Proteome Analysis of Multidrug Resistance of Human Oral Squamous Carcinoma Cells Using CD147 Silencing Ye-Hong Kuang,‡,† Xiang Chen,*,‡,† Juan Su,‡ Li-Sha Wu,‡ Ji Li,‡ Jing Chang,‡ Ying Qiu,‡ Zhe-Sheng Chen,# and Takuro Kanekura§ Department of Dermatology, Xiang Ya Hospital, Central South University, Hunan, 410008, China, Department of Dermatology, Kagoshima University Graduate School of Medical and Dental Sciences, Kagoshima, 890-8520, Japan, and Department of Pharmaceutical Sciences, St. John’s University, New York 11439 Received May 13, 2008
There is a correlation between the multidrug-resistance (MDR) of cancer cells and their enhanced invasive or metastatic potential. We studied the expression of CD147, a plasma membrane glycoprotein that plays a key role in tumor metastasis by stimulating the production of matrix metalloproteinases (MMPs), in sensitive human oral squamous KB and MDR derivative KB/V cells. Reverse transcriptionPCR and flow cytometric analysis revealed that KB/V cells expressed CD147 at significantly higher levels than their parental KB cells. Using stable RNA interference, we succeeded in establishing a CD147 knock-down KB/V cell line (KB/VsiCD147). MTT colorimetric assay showed an increase in the chemosensitivity to vincristine (VCR), all transretinoic acid (ATRA), taxol, and 5-fluorouracil (5-Fu) of KB/VsiCD147 cells. Proteome analysis of KB, KB/V, and KB/VsiCD147 cell lines identified 21 differently expressed proteins. The enhanced expression of representative active proteins, GRP75 and CyPA, was confirmed by Western blotting and RT-PCR. In addition, pretreatment of KB/V cells with a CyPA-binding immunosuppressive drug, cyclosporine A (CsA), enhanced their chemosensitivity to VCR and 5-Fu. We document an abundance of molecules that interact with CD147 in the MDR of human oral squamous carcinoma cells. Additional studies are needed to investigate these novel target proteins of CD147. Keywords: CD147 • multidrug resistance • human oral squamous carcinoma cells • proteome analysis • RNA interference
Introduction Multidrug resistance (MDR) is a major obstacle to the effective treatment of malignant tumors1,2 and its complex mechanisms remain to be elucidated. Most tumors with high metastatic potential exhibit the MDR phenotype and vice versa.3,4 A functional linkage between drug resistance and metastasis has been proposed in tumor cells. Kerbel et al.5,6 reported that switched-on genes in metastatic cancer cells affect their sensitivity to chemotherapeutic drugs. However, the overlapping molecular basis for this phenomenon remains unclear. There is growing evidence that the human cell-surface molecule CD147, an integral plasma membrane glycoprotein belonging to the Ig superfamily,7,8 participates in tumor metastasis and MDR. CD147, also known as M6 antigen, extracellular matrix metalloproteinase inducer (EMMPRIN), and human basigin,9 is highly expressed on the surface of various tumor cells. It stimulates the production of multiple matrix metalloproteinases * To whom correspondence should be addressed: Xiang Chen, M.D., Ph.D., Department of Dermatology, Xiang Ya Hospital, Central South University, 87 Xiang Ya Road, Changsha, Hunan, 410008, China. Tel, +86 731 432 7377; fax, +86 731 432 8478; e-mail,
[email protected]. ‡ Central South University. † These authors contributed equally to this study. # St. John’s University. § Kagoshima University Graduate School of Medical and Dental Sciences.
