACCAGGTTGCTGAAGTTTAAT GCATGTGAGCTCTGTAGTTATCTTTTGAGCAATCT GCATGTCTCGAGTCTGTAGCACTACTATTATCAAT CTTATTTCTTTAGTAGTTTCATCAAAATTATTCTCATA TTTGATGAAACTACTAAAGAAATAAGAGATGCCAA GCATGTGAGCTCAGGGATTGCTCTAGATAATTGA (B) Primers for RT-PCR ATCGCTATTGCAGTCGGTAA TGCTGGTGCTCTAATTACTTC TTGAGCAGCCATTTCTTGCTT AGTAGCTTGCTCAGATAGTTC ACTTGTACATCACTATTATCCTT TGATTGGAATTAGAAAAGGTAGT GCATACCTATAGTGAGGATTT

Restriction sites for selected endonucleases on primer A and D are given in italic; complementary parts of primer B and C are underlined.

In the present study, we wanted to verify if any of these lipoproteins had a role in virulence of F. tularensis. Strains specifically mutated for each gene by in-frame deletion mutagenesis were evaluated in a mouse infection model. Of the three genes, only the dsbA mutant strain was found to be highly attenuated. Recently and during the course of this study, the corresponding DsbA-like protein (FTT1103) encoded by F. tularensis subsp. tularensis Schu S4 was also identified to be an essential virulence factor.10 Here we provide the first experimental evidence for fatty acid modification and disulfide oxidoreductase activity of F. tularensis DsbA homologue. Additionally, by using comparative proteomic approaches, we were able to identify proteins that may depend on DsbA activity for their localization and/or function and therefore are candidates for encoding proteins more directly involved in the virulence attenuation seen in the dsbA mutant.

Materials and Methods Bacterial Strains and Culture. The F. tularensis and Escherichia coli strains used in this study are listed and described in Table 1.

All F. tularensis strains were cultured on McLeod agar enriched for bovine hemoglobin (Becton Dickinson) and IsoVitalex (Becton Dickinson) or on modified Thayer-Martin agar plates at 37 °C in 5% CO2 atmosphere. E. coli strains were grown on blood agar base plates (Merck, Germany) or in Luria-Bertani broth. Where appropriate, antibiotics were used at the following concentrations; chloramphenicol 2.5 µg mL-1 (Francisella) or 25 µg mL-1 (E. coli) and polymyxin B 75 µg mL-1. Preparation of plasmid DNA, restriction enzyme digests, ligations and transformations into E. coli were performed essentially as described previously.17 Construction of In-Frame Deletion Mutants. DNA constructs encoding in-frame deletions for the respective genes were generated by overlapping PCR amplification using the primers A-D described in Table 2. Restriction sites for XhoI and SacI endonucleases were introduced in the flanking primers (A, D) and the resulting DNA fragment was cloned into pCR4-TOPO vector (Invitrogen) and sequenced by MWGBiotech AG (Ebersberg, Germany). Fragments from plasmids with verified inserts were cloned into pDM4 (Table 1), and introduced into E. coli S17-1λpir and the plasmids were Journal of Proteome Research • Vol. 8, No. 11, 2009 5337

research articles mobilized into the F. tularensis strain FSC155 (LVS) by conjugation as previously described.18 The extents of deletions were as follows: FTL_1096, deletion between codons 4-369 (366 amino acids); FTL_0765 deletion between codons 5-300 (296 amino acids); FTL_1637, deletion between codons 9-341 (333 amino acids. Isolation of RNA and RT-PCR. Bacteria were grown for 16 h in Chamberlain medium.19 The TRIzol reagent (Life Technologies) was used for RNA extraction. Total RNA was extracted from 0.5 mL of bacterial culture and treated with RNase-free DNase I (Roche, Germany). An aliquot of the RNA (3 µg) was used to synthesize cDNA using random hexamers (final concentration 25 ng µL-1) and Superscript III reverse transcriptase according to the manufacturer’s recommendations (Life Technologies). Negative control reactions omitting reverse transcriptase were set up in parallel. RT-PCR was performed using DyNAzyme II polymerase (Finnzymes, Finland) and transcription of the region between primers A and G was verified (Table 2). Infection of Macrophages. The mouse monocyte macrophage cell line J774.2 (ECACC ref No: 85011428) was cultured in Dulbecco’s Modified Eagle Medium (DMEM, Gibco) supplemented with 10% of fetal bovine serum (FBS, Gibco) and 5 µg · mL-1 of gentamicin (Invitrogen) at 37 °C in the presence of 5% CO2. Before each experiment, the cells were cultured at least 48 h in medium without gentamicin. For the cell infection experiments, the different F. tularensis strains were used at a multiplicity of infection (MOI) of 500. Infected macrophages were incubated for 2 h at 37 °C in 5% atmosphere. To eliminate the extracellular bacteria, cells were washed three times with PBS and incubated for 1 h in medium supplemented with gentamicin at a concentration of 50 µg · mL-1. Finally, the cells were washed three additional times with PBS before complete cultivation medium was added. Macrophage Proliferation Assay. In the macrophage proliferation assay, J774.2 cells were infected in triplicate as described above. An iglC mutant strain constructed in F. tularensis LVS18 kindly provided by A. Sjostedt was included as a control in the experiments. At selected time points (0, 24, and 48 h) after infection, J774.2 cells were lysed by 0.1% sodium deoxycholate and the number of intracellular bacteria was determined by viable count (cfu). The lysates were serially diluted in PBS and plated on McLeod agar. Plates were incubated for 3 days at 37 °C in the presence of 5% CO2. The Cell Viability Assay. J774.2 cells were infected in triplicates as described above using a MOI 500. The viability of J774.2 cells was determined by trypan blue staining of infected cells at selected time points after infection (0, 24, and 48 h). Cytotoxicity Assay. To assay cytotoxicity, J774.2 cells were infected with the different strains in triplicate as described above. Supernatants of infected macrophages were sampled at 2, 24, and 42 h after infection and assayed for release of lactate dehydrogenase (LDH) from damaged cells. The LDH activity was detected using Cytotoxicity Detection Kit (Roche Diagnostics, Germany) and measured on plate reader FLUOStar OPTIMA (BMG Labtech, Germany). The fraction of affected cells was calculated as relative cytotoxicity (%) where the value for J774.2 cells lysed with 2% Triton X-100 was set as 100%. Mouse Infection Studies. Groups of six 8-9 weeks old female pathogen free BALB/c mice were housed under conventional conditions; food and water were given ad libitum, and the mice were allowed to acclimatize for at least 7 days before starting 5338