4784 Journal of Proteome Research 2008, 7, 4784–4791 Published on Web 09/25/2008
(MMPs) by tumor cells and fibroblasts, thus, serving as a key regulator of tumor cell invasiveness and metastasis.10 We previously demonstrated that highly expressed CD147 on the surface of malignant melanoma (MM) cells plays an important role in its invasiveness and metastasis.11 In addition, CD147 can interact with lactate transporters and facilitate their cellsurface expression;12 it also serves as a receptor for extracellular cyclophilins.13 CD147 expression was upregulated in MDR cancer cells14 and CD147 stimulated the production of hyaluronan in mammary carcinoma cells and induced MDR in a hyaluronan-dependent manner.15,16 Thus, CD147 represents a potent target for both tumor metastatic behavior and drug resistance; however, the mechanism(s) underlying the effects of CD147 on MDR remains unclear. We used human oral squamous cell carcinoma (SCC) cells to determine whether CD147 is involved in the expression of the MDR phenotype. We employed proteome analysis to define the protein expression profiles related to CD147 knock-down. Two representative molecules that were expressed differently, GRP75 and CyPA, were further determined by Western blot analysis and RT-PCR. The effect of CyPA on the development of MDR by KB/V cells was confirmed by suppressing CyPA activity with the CyPA-binding immunosuppressive drug cyclosporine A (CsA). Our results provide new insight into CD147 protein-protein interactions in the MDR of cancer cells. 10.1021/pr800355b CCC: $40.75
2008 American Chemical Society
Proteome Analysis of MDR of Human Oral Squamous Carcinoma Cells Table 1. Oligonucleotides Used in RT-PCR Analysis gene
primer sequence
CD147
S 5′-GCAGCGGTTGGAGGTTGT-3′ AS 5′-AGCCACGATGCCCAGGAAAGG-3′ S 5′-TCAACTGATGCCTTGCA-3′ AS 5′-AACCGTACATACGACCT-3′ S 5′-CACCGTGTTCTTCGACATTG-3′ AS 5′-CCATGGCCTCCACAATATTC-3′ S 5′-GCCAAAAGGGTCATCATCTC-3′ AS 5′-GTAGAGGCAGGGATGATGTTC-3′
GRP75 CyPA GAPDH
Materials and Methods Cell Culture and Cell Lines. The human oral SCC cell line KB and its MDR derivative KB/V (KG-005, KG-127, KeyGen Biotech, Nanjing, China) were routinely cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum, 100 U/mL penicillin-G, and 100 µg/mL streptomycin at 37 °C in a humidified atmosphere containing 5% CO2. To maintain the MDR phenotype in the KB/V cell line, the medium was supplemented with 200 ng/mL vinblastine. Before the experiments, KB/V cells were incubated for 10 days in drug-free medium. Semiquantitative Reverse Transcription-PCR, Flow Cytometric Analysis, and Western Blot Analysis of CD147 Expression. Total cellular RNA was extracted using TRizol reagent (Invitrogen, Carlsbad, CA) and reverse-transcribed with a reverse transcription kit (Invitrogen, Carlsbad, CA). cDNA (2.0 µL) was PCR-amplified using the platinum Taq DNA polymerase kit (Invitrogen). Primer pairs were synthesized by Shanghai Pharmnet Biotechnologies. The sequences are shown in Table 1. The parameters for CD147 and GAPDH amplification were 94 °C for 4 min, 32 cycles at 94 °C for 50 s, 59 °C for 1 min, 72 °C for 50 s; final extension was at 72 °C for 10 min. PCR products were electrophoresed on 1.2% agarose gels and the grayscale ratio of CD147 to GAPDH was calculated. For flow cytometric analysis, 1 × 105 KB or KB/V cells were incubated for 40 min under light-shielded conditions with FITC-conjugated anti-human CD147 monoclonal antibody (mAb) diluted 1:50 (Ancell Co., Bayport, MN) or equal amount PBS as a control, washed with cold PBS, and fixed with 4% paraformaldehyde before assay by FACS Vantage flow cytometry (Becton Dickinson, San Diego, CA). For Western blot analysis, protein samples (20 µg) were separated by 12% SDS-PAGE and transferred onto PVDF membranes (Pierce Chemical, Rockford, IL). Nonspecific reactivity was blocked with 5% nonfat dry milk in TBST (10 mM Tris-HCl, 150 mM NaCl, 0.05% Tween-20, pH 7.5) for 1 h at room temperature. This was followed by 1 h incubation with the primary mouse antiCD147 antibody (Ab) diluted to 1:30 000 (Abcam. Co., Cambridge, U.K.) at room temperature, and then by incubation with the secondary HRP-conjugated goat anti-mouse IgG Ab (Santa Cruz Biotech, Santa Cruz, CA) at 1:10 000 dilution. The reactions were visualized with the ECL detection system (Pierce Chemical). Antiβ-actin Ab at 1:10 000 dilution (Sigma-Aldrich) was used to ensure equal loading of each sample. All Western blot analyses were repeated at least 3 times. Transfection of Small Interference RNA (siRNA). We previously designed 2 siRNA sequences targeting human CD147 mRNA (named pSUPER/CD147 siRNA1 and pSUPER/CD147 siRNA2).11 The sequences used were the folowing: sequence 1-1, 5′-GATCCCCGTCGTCAGAACACATCAACTTCAAGAGAGTTGATGTGTTCTGACGACTTTTTGGAAA-3′; sequence 1-2, 5′AGCTTTTCCAAAAAGTCGTCAGAACACATCAACTCTCTTGAA-
research articles
GTTGATGTGTTCTGACGACGGG-3′; sequence 2-1, 5′GATCCCCTGACAAAGGCAAGAACGTCTTCAAGAGAGACGTTCTTGCCTTTGTCATTTTTGGAAA-3′; sequence 2-2, 5′AGCTTTTCCAAAAATGACAAAGGCAAGAACGTCTCTCTTGAAGACGTTCTTGCCTTTGTCAGGG- 3′, with no homology to other human genes besides CD147 (determined by nucleotidenucleotide BLAST search); the control vector containing a scrambled sequence with no homology to other genes annealed and ligated into the linearized plasmid using T4 DNA ligase (Promega, San Luis, CA). Chemically competent DH5a Escherichia coli were transformed, and positive transformants were isolated by ampicillin selection (100 µg/mL) and amplified. The correct insertion of siRNA into pSUPER was confirmed by DNA sequencing, PCR assay, and restriction endonuclease digestion. KB/V cells were transfected with vector containing pSUPER/ CD147 siRNA1, pSUPER/CD147 siRNA2, or scrambled sequence. Transfection was with Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. Cells were selected for puromycin resistance in medium containing 400 ng/ mL puromycin (Sigma-Aldrich Corp., St. Louis, MO) and then maintained in medium containing 200 ng/mL puromycin for at least 4 weeks until the final stable single cell clones were harvested and verified. KB/V cells transfected with vector containing siRNA1 and siRNA2 were designated C1 and C2, respectively. Scrambled sequence vector was used as a transfection control and the resulting empty vector transfected subline was assigned KB/V-vector. Drug Sensitivity Assays. To assess the multidrug chemosensitivity of KB/V, KB/VsiCD147, and KB cells, they were placed in 96-well plates at a density of 1 × 104 cells/well and incubated for 24 h. The medium was then removed and replaced with fresh medium containing vincristine (VCR, Wanle, Shenzhen, China), all trans retinoic acid (ATRA, Sigma-Aldrich, St. Louis, MO), taxol (Bristol-Myers Squibb Company, New York) or 5-fluorouracil (5Fu, Haipu, Shanghai, China) dissolved in PBS with varying plasma peak concentrations (PPC; 0.1× PPC, 1× PPC, 10× PPC, and 100× PPC) for another 48 h. Then the cells were stained with 20 µL sterile MTT (3-[4, 5-dimethyl-2-thiazolyl]-2, 5-diphenyl-2H-tetrazolium bromide) dye (5 mg/mL in PBS) at 37 °C for 4 h. The culture medium was removed and 150 µL dimethylsulfoxide (DMSO) was added into each well and admixed thoroughly for 10 min. Spectrometric absorbance at 570 nm was measured with a microplate reader. The inhibition ratios were calculated as [(OD value of control - OD value of the sample)/OD value of control] × 100%. Two-Dimensional Electrophoresis (2-DE) and Image Analysis. Proteomic analysis by 2-DE was as previously documented.17 An equal amount (1.0 mg) of protein fractions of KB, KB/V, and KB/VsiCD147 cells per gel was loaded onto a 240-mm linear IPG strip (pH 3-10, Amersham Biosciences, Piscataway, NJ) for first-dimensional isoelectrofocusing (IEF). This was followed by second-dimension SDS-PAGE on an Ettan DALT II system (Amersham Biosciences), the gels were stained with modified Neuhoff colloidal Coomassie blue G-250 (Amersham Biosciences), and then scanned with an Imagescanner (Amersham Biosciences). Analysis of separate gels including background subtraction, spot intensity calibration, spot detection, 1-D calibration, the establishment of average-gel and matching was performed using the PDQuest system (Bio-Rad Laboratories, Hercules, CA). Intensity of each spot was quantified by calculation of spot volume normalization method multiplied by the total area of all the spots. Each sample was examined in triplicate. Proteins isolated from KB/V cells that Journal of Proteome Research • Vol. 7, No. 11, 2008 4785
research articles
Kuang et al.
Figure 1. RT-PCR and flow cytometric analysis of CD147. (A) RT-PCR products of total RNA from KB and KB/V cells were electrophoresed on 1.2% agarose gels. (B) Comparison of grayscale ratios of CD147/GAPDH in KB and KB/V cells. *p < 0.05 compared with KB/V cells. (C) Flow cytometric analysis of CD147 in KB and KB/V cells. (D) Western blot analysis of CD147 in KB and KB/V cells.