Journal of Proteome Research • Vol. 8, No. 11, 2009

Straskova et al. the experiment. Thereafter, the mice were infected with the different F. tularensis LVS strains intraperitoneally (i.p.) using an infection dose of 104 cfu/mice. A control group of mice were infected with sterile saline only. Infected mice were observed twice a day to monitor symptoms of infection. Assay for Disulfide Oxidoreductase Activity. The ability of F. tularensis DsbA homologue to catalyze the reduction of human insulin (Sigma-Aldrich) in the presence of dithiothreitol (DTT) was tested as described previously.20 The reaction mixtures (0.6 mL) contained 150 µM insulin in 0.1 M potassium phosphate buffer, pH 7.0, and 2 mM EDTA, protein catalysts 5 µM E. coli thioredoxin (Sigma-Aldrich) or 5 µM recombinant F. tularensis DsbA homologue (Appronex, Czech Republic). The reactions were started by adding DTT to a final concentration of 0.33 mM. Measurements were performed at 650 nm every 30 s for 1 h. The uncatalyzed reduction of insulin by DTT was monitored in a control reaction without addition of DsbA or thioredoxin. Preparation of Membrane Enriched Fractions. F. tularensis LVS and the isogenic dsbA mutant strain (∆FTL_1096) were cultivated in Chamberlain medium19 to OD600nm 0.65-0.70 and washed twice in PBS. The bacteria were resuspended in 50 mM Tris/HCl (pH 8.0) and then disintegrated by two passages through a French pressure cell at 16 000 psi. The undisrupted microbes were eliminated by centrifugation. Cellular proteins (23 mg) (determined by Bicinchoninic Acid Kit, Sigma-Aldrich) were diluted 1:10 with ice-cold 0.1 M sodium carbonate (pH 11) and stirred for 1 h at 4 °C. The carbonate buffer insoluble material containing membrane proteins was collected by ultracentrifugation in a Beckman Optima MAX ultracentrifuge (Palo Alto, CA) at 115 000g for 1 h at 4 °C. The pellet was dissolved in 1.5 mL of rehydration buffer for two-dimensional electrophoresis (7 M urea, 2 M thiourea, 1% (w/v) ASB-14, 1% Triton X-100, 40 mM Tris, 2 mM tributylphosphine) or in 120 µL of 0.2% RapiGest (Waters). Two-Dimensional Electrophoresis (2-DE), Image Analysis and Protein Identification. The protein samples were separated using isoelectric focusing on 18 cm IPG strips with pH gradient 3-10 NL, 6-11 (GE Healthcare Bio-Sciences AB, Sweden) and gradient 9-16% SDS-PAGE for the second dimension, as described previously.14 Proteins were visualized by sensitive ammoniacal silver staining21 for comparative analysis or by Coomassie G-250 (Colloidal Blue Stain Kit, Invitrogen, San Diego, CA) for MS identifications. Three independent samples were prepared for each strain to confirm reproducibility. Each sample was used for preparation of one gel of pH gradient 3-10 and pH gradient 6-11. Thus, the final set comprised 6 images for wide pH gradient and 6 images for basic pH gradient. The gels were scanned using a CCD camera (Image Station 2000R, Eastman Kodak, Rochester, NY) and the data were analyzed by ImageMaster 2D Platinum 6.0 (GE Healthcare). Finally, the gels were divided into two classes corresponding to the wild-type LVS strain and ∆FTL_1096 mutant strains and analyzed as described previously.14 Relative spot volumes (% vol) were used for spot quantification and normalized data were analyzed by Student’s t test. Spots with a p-value e0.05 and fold changes greater than 2.5 were defined as significantly different. Proteins spots of interest were excised from Coomassie stained gels and trypsin digested in-gel at 37 °C overnight. Resulting peptides were mixed in 1:1 ratio with matrix solution (5 mg/mL R-cyano 4-hydroxycinnamic acid in 50% acetonitrile (ACN), 0.1% trifluoroacetic acid (TFA)) and spotted on MALDI