showed changes in average abundance for more than 2-fold variation compared to KB and C2 were defined as being differentially expressed. Protein Identification. The different protein spots were excised from preparative gels and subjected to tryptic digestion according to a reported protocol.17 Supernatants were collected, vacuum-dried, redissolved in 0.1% TFA, and mixed with R-cyano4-hydroxycinnamic (CCA) (Sigma-Aldrich Co) matrix. The mixture (1 µL) was loaded on a stainless steel plate and analyzed with a Voyager System DE-STR 4307 MALDI-TOF Mass Spectrometer (MS) (AppliedBiosystems, Foster City, CA). The parameters were set up as previously described:17 positive ion-reflector mode, accelerating voltage 20 kV, grid voltage 64.5%, mirror voltage ratio 1.12, N2-laser wavelength 337 nm, pulse width 3 ns, the number of laser shots 50, acquisition mass range 800-3000 Da, delay 100 ns, and vacuum degree 461 027 Torr. The autodigestion peaks of trypsin were used for internal calibration. A list of the corrected mass peaks was the peptide mass fingerprint (PMF). Database Analysis. Peptide-matching and protein searches against the Swiss-Prot databases were performed using the Mascot search engine (http://www.matrixscience.com/). The search parameters were as described previously.17 Briefly, the taxonomy was Homo sapiens, the enzyme was trypsin, up to 1 missed cleavage site was allowed, the peptide tolerance was 4786
Journal of Proteome Research • Vol. 7, No. 11, 2008
200 ppm, the mass value was MH+, the search range was within the experimental pI value ( 0.5 pH unit, and the experimental mass range (Mr) ( 20%. The MASCOT score of a protein matching greater than 55 was taken as the criterion for the positive identification of proteins (p < 0.05). Western Blot and RT-PCR Analysis of Proteins Interacting with CD147. Briefly, equal amounts of protein were subjected to SDS/PAGE (20 µg, 10% for GRP75 and 50 µg, 15% for CypA). Transferred membranes were incubated overnight at 4 °C with polyclonal antibody against GRP75 at 1:1000 (C19, Santa Cruz Biotechnology) or mAb against CyPA at 1:2000 (ZC001, Abcam. Co., Cambridge, U.K.). This was followed by incubation with the secondary HRP-conjugated rabbit antigoat- or goat anti-mouse IgG Ab (Santa Cruz Biotech) at 1:10 000 dilution. Bands were visualized as described above. RT-PCR was as described above. The primer pairs are shown in Table 1. The parameters for the amplification of GRP75 and CyPA were 94 °C for 4 min, 35 cycles at 94 °C for 1 min, 60 °C for 1 min, 72 °C for 1 min (GRP75) or 1.5 min (CyPA); final extension was at 72 °C for 10 min. PCR products were electrophoresed on 1.5% agarose gels. Chemosensitivity Related to the Interaction of CyPA and CD147. KB/V-vector and KB/VsiCD147 cell lines in 96-well plates were pretreated for 24 h with 200 ng/mL CsA. VCR or
Proteome Analysis of MDR of Human Oral Squamous Carcinoma Cells
research articles
Figure 2. RT-PCR and Western blot analysis of CD147 knock-down. (A) RT-PCR products of total RNA from KB/V cells, KB/V-vector, C1a, C1b, and C2 were electrophoresed on 1.2% agarose gels. (B) Comparison of grayscale ratios of CD147/GAPDH in different cell lines. *p < 0.01 compared with KB/V cells (by ANOVA). (C) Western blot analysis of the CD147 protein level in KB/V cells transfected with vector containing pSUPER/CD147 siRNA1, pSUPER/CD147 siRNA2, or scrambled sequence as a control.
5-Fu was then added to each well at their PPC, 0.2 µg/mL or 25 µg/mL, respectively, for another 48 h and MTT assays were performed. Statistical Analyses. Data analysis was with one-way ANOVA or Student’s t test. The criterion for significance was P < 0.05.
Results KB/V Cells Expressed Significantly Higher CD147 Levels than the Parental KB Cells. We compared the expression of CD147 in sensitive human oral SCC cells (KB cells), and their MDR derivative (KB/V cells). RT-PCR (Figure 1A), flow cytometric analysis (Figure 1C) and Western blot analysis (Figure 1D) showed that KB/V cells expressed higher levels of CD147 than KB cells. Quantitative estimation indicated that the grayscale ratio of CD147/GAPDH was 2.4-fold higher in KB/V cells than sensitive KB cells (1.04 ( 0.04, 0.43 ( 0.04, respectively, Figure 1B, P < 0.05). Establishment of CD147-Knock-Down KB/V Cells. We examined whether CD147 is stably suppressed by siRNA in oral SCC cells. RT-PCR and Western blot analysis were applied to validate the effects of transfection on 3 established stable clones (C1a, C1b, and C2; Figure 2A). Quantified grayscale ratios showed that, compared to the control, CD147 expression was downregulated by 50.63%, 80.54%, and 86.50% in C1a, C1b, and C2 (the corresponding ratios of CD147/GAPDH were 0.43 ( 0.02, 0.16 ( 0.02, 0.11 ( 0.03, respectively, Figure 2B, P < 0.01). CD147 protein inhibition correlated with the mRNA level (Figure 2C). C1b and C2, in which CD147 was effectively downregulated, were used in subsequent experiments. CD147 Silencing Increased the Multidrug Chemosensitivity of KB/V Cells. To determine whether CD147 contributes to the MDR phenotype of human oral SCC, we compared the vitality of KB cells, KB/V-vector, and C2 cells expressing different amounts of CD147 in the presence of VCR, ATRA, Taxol, or 5-Fu. As shown in Figure 3, at the concentrations examined, the inhibitory effect of VCR, ATRA, taxol, and 5-Fu was lower in KB/V than in KB cells (p < 0.05). Treatment of KB/V cells with CD147 siRNA significantly enhanced their
Figure 3. MTT assays for the chemosensitivity of KB cells, KB/ V-vector, and KB/VsiCD147 (C2). Cells were incubated with different concentrations of VCR, ATRA, Taxol, or 5-Fu. The inhibition ratios were calculated as [(OD value of control - OD value of the sample)/OD value of control] × 100%. The results in panels A-D are the mean ( SD from 3 independent experiments.