Proteome Analysis of an Attenuated F. tularensis dsbA Mutant plate. The mass spectra were recorded on ABI 4800 MALDI -TOF/TOF mass analyzer (Applied Biosystems). The peptide mass fingerprints (PMFs) were recorded in the reflectron mode of the instrument in the m/z range 800-4000 Da and calibrated internally using peptides occurring due to trypsin autolysis as markers. The fragmentation analysis of eight most intensive peaks was performed without applying CID. The acquired data were evaluated using GPS Explorer software v.3.6 (Applied Biosystems) that integrates the Mascot search algorithm against F. tularensis subsp. holarctica LVS genome (NC_007880). Selected parameters for identified proteinsstotal peptide count, protein score, protein score confidence interval (%) and sequence of unique peptidessare summarized in Supporting Information (Table 1). Protein score confidence intervals greater than 95 were significant (p < 0.05). For proteins not identified by MALDI-TOF/TOF, LC-nanoESI-MS/MS was performed on CapLC Q-TOF Ultima API (Waters, U.K.). Protein digests were recovered from gel pieces by sequential extraction with 50 µL of 1% TFA in ACN. The extract was concentrated in a vacuum centrifuge and suitably diluted in buffer A (2% ACN, 98% water and 0.1% formic acid). Data Directed Analysis was recorded for each protein spot digest. Data were processed using the ProteinLynx Global Server 2.1. (smoothed by Savitzky-Golay 2 times, deisotoped, 80% peak height centroided). Database search was performed using the same software platform (PLGS 2.1.) against NCBInr (version 20070417). One hundred percent probability of match and a minimum two peptide fragmentation spectra were required (as assigned by software after validation). ITRAQ Labeling and Peptide Immobilized pH Gradient Isoelectric Focusing. Samples dissolved in 0.2% RapiGest containing 100 µg of protein were supplemented with 1 M triethanolammonium bicarbonate (TEAB) buffer pH 8.5 (SigmaAldrich) to a final concentration of 0.5 M and labeled with iTRAQ reagents (Applied Biosystems) according to the manufacturer’s protocol. ITRAQ labels 114-117 were used according to the following scheme: first replicate, LVS strain, iTRAQ 114 and ∆FTL_1096 mutant, iTRAQ 115; second replicate, LVS strain, iTRAQ 116 and ∆FTL_1096 mutant, iTRAQ 117; third replicate, LVS strain, iTRAQ 114 and ∆FTL_1096 mutant, iTRAQ 116; fourth replicate, LVS strain, iTRAQ 115 and ∆FTL_1096 mutant, iTRAQ 117. The mixed samples were desalted using OASIS HLB 1 cm3 (10 mg) extraction cartridges (Waters, U.K.). Peptides eluted with 0.1% TFA in 80% ACN were vacuum-dried, and washed with 50 µL of water and dried again. For each iTRAQ labeled sample, 100 µg of peptides was dissolved in 150 µL of 4 M urea, 0.5% IPG buffer pH 3-10 (GE Healthcare, Sweden) in 50% trifluoroethanol and applied onto a 7 cm long, pH 3-10 linear IPG strip (GE Healthcare, Sweden). The peptides were submitted to isoelectric focusing and then extracted from 10 equally cut gel pieces as described.22 Finally, the extracted peptides were reconstituted in 40 µL of mobile phase A (5% ACN, 95% water, and 0.1% TFA v/v). Liquid Chromatography-Mass Spectrometry. Peptides were separated on an Atlantis dC18 3 µm, 100 Å, 0.075 × 150-mm column (Waters) in combination with a C18 PepMap100, 5 µm, 100 Å, 0.3 × 5-mm trap column (Dionex) using the UltiMate 3000 nano-LC system (Dionex). The mobile phases were A, 5% ACN/95% water/0.1% TFA and B, 80% ACN/20% water/0.1% TFA (v/v). An aliquot of 10 µL from each IEF fraction was loaded for 5 min with 2% ACN/95% water/0.1% TFA onto the trap column at flow rate of 20 µL min-1.The peptide separation was performed by a linear gradient formed by mobile phase A and

research articles

mobile phase B, from 0 to 50% of mobile phase B in 60 min at a flow rate of 0.25 µL min-1. The Probot (Dionex) was used for fraction collection (every 12 s between 16 and 52 min) and MALDI matrix addition. The column effluent was continuously mixed with 2 mg mL-1 R-cyano-4-hydroxycinnamic acid (LaserBio Laboratories, Sophia-Antipolis Cedex, France) in 50% ACN/50% water/0.1% TFA at a flow rate of 1.0 µL min-1. The mass spectrometric analysis was performed on a 4800 MALDI TOF/TOF Analyzer (Applied Biosystems). Mass spectra were acquired from 800 to 4000 m/z window in the reflector positive ion mode. Fragmentation of automatically selected precursors was performed at collision energy of 1 kV with argon as a collision gas. One MS/MS spectrum was accumulated from 3000 laser shots. Data acquisition and processing were carried out using 4000 Series Explorer software v 3.5 (Applied Biosystems). Data Analysis. Protein identification and quantification was conducted using the ProteinPilot software v 2.0.1 (Applied Biosystems) equipped with a Paragon searching algorithm23 and a Proteomic System Performance Evaluation Pipeline script that permits false positive discovery rate (FDR) estimation.24 The samples were described using the following parameters in the Paragon method: peptides labeled by iTRAQ 4plex; cysteine residues modified by methyl methanethiosulfonate; digestion performed using trypsin. Data were evaluated using the ssp. holarctica LVS protein database downloaded from NCBI, containing 1754 entries. For protein identification, quantification and FDR determination, data were searched against concatenated database that contained the forward and reversed protein sequences. The Detected Protein Threshold was set to the lowest value of 10%, to include enough decoy hits for FDR analysis. The labeling efficiency was calculated as a ratio of the number of peptides carrying iTRAQ modification and the total number of peptides. For quantification, the ProteinPilot software excluded peptides with confidence 95% peptide sequences. In data set 2 (third and fourth replicates), the number of spectra identified was 6937 of which 3694 were unique high confident >95% peptide sequences. The numbers of proteins identified at the level of 5% FDR were 745 and 762 in data set 1 and in data set 2, respectively, of which 655 were 5342

Journal of Proteome Research • Vol. 8, No. 11, 2009

Figure 6. Proteomic comparison between parental LVS and ∆FTL_1096 mutant strains using 2-DE gel electrophoresis. Enlarged regions with the proteins significantly altered in the ∆FTL_1096 mutant as compared to the parental LVS are shown.

common for both data sets. The iTRAQ labeling efficiency was 96% and 95% for data set 1 and data set 2, respectively. Quantitative analysis of the data revealed significantly different levels of nine proteins, two proteins showed lower levels and seven proteins higher levels in the mutant strain. These proteins

research articles

Proteome Analysis of an Attenuated F. tularensis dsbA Mutant

Table 3. Proteins with Significantly Altered Expression in ∆FTL_1096 Mutant Strain Detected by Classical (2-DE) and/or Quantitative Shotgun Proteomic Approaches (iTRAQ)

locus

a

FTL_1579 FTL_1532 FTL_1306 FTL_1306 FTL_1306 FTL_1060 FTL_1060 Unknown FTL_0115 FTL_1116 FTL_1521 FTL_0661 FTL_0694 FTL_1097 FTL_1096

protein name

2-DE: fold change/ Student’s confidence levelc

b

Hypothetical protein YP_514218 Hypothetical protein YP_514178 Hypothetical protein, YP_513977, basic variant Hypothetical protein, YP_513977, middle variant Hypothetical protein, YP_513977, acidic variant Serine-type D-Ala-D-Ala carboxypeptidase, YP_513757, basic variant Serine-type D-Ala-D-Ala carboxypeptidase, YP_513757, acidic variant Unidentified protein Conserved hypothetical protein, YP_512913, YP_513845

u/p < 0.001 u/p < 0.001 6.8/p < 0.001 4.4/p < 0.001 4.5/p < 0.001 4.8/p < 0.001 3.1/p < 0.001 3/p < 0.001 --

Chitinase family 18 protein, YP_514168 Hypothetical protein, YP_513413 Hypothetical protein, YP_513445 Macrophage infectivity potentiator, fragment, YP_513789a Conserved hypothetical lipoprotein, YP_513788

-2.9/p < 0.05 -5.6/p < 0.001 -N/p < 0.001

iTRAQ: up-/down-d

bioinformatical analysise

UpUpUp-

OM or PP, Sp, Sp-I OM or PP, Sp OM or PP, Sp

Up-

OM or PP, Sp

-Up-

n.d. Sp-I

UpUp-DownDown-

Sp-I OM or PP, Sp OM or PP, Sp OM or PP, Sp-I OM or PP, Sp

a Loci correspond to locus tag designations for predicted coding sequences in F. tularensis subsp. holarctica genome sequence. b Protein name and accession number according to NCBI. c Proteins found on two-dimensional gels. Fold change in mutant strain comparing to LVS strain: u, unique expression in mutant strain; N, not detected in mutant strain; --, not detected on 2-D gels. d Up- or down-regulated proteins according to following criteria: statistical significance p < 0.05, relative changes g1.5 for up-regulated or e0.67 for down-regulated proteins. e Data obtained from bioinformatical analysis using the programs and databases: B-PSORT, SignalP, LipoP, PROSITE, Interproscan, Pfam, NCBInr.). Sp-I, signal peptide cleaved by signal peptidase I; Sp, signal peptide cleavage site; OM, outer membrane protein; PP, periplasmic localization; n.d., not done.

were quantified by at least 5 data points of which 3 represented unique peptide sequences (Table 3). The iTRAQ analysis confirmed the elevation of all proteins detected on 2-DE. Furthermore, the abundance of two additional proteins was found to be increased, the Chitinase family 18 protein and conserved hypothetical protein encoded by two identical genes FTL_1161 and FTL_0115 localized in the 33.9-kb duplicated Francisella pathogenicity island (FPI). Conversely, the shotgun approach failed to confirm the abrogation of the FTL_0694 hypothetical protein production detected by 2-DE approach. Instead, the shotgun procedure found the macrophage infectivity potentiator encoded by FTL_1097 to be significantly decreased in the dsbA mutant. These differences might reflect the complementary character of gel-based and nongel-based proteome technologies. It is striking that all identified proteins contained consensus sequences for signal peptides indicating that they localize either to the periplasm, outer membrane or are secreted (Table 3). In summary, by applying two different proteomic approaches, we were able to identify several proteins with significantly different abundance in the dsbA mutant compared to the wt strain. Proteins with significantly increased levels in the mutant could be regarded as potential DsbA substrates in F. tularensis, and some of these proteins may be directly involved in virulence and responsible for the attenuated phenotype of the dsbA mutant.