chemosensitivity to these antitumor drugs (P < 0.05), implying that CD147 is indeed related to susceptibility to multiple antitumor drugs. 2-DE Gel Analysis of Differentially-Expressed Proteins. To identify the proteins associated with the role of CD147 in the chemosensitivity of KB/V cells, we performed a comparative proteomics study of KB, KB/V, and C2 cells. Representative 2-DE maps are shown in Figure 4A. The 2-DE pattern of each cell line was highly reproducible and well-resolved, and approximately 1000 protein spots were visualized. Using image analysis, we compared the 2-D PAGE patterns of paired KB/V and KB cells or KB/V and C2 cells. When we combined the results of 3 independent experiments; the average number of Journal of Proteome Research • Vol. 7, No. 11, 2008 4787
research articles
Kuang et al.
Figure 4. (A) Representative 2-DE maps of 3 cells and 21 differentially expressed protein spots (arrows) were identified using MALDITOF-MS. (B) MALDI-TOF-MS of spot no. 13, identified as peptidyl-prolyl cis-trans isomerase A (CyPA) according to the matched peaks. (C) Protein sequence of CyPA. The matched peptides were in bold font and underlined.
differential protein spots that showed more than 2-fold changes in expression were 93 ( 5.84, 98 ( 7.91, respectively. We converged those spots detected in both paired cells and found that 21 proteins were differentially expressed (Figure 4A). In KB/V cells, 15 spots, including no. 13 and no. 16, were specifically upregulated; 6 spots (nos. 9, 10, 12, 14, 17, and 18) were downregulated (p < 0.05). Identification of Candidate Proteins by Matrix-Assisted Laser Desorption/Ionization Time-of-Flight Mass Spectrometry (MALDI-TOF-MS). For further characterization, we performed automated MALDI-TOF-MS and database searches on the 21 differentially expressed protein spots. All 21 proteins were identified on MALDI-TOF-MS maps and by database query. In Figure 4B, the representative spot no. 13 is shown. We input the PMF into the Mascot search engine to search the Swiss-Prot database and found that spot no. 13 protein was PPIA/cyclophilin (CyPA) (Figure 4C). The annotation of all identified proteins with their corresponding experimental Mr, pI, expression, MASCOT score, the sequence coverage and the number of peptide matches was shown in Table 2. On the basis of the protein function available from the Swiss-Prot database, the 21 identified proteins associated with stable CD147 silencing were grouped into categories such as kinase-, chaperone-, 4788
Journal of Proteome Research • Vol. 7, No. 11, 2008
metabolism-, transcription-, structure-, and signal-correlated. Most of the proteins were correlated with metabolism. Western Blot and RT-PCR Confirmation of Proteins Interacting with CD147. Of the identified candidates, GRP75 (spot no. 16) and CyPA (spot no. 13) showed significantly enhanced expression; they were subjected to further confirmation by Western blotting and RT-PCR analysis. Representative blots and comparative grayscale ratios are shown in Figure 5A,B. The ratio of GRP75/β-actin and CyPA/β-actin in KB/V cells was more than 2-fold that in KB cells (1.16 ( 0.04 vs 0.54 ( 0.05 and 0.48 ( 0.02 vs 0.20 ( 0.02), and 3-5-fold that in CD147 siRNA transfectants C1b, C2 (0.29 ( 0.02, 0.23 ( 0.03 or 0.14 ( 0.04, 0.10 ( 0.02, P < 0.05). This finding was in accordance with our previous proteomics assessment. While GRP75 mRNA levels were proportional to the protein changes, no changes in CyPA mRNA were detectable among the different cell lines (Figure 5C). Interaction of CyPA and CD147 in the Chemoresistance of KB/V Cells. To address whether an association between CD147 and CyPA is involved in the chemoresistance of KB/V cells, we conducted experiments with the CyPA-binding immunosuppressive drug cyclosporine A (CsA). MTT assay showed that CsA pretreatment restored the sensitivity of KB/V cells to
research articles
Proteome Analysis of MDR of Human Oral Squamous Carcinoma Cells Table 2. List of 21 Differentially Expressed Protein Spots Identified by MALDI-TOF MS spot
accession numbera
1 2
P35527 O00264
3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21
Q01469 P07108 P30085 P24385 P13693 P15531 Q99497 P25398 P09382 P07737 P62937 P04075 P06576 Q3ZCH0 P52597 Q96DD0 P60174 P30040 P13645
protein name
Keratin-9 Membrane-associated progesterone receptor component 1 Fatty acid-binding protein Acyl-CoA-binding protein UMP-CMP kinase G1/S-specific cyclin-D1 Translationally controlled tumor protein Nucleoside diphosphate kinase A Protein DJ-1 40S ribosomal protein S12 Galectin-1 Profilin-1 Peptidyl-prolyl cis-trans isomerase A Fructose-bisphosphate aldolase A ATP synthase subunit beta, mitochon-dria 75 kDa glucose-regulated protein Heterogeneous nuclear ribonucleoprotein F Leucine-rich repeat-containing protein 39 Triosephosphate isomerase Annexin1 Keratin-10
a Swiss-Prot database accession number. than 2-fold that in C2 and KB cells.
b
mass weight (Da)
pI
expressionb
score
62320 21772
5.19 4.56
v v
68 55
undefined 10038 22436 34448 19697 17309 20050 14859 15048 15216 18229 39851 56525 73981 45985 39048 26938 38787 58792
undefined 6.12 5.44 4.97 4.84 5.83 6.33 6.30 5.34 8.44 7.68 8.30 5.26 5.97 5.38 5.67 6.45 6.64 5.09
v v v v v v V V v V v V v v V V v v v
55 59 59 58 109 120 75 59 80 62 133 160 238 101 136 61 245 109 86
coverage
peptide matches
18% 12%
8/26 3/4
undefined 45% 16% 20% 52% 40% 38% 26% 46% 33% 70% 59% 54% 15% 38% 26% 67% 52% 24%
4/16 4/5 3/3 4/9 7/9 7/11 9/13 5/16 7/21 7/19 12/23 17/31 18/21 9/13 12/18 5/10 15/21 12/46 10/40
v: the intensity of the spot was more than 2-fold that in C2 and KB cells; V: the intensity of the spot was less
Figure 5. Western blotting and RT-PCR analysis of GRP75 and CyPA in KB and KB/V cells and in CD147 siRNA transfectants (C1b, C2). (A) Western blotting analysis of GRP75 and CyPA protein levels. (B) Comparison of the grayscale ratio of CD147/ β-actin. *p < 0.01 compared with KB/V (by ANOVA). (C) RT-PCR products of total RNA for GRP75 and CyPA.
In the current study, we first document higher CD147 expression in KB/V than the parental KB cells. This coincides with immunofluorescence and FACS findings reported by Yang et al.14 that CD147 expression was 3-4-fold higher in MDR than drug-sensitive cells. To examine the role of CD147 in the expression of the MDR phenotype by KB/V cells, we used RNA interference (SiRNA). Stable transfectants, C1b and C2, were established by transfecting pSUPER/CD147-siRNA1 or pSUPER/CD147-siRNA2 into KB/V cells. Consistent with our previous findings in human Jurkat cells,18 C2 exhibited the highest interference effect, while pSUPER/CD147-siRNA1, but not siRNA2, significantly reduced CD147 mRNA expression in the human MM cell line A375.11 The different inhibitory effects of the same siRNA in different cell lines may be attributable to a difference in the secondary structure of the nucleotide sequence at different sites or to positional effects.19,20
Discussion
We found that vector-based CD147-specific siRNA restored the sensitivity of the human oral SCC cells to various chemotherapeutics including VCR, ATRA, taxol, and 5-Fu. The drug sensitivity of the pSUPER/CD147-siRNA2 transfected C2 cells was still lower than that of the sensitive KB line, referring to other mechanisms besides CD147 pathway might also involve in MDR of KB cells. Our finding also consist with the previous research carried out by Zou et al.21 which issued that CD147 suppression increased the chemosensitivity of HO-8910 pm cells to paclitaxel, suggesting that CD147 may represent a target for adjuvant gene therapy in cancer chemotherapy.
CD147 reportedly plays a critical role not only in tumor invasiveness and metastasis, but also in the initiation of the MDR phenotype in tumor cells.11,14 Our observation that the sensitive human oral SCC cell line KB and its MDR derivative KB/V manifested equal levels of MDR-associated proteins such as P-glycoprotein (P-gp), multidrug resistance-related protein (MRP), and lung resistance-related protein (LRP) (data not shown), suggests that there are other nonclassical mechanisms in the acquisition of MDR by human oral SCC.