Discussion Successful new strategies for vaccines and therapeutics must be based on extensive knowledge of the molecular mechanisms of virulence. In a previous study,14 we used a comparative proteomic approach that was applied on F. tularensis strains of different virulence properties as a means to identify novel potential virulence factors. On the basis of this study, three genes encoding hypothetical lipoproteins were selected for further studies to confirm their potential role as virulence determinants: FTL_1096, FTL_1637 and FTL_0765 (LVS nomenclature). Two of these, FTL_1637 and FTL_0765, have not been studied so far and both displayed homology to VacJ that

has previously been shown to be a virulence determinant in Shigella.16 By using palmitoylation, we confirmed that FTL_1637 indeed encodes a lipoprotein, while as in our previous proteome study,14 we were unable to detect expression of the gene product encoded by FTL_0765 on the 2-D gels. It is possible that this gene is either expressed at levels too low to allow detection or that it is not expressed under the in vitro conditions used in our study. The genes encoding both these VacJ-like lipoproteins were targeted by in-frame deletion mutagenesis. Neither of the two VacJ homologues was however found to be required for intracellular survival or replication in macrophages and was not attenuated in the mouse infection model for tularemia. Hence, the two VacJ homologues encoded by FTL_1637 and FTL_0765 do not appear to play any significant role in virulence of F. tularensis LVS strain at least not in the mouse infection model. FTL_1096 was identified to be homologous to a protein family of disulfide oxidoreductases, DsbA, and also shows similarity to Com1, a 27-kDa outer membrane-associated immunoreactive protein originally found in both acute and chronic disease strains of Coxiella burnetti. (Pfam on http:// pfam.sanger.ac.uk). DsbA proteins are responsible for introduction of disulfide bonds into newly synthesized proteins that are translocated to the periplasm. DsbA has been found to contribute significantly to pathogenesis of numerous pathogenic bacteria and has been shown to be necessary for the assembly and/or function of toxins and secreted enzymes and proteins involved for example in adhesion, motility, bactericidal activity, secretion (type III secretion system), capsule biogenesis or DNA uptake.15 Several studies indicate that DsbA-like proteins are also important for virulence in F. tularensis. Genome-wide screening of F. tularensis LVS using signaturetagged mutagenesis implicated a possible role for DsbA (FTL_1096) in lung infection.3 In another study using the Himar1-based transposon system, an insertion mapping to FTL_1096 displayed a growth defect in macrophages and was attenuated in the mouse model of infection (i.p. administration) but, in contrast to our finding here, it was not impaired for Journal of Proteome Research • Vol. 8, No. 11, 2009 5343

research articles

Straskova et al. 27

cytotoxicity on infected macrophages. Further a transposoninsertion mutant in the DsbA-like protein (FTT1103) in F. tularensis subsp. tularensis strain Schu S4 was found to be deficient in intracellular replication in HepG2 cells.5 Recently, Qin et al. verified that the DsbA homologue is an essential virulence factor in Schu S410 and that mutants are defective in replication and phagosomal escape in J774 cells. In addition, they also established that the mutant is highly attenuated in the mouse model by intranasal, intraperitoneal, subcutaneous as well as intravenous infection routes. Intranasal immunization with FTT1103 mutant protected mice from subsequent intranasal challenge with the Schu S4 strain. The transmembrane DsbB protein can promote oxidation of reduced DsbA and is thereby required to maintain DsbA enzymatic activity.28 Interestingly, a Schu S4 transposon-insertion dsbB mutant was also found to be defective in intracellular survival and highly attenuated in mice; however, in contrast to DsbA,10 the dsbB mutant did not induce protective immunity.9 Despite all these findings, many questions concerning the function, structure and the bases for attenuation and immunoprotective effect of dsbA mutant strains remain to be elucidated. In this study, we present new findings concerning the potential role of DsbA in LVS. The DsbA like protein of F. tularensis is predicted to be a lipoprotein (http://www.ncbi.nlm.nih.gov) (http://www.cbs. dtu.dk/services/LipoP/), but until now, experimental evidence for this has been lacking. Here, we used incorporation of tritium labeled palmitic acid to confirm the presence of lipid modification in the F. tularensis LVS DsbA-like protein. Such a modification is quite unusual in DsbA proteins of Gram-negative bacteria but has also been verified in Neisseria meningitidis.29 The lipidation of the F. tularensis Schu S4 DsbA protein is probably linked to its ability to activate TLR2-mediated signaling as described in a recent study.30 We also present the first experimental evidence that DsbA has disulfide oxidoreductase activity and show that recombinant F. tularensis DsbA-like protein could catalyze the reduction of insulin disulfide bonds by DTT similar to E. coli thioredoxin. The disulfide oxidoreductase acitivity of DsbA protein is a prerequisite for toxin secretion or proper folding of outer membrane proteins including several known virulence factors in other pathogens.15 We therefore decided to investigate if misfolded proteins accumulated in the membranes of in the dsbA mutant. For this purposes, an in-frame deletion mutant in F. tularensis subsp. holarctica LVS was constructed and first the mutant was confirmed to be attenuated for intracellular replication as well as for virulence in mice after intraperitoneally challenge. Furthermore, the mutant did not affect viability of infected cells and showed decreased cytotoxicity. The importance of this gene for in vivo virulence was also verified in a virulent clinical isolate of a subsp. holarctica strain FSC200 (data summarized in Supporting Information). The inframe deletion mutant in FSC200 was highly attenuated and C57Bl/6 mice challenged subcutaneously with 4 × 104 cfu all survived and mice preinfected in the same way were also fully protected against a challenge with wild-type parental strain with doses up to 4 × 105 cfu. Using two distinct comparative proteomic approaches, we succeeded in the identification of several proteins with significantly altered abundance in membrane enriched fractions of the dsbA mutant strain compared to the wild-type strain. The identified proteins included five hypothetical proteins, the 5344

Journal of Proteome Research • Vol. 8, No. 11, 2009

serine-type D-Ala-D-Ala carboxypeptidase and Chitinase family 18 protein that all were more abundant in the mutant strain. Several cysteine residues can be found in their amino acid sequences further supporting the possible role of the DsbA protein in their folding process. Serine-type D-Ala-D-Ala carboxypeptidase has been shown to be a virulence determinant in Brucella abortus and mutants failed to replicate in host cells.31 Moreover, this enzyme belongs to penicilin-binding proteins that are membrane-associated macromolecules participating in the cell wall synthesis and serving as the targets of β-lactame antibiotics.32 Chitinases have been found to be secreted in numerous bacteria,33 including F. tularensis subsp. novicida.34 The Chitinase family 18 protein was found to be overexpressed by subspecies tularensis during in vivo growth,35 however, the appropriate F. tularensis LVS mutant strain was not attenuated in mouse infection experiments via the intradermal route.8 Chitinases are important for vector-host transmission of various arthropod-borne protozoal parasites,36 and since F. tularensis is an arthropod-borne bacterium, it might play a role in tularemia spread via such vectors. Unfortunately, the hypothetical proteins do not exhibit any homology to known bacterial proteins in accessible databases and therefore their biological function is difficult to predict at this point. In the case of the FTL_1306 encoded hypothetical protein, the presence of the tetratricopeptide repeat and Sel1like repeat motifs were revealed. Bacterial proteins containing these motifs have been shown to mediate interaction between bacterial and eukaryotic host cells, entry of Legionella pneumophila into epithelial cells and macrophages and exopolysaccharide synthesis.37 Recently, this protein was identified as novel determinant of F. tularensis Schu S4 virulence.7 The conserved hypothetical protein encoded by the two identical FPI genes, FTL_1161 and FTL_0115, is another potential virulence determinant and like the other studied FPI-encoded proteins, might play an important role in pathogenesis of tularemia.38 Bioinformatic analysis of another hypothetical protein FTL_1579 revealed that it might be secreted which is well in accordance with our experimental data that show the release of this protein into culture medium (unpublished results, submitted for publication). Furthermore, this protein is also expressed at significantly increased levels after engulfment by macrophages (unpublished results, submitted for publication). The gene encoding the down-regulated macrophage infectivity potentiator (MIP) appears to be encoded in the same operon as dsbA. On the basis of the presence of Nterminal FKBP-type peptidyl-prolyl isomerase domain, this protein might be involved in protein folding. MIP is a known virulence factor in intracellular pathogen L. pneumophila.39 In conclusion, we have demonstrated that genes FTL_1637 and FTL_0765 encoding homologues to VacJ appear to be dispensable for F. tularensis virulence. On the other hand, FTL_1096 that encodes a DsbA-like lipoprotein plays an important role in the F. tularensis LVS virulence in mice and the dsbA mutant also induced robust immunity and protection against challenge with fully virulent type B strains. These findings are in agreement with previously published study concerning F. tularensis subsp. tularensis Schu S4 DsbA-like protein.10 Here, we experimentally confirmed the oxidoreductase activity of this protein and identified several proteins whose localization and function seem to depend on DsbA enzymatic activity. Misfolding of these proteins could be then responsible for the virulence attenuation of the dsbA mutant.

Proteome Analysis of an Attenuated F. tularensis dsbA Mutant Work is ongoing in our laboratory to address the role of these genes in the pathogenesis of tularemia.