We describe a new method that applies proteomics combined with RNAi technology to identify proteins functionally associated with CD147 in the MDR of oral SCC. In earlier drugresistance studies, 2-DE coupled with MS identified differentially expressed proteins,22,23 and provided a novel way for elucidating the pathogenesis of MDR of cancer cells. We report that 21 proteins manifesting altered expression by CD147 knock-down exhibited a range of functions including kinase, chaperone, metabolism, transcription, structure, and signal
VCR and 5-Fu at their PPCs by 22.2% and 28.2%, respectively (p < 0.05). C2 exhibited no significant response to CsA pretreatment (2.9%, 3.0%, p < 0.05) (Figure 6).
Journal of Proteome Research • Vol. 7, No. 11, 2008 4789
research articles
Kuang et al.
Figure 6. MTT assay of the effect of the interaction of CyPA and CD147 on the chemosensitivity of KB/V cells. KB/V-vector and C2 cells were pretreated with 200 ng/mL CsA or PBS as a control. Cell viability in response to VCR (0.2 µg/mL) or 5-Fu (25 µg/mL) exposure was calculated. *p < 0.05 compared with KB/V, **p > 0.05 compared with C2 (A, B).
transduction functions. We selected a representative glucoseregulated protein 75 (GRP75) and PPIA/cyclophilin (CyPA), and because erroneous protein identification is widely appreciated in proteomic analysis, we further performed Western blot analysis and RT-PCR. GRP75 belongs to the mitochondrial-type branch of the Hsp 70 family tree triggered by various stimulators. It functions as a protective factor during glucose deprivation and performs a broad spectrum of cellular functions including the management of reactive oxygen species and mitochondrial- or intracellular trafficking.24 Our proteome analysis identified GRP75 as a potential therapeutic target related to CD147 knock-down. The expression of GRP75, increased in the KB/V cell line compared to its sensitive KB counterpart, was downregulated by CD147 silencing, suggesting that GRP75 is one of the CD147-interacting proteins that lead to the expression of the MDR phenotype by oral SCC. CyPA, a member of the immunophilin family, is a cis-trans isomerase involved in protein folding and trafficking.25 It is also the principal ligand in the immunosuppressive drug cyclosporine (CsA).26 CyPA is overexpressed in many cancer cells27,28 and CD147 is its signaling receptor.13 Most CyPA-mediated chemotactic activities were CD147-dependent.29 We found that exogenous recombinant CyPA mediated the activation, proliferation, and chemotaxis of Jurkat cells via its receptor CD147 (unpublished data). Our proteomics analysis identified CyPA as a new candidate associated with human oral SCC chemosensitivity. Other proteomics studies have shown the high expression of CyPA on MDR tumors; these findings further support the hypothesis that CyPA is a target protein for reversing MDR.30,31 Interestingly, CD147 siRNA significantly downregulated the CyPA protein level while it had no effect on the mRNA level. This discrepancy may be due to post-transcriptional modification or protein transportation and secretion. To our knowledge, ours is the first report that CD147, known to serve as an extracellular receptor of CyPA, resides directly upstream of CyPA. The effect of CD147 upregulation on CyPA provides new insights for investigating the interaction(s) between CD147 and CyPA in the MDR of human oral SCC. To study the interaction of CyPA and CD147 in the MDR of human oral SCC, we pretreated the cells with the CyPA-binding immunosuppressive drug CsA at previously recommended concentrations.32 As CsA exhibits potent antitumor activity and overcomes P-gp-mediated drug resistance,33 we simultaneously examined the sensitivity of these cells to a P-gp substrate (VCR) and a non-P-gp substrate (5-Fu). The function of CyPA was inhibited by CsA, resulting in the increased sensitivity of KB/V cells to VCR or 5-Fu. No change was observed in C2 cells that expressed low levels of CyPA due to CD147 silencing. These 4790
Journal of Proteome Research • Vol. 7, No. 11, 2008
results provide further evidence for a CyPA-CD147 signal pathway in the chemoresistance of human oral SCC. Among the 21 differentially expressed proteins we identified, most were metabolism-associated; they included members of the acyl-CoA-binding protein, UMP-CMP kinase, ATP synthase subunit beta, mitochondria, and triosephosphate isomerase (Table 2). These proteins are associated with the cellular energy metabolism and they are frequently involved in the resistance of malignant tumors to therapeutic agents.17,34 We propose that these proteins are associated with the action of CD147 on the MDR phenotype of oral SCC, presumably by changing the energy metabolism. This hypothesis is in accordance with our recent observation that highly expressed CD147 interacts with monocarboxylate transporter (MCT) 1 and 4 on the plasma membrane to promote glycolysis, resulting in the progression to the malignant phenotype of human melanoma cells (submitted for publication). A protein differentially expressed such as Galectin-1 (Putative MAPK-activating protein PM12) was previously reported to be associated with malignant tumor cells including human oral SCC metastasis.35,36 Our proteomics analysis showed that it was involved in the drug sensitivity of SCC and being regulated by CD147 as well, a supportive finding pointing out CD147 participates in tumor metastasis and MDR. However, the mechanism of Galectin-1 and CD147 interaction remains to be elucidated. Our proteomics analysis also showed that CD147 upregulates keratin-9 and -10, molecules associated with keratinocyte differentiation.37 Keratin-10 is the late differentiation marker of keratinocytes. These observations coincide with our earlier findings that CD147 expression is correlated with the differentiation of epidermal keratinocytes.38 In human oral SCC, other proteins such as DJ-1, 40S ribosomal protein S12, profilin-1, and fructose-bisphosphate aldolase A correlated inversely with the MDR phenotype. Although the interaction between these proteins and MDR or CD147 has not been documented, they may represent new candidates that interact with CD147 in the MDR of human oral SCC. In conclusion, we propose that CD147 is at least partly involved in the MDR of KB/V cells by upregulating GRP75 and CyPA. CD147 may represent a therapeutic target to overcome MDR by oral SCC.