Acknowledgment. This study was supported by the Czech Science Foundation GACR 310/06/P266 and GACR 310/07/0226, by Ministry of Health 9747 and by Ministry of Education, Youth and Sports OC151. We thank Maria Safarova, Lenka Luksikova, Alena Firychova and Jana Michalickova for their excellent technical assistance. Peptide IEF was performed according to a protocol kindly provided by Dr. Denis Hochstrasser from Geneva University Hospital, Switzerland. Supporting Information Available: Selected identification and/or quantification parameters for proteins identified from 2-D gels or proteins considered to be differentially expressed by the shotgun approach are summarized in Supporting Information. Additionally the analyses performed with the dsbA mutant strain in F. tularensis subsp. holarctica FSC200 (mouse infection and protection study) mentioned in the discussion are included in the Supporting Information as well. This material is available free of charge via the Internet at http://pubs.acs.org. References (1) Oyston, P. C.; Sjostedt, A.; Titball, R. W. Tularaemia: bioterrorism defence renews interest in Francisella tularensis. Nat. Rev. Microbiol. 2004, 2 (12), 967–78. (2) Barker, J. R.; Klose, K. E. Molecular and genetic basis of pathogenesis in Francisella tularensis. Ann. N.Y. Acad. Sci. 2007, 1105, 138–59. (3) Maier, T. M.; Casey, M. S.; Becker, R. H.; Dorsey, C. W.; Glass, E. M.; Maltsev, N.; Zahrt, T. C.; Frank, D. W. Identification of Francisella tularensis Himar1-based transposon mutants defective for replication in macrophages. Infect. Immun. 2007, 75 (11), 5376–89. (4) Gray, C. G.; Cowley, S. C.; Cheung, K. K.; Nano, F. E. The identification of five genetic loci of Francisella novicida associated with intracellular growth. FEMS Microbiol. Lett. 2002, 215 (1), 53– 6. (5) Qin, A.; Mann, B. J. Identification of transposon insertion mutants of Francisella tularensis tularensis strain Schu S4 deficient in intracellular replication in the hepatic cell line HepG2. BMC Microbiol. 2006, 6, 69. (6) Tempel, R.; Lai, X. H.; Crosa, L.; Kozlowicz, B.; Heffron, F. Attenuated Francisella novicida transposon mutants protect mice against wild-type challenge. Infect. Immun. 2006, 74 (9), 5095– 105. (7) Wehrly, T. D.; Chong, A.; Virtaneva, K.; Sturdevant, D. E.; Child, R.; Edwards, J. A.; Brouwer, D.; Nair, V.; Fischer, E. R.; Wicke, L.; Curda, A. J.; Kupko, J. J., III; Martens, C.; Crane, D. D.; Bosio, C. M.; Porcella, S. F.; Celli, J. Intracellular biology and virulence determinants of Francisella tularensis revealed by transcriptional profiling inside macrophages. Cell Microbiol. 2009, 11 (7), 1128– 50. (8) Kadzhaev, K.; Zingmark, C.; Golovliov, I.; Bolanowski, M.; Shen, H.; Conlan, W.; Sjostedt, A. Identification of genes contributing to the virulence of Francisella tularensis SCHU S4 in a mouse intradermal infection model. PLoS One 2009, 4 (5), e5463. (9) Qin, A.; Scott, D. W.; Mann, B. J. Francisella tularensis subsp. tularensis Schu S4 disulfide bond formation protein B, but not an RND-type efflux pump, is required for virulence. Infect. Immun. 2008, 76 (7), 3086–92. (10) Qin, A.; Scott, D. W.; Thompson, J. A.; Mann, B. J. Identification of an essential Francisella tularensis subsp. tularensis virulence factor. Infect. Immun. 2009, 77 (1), 152–61. (11) Melillo, A. A.; Mahawar, M.; Sellati, T. J.; Malik, M.; Metzger, D. W.; Melendez, J. A.; Bakshi, C. S. Identification of Francisella tularensis live vaccine strain CuZn superoxide dismutase as critical for resistance to extracellular generated reactive oxygen species. J. Bacteriol. 2009, 191 (20), 6447–56. (12) Ludu, J. S.; de Bruin, O. M.; Duplantis, B. N.; Schmerk, C. L.; Chou, A. Y.; Elkins, K. L.; Nano, F. E. The Francisella pathogenicity island protein PdpD is required for full virulence and associates with homologues of the type VI secretion system. J. Bacteriol. 2008, 190 (13), 4584–95.

research articles

(13) Oyston, P. C. Francisella tularensis: unravelling the secrets of an intracellular pathogen. J. Med. Microbiol. 2008, 57 (Pt. 8), 921–30. (14) Pavkova, I.; Reichelova, M.; Larsson, P.; Hubalek, M.; Vackova, J.; Forsberg, A.; Stulik, J. Comparative proteome analysis of fractions enriched for membrane-associated proteins from Francisella tularensis subsp. ularensis and F. tularensis subsp. holarctica strains. J. Proteome Res. 2006, 5 (11), 3125–34. (15) Heras, B.; Shouldice, S. R.; Totsika, M.; Scanlon, M. J.; Schembri, M. A.; Martin, J. L. DSB proteins and bacterial pathogenicity. Nat. Rev. Microbiol. 2009, 7 (3), 215–25. (16) Suzuki, T.; Murai, T.; Fukuda, I.; Tobe, T.; Yoshikawa, M.; Sasakawa, C. Identification and characterization of a chromosomal virulence gene, vacJ, required for intercellular spreading of Shigella flexneri. Mol. Microbiol. 1994, 11 (1), 31–41. (17) Sambrook, J.; Russel, D. Molecular Cloning: A laboratory Manual; Spring Harbor Laboratory Press: Cold Spring Harbor, NY, 2001. (18) Golovliov, I.; Sjostedt, A.; Mokrievich, A.; Pavlov, V. A method for allelic replacement in Francisella tularensis. FEMS Microbiol. Lett. 2003, 222 (2), 273–80. (19) Chamberlain, R. E. Evaluation of live tularemia vaccine prepared in a chemically defined medium. Appl. Microbiol. 1965, 13, 232– 5. (20) Holmgren, A. Thioredoxin catalyzes the reduction of insulin disulfides by dithiothreitol and dihydrolipoamide. J. Biol. Chem. 1979, 254 (19), 9627–32. (21) Hochstrasser, D. F.; Patchornik, A.; Merril, C. R. Development of polyacrylamide gels that improve the separation of proteins and their detection by silver staining. Anal. Biochem. 1988, 173 (2), 412–23. (22) Lenco, J.; Link, M.; Tambor, V.; Zakova, J.; Cerveny, L.; Stulik, A. J. iTRAQ quantitative analysis of Francisella tularensis ssp. holarctica live vaccine strain and Francisella tularensis ssp. tularensis SCHU S4 response to different temperatures and stationary phases of growth. Proteomics 2009, 9 (10), 2875–82. (23) Shilov, I. V.; Seymour, S. L.; Patel, A. A.; Loboda, A.; Tang, W. H.; Keating, S. P.; Hunter, C. L.; Nuwaysir, L. M.; Schaeffer, D. A. The Paragon Algorithm, a next generation search engine that uses sequence temperature values and feature probabilities to identify peptides from tandem mass spectra. Mol. Cell. Proteomics 2007, 6 (9), 1638–55. (24) Tang, W. H.; Shilov, I. V.; Seymour, S. L. Nonlinear fitting method for determining local false discovery rates from decoy database searches. J. Proteome Res. 2008, 7 (9), 3661–7. (25) Lai, X. H.; Golovliov, I.; Sjostedt, A. Expression of IglC is necessary for intracellular growth and induction of apoptosis in murine macrophages by Francisella tularensis. Microb. Pathog. 2004, 37 (5), 225–30. (26) Lai, X. H.; Golovliov, I.; Sjostedt, A. Francisella tularensis induces cytopathogenicity and apoptosis in murine macrophages via a mechanism that requires intracellular bacterial multiplication. Infect. Immun. 2001, 69 (7), 4691–4. (27) Su, J.; Yang, J.; Zhao, D.; Kawula, T. H.; Banas, J. A.; Zhang, J. R. Genome-wide identification of Francisella tularensis virulence determinants. Infect. Immun. 2007, 75 (6), 3089–101. (28) Ito, K.; Inaba, K. The disulfide bond formation (Dsb) system. Curr. Opin. Struct. Biol. 2008, 18 (4), 450–8. (29) Tinsley, C. R.; Voulhoux, R.; Beretti, J. L.; Tommassen, J.; Nassif, X. Three homologues, including two membrane-bound proteins, of the disulfide oxidoreductase DsbA in Neisseria meningitidis: effects on bacterial growth and biogenesis of functional type IV pili. J. Biol. Chem. 2004, 279 (26), 27078–87. (30) Thakran, S.; Li, H.; Lavine, C. L.; Miller, M. A.; Bina, J. E.; Bina, X. R.; Re, F. Identification of Francisella tularensis lipoproteins that stimulate the toll-like receptor (TLR) 2/TLR1 heterodimer. J. Biol. Chem. 2008, 283 (7), 3751–60. (31) Kikuchi, H.; Kim, S.; Watanabe, K.; Watarai, M. Brucella abortusdalanyl-D-alanine carboxypeptidase contributes to its intracellular replication and resistance against nitric oxide. FEMS Microbiol. Lett. 2006, 259 (1), 120–5. (32) Zapun, A.; Contreras-Martel, C.; Vernet, T. Penicillin-binding proteins and beta-lactam resistance. FEMS Microbiol. Rev. 2008, 32 (2), 361–85. (33) Folders, J.; Algra, J.; Roelofs, M. S.; van Loon, L. C.; Tommassen, J.; Bitter, W. Characterization of Pseudomonas aeruginosa Chitinase, a gradually secreted protein. J. Bacteriol. 2001, 183 (24), 7044– 52. (34) Hager, A. J.; Bolton, D. L.; Pelletier, M. R.; Brittnacher, M. J.; Gallagher, L. A.; Kaul, R.; Skerrett, S. J.; Miller, S. I.; Guina, T. Type IV pili-mediated secretion modulates Francisella virulence. Mol. Microbiol. 2006, 62 (1), 227–37.

Journal of Proteome Research • Vol. 8, No. 11, 2009 5345

research articles (35) Twine, S. M.; Mykytczuk, N. C.; Petit, M. D.; Shen, H.; Sjostedt, A.; Wayne Conlan, J.; Kelly, J. F. In vivo proteomic analysis of the intracellular bacterial pathogen, Francisella tularensis, isolated from mouse spleen. Biochem. Biophys. Res. Commun. 2006, 345 (4), 1621–33. (36) Tsai, Y. L.; Hayward, R. E.; Langer, R. C.; Fidock, D. A.; Vinetz, J. M. Disruption of Plasmodium falciparum Chitinase markedly impairs parasite invasion of mosquito midgut. Infect. Immun. 2001, 69 (6), 4048–54. (37) Mittl, P. R.; Schneider-Brachert, W. Sel1-like repeat proteins in signal transduction. Cell. Signalling 2007, 19 (1), 20–31. (38) Nano, F. E.; Zhang, N.; Cowley, S. C.; Klose, K. E.; Cheung, K. K.; Roberts, M. J.; Ludu, J. S.; Letendre, G. W.; Meierovics, A. I.; Stephens, G.; Elkins, K. L. A Francisella tularensis pathogenicity island required for intramacrophage growth. J. Bacteriol. 2004, 186 (19), 6430–6. (39) Helbig, J. H.; Konig, B.; Knospe, H.; Bubert, B.; Yu, C.; Luck, C. P.; Riboldi-Tunnicliffe, A.; Hilgenfeld, R.; Jacobs, E.; Hacker, J.; Fischer,

5346

Journal of Proteome Research • Vol. 8, No. 11, 2009

Straskova et al. G. The PPIase active site of Legionella pneumophila Mip protein is involved in the infection of eukaryotic host cells. Biol. Chem. 2003, 384 (1), 125–37. (40) Johansson, A.; Ibrahim, A.; Goransson, I.; Eriksson, U.; Gurycova, D.; Clarridge, J. E., III; Sjostedt, A. Evaluation of PCR-based methods for discrimination of Francisella species and subspecies and development of a specific PCR that distinguishes the two major subspecies of Francisella tularensis. J. Clin. Microbiol. 2000, 38 (11), 4180–5. (41) Simon, R. P. U.; Puhler, A. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gramnegative bacteria. Biotechnology 1983, 1, 784–791. (42) Milton, D. L.; O’Toole, R.; Horstedt, P.; Wolf-Watz, H. Flagellin A is essential for the virulence of Vibrio anguillarum. J. Bacteriol. 1996, 178 (5), 1310–9.

PR900570B