Acknowledgment. This study was supported by the National Natural Science Foundation of China (30571682); Program for New Century Excellent Talents in University
Proteome Analysis of MDR of Human Oral Squamous Carcinoma Cells (NCET-05-0685); The Hunan Science Fund for Distinguished Young Scholars (06JJ-1005); Program for Creative Research for Ph.D. candidates to Ms. Ye-hong Kuang at university. We thank Ms. Tong Shen (St. John’s University, New York) and Ms. Yang-Min Chen (Montgomery High School, New Jersey) for editing the manuscript.
References (1) Gottesman, M. M.; Fojo, T.; Bates, S. E. Multidrug resistance in cancer: Role of ATP-dependent transporters. Nat. Rev. Cancer 2002, 2 (1), 48–58. (2) Modok, S.; Mellor, H. R.; Callaghan, R. Modulation of multidrug resistance efflux pump activity to overcome chemoresistance in cancer. Curr. Opin. Pharmacol. 2006, 6 (4), 350–4. (3) Kerbel, R. S.; Waghorne, C.; Korczak, B.; Lagarde, A.; Breitman, M. L. Clonal dominance of primary tumours by metastatic cells: Genetic analysis and biological implications. Cancer Surv. 1988, 7 (4), 597–629. (4) Su, Z. Z.; Austin, V. N.; Zimmer, S. G.; Fisher, P. B. Defining the critical gene expression changes associated with expression and suppression of the tumorigenic and metastatic phenotype in Haras-transformed cloned rat embryo fibroblast cells. Oncogene 1993, 8 (5), 1211–9. (5) Burt, R. K.; Garfield, S.; Johnson, K.; Thorgeirsson, S. S. Transformation of rat liver epithelial cells with v-H-ras or v-raf causes expression of MDR-1, glutathione-S-transferase-P and increased resistance to cytotoxic chemicals. Carcinogenesis 1988, 9 (12), 2329–32. (6) Hennequin, E.; Delvincourt, C.; Pourny, C.; Jardillier, J. C. Expression of mdr1 gene in human breast primary tumors and metastases. Breast Cancer Res. Treat. 1993, 26 (3), 267–74. (7) Miyauchi, T.; Kanekura, T.; Yamaoka, A.; Ozawa, M.; Miyazawa, S.; Muramatsu, T. Basigin, a new, broadly distributed member of the immunoglobulin superfamily, has strong homology with both the immunoglobulin V domain and the beta-chain of major histocompatibility complex class II antigen. J. Biochem. 1990, 107 (2), 316–23. (8) Kanekura, T.; Miyauchi, T.; Tashiro, M.; Muramatsu, T. Basigin, a new member of the immunoglobulin superfamily: Genes in different mammalian species, glycosylation changes in the molecule from adult organs and possible variation in the N-terminal sequences. Cell Struct. Funct. 1991, 16 (1), 23–30. (9) Miyauchi, T.; Masuzawa, Y.; Muramatsu, T. The basigin group of the immunoglobulin superfamily: Complete conservation of a segment in and around transmembrane domains of human and mouse basigin and chicken HT7 antigen. J. Biochem. 1991, 110 (5), 770–4. (10) Kanekura, T; Chen, X; Kanzaki, T. Basigin (CD147) is expressed on melanoma cells and induces tumor cell invasion by stimulating production of matrix metalloproteinases by fibroblasts. Int. J. Cancer 2002, 99 (4), 520–8. (11) Chen, X.; Lin, J.; Kanekura, T.; Su, J.; Lin, W.; Xie, H. F.; Wu, Y. X.; Li, J.; Chen, M. L.; Chang, J. A small interfering CD147-targeting RNA inhibited the proliferation, invasiveness, and metastatic activity of malignant melanoma. Cancer Res. 2006, 66 (23), 11323– 30. (12) Kirk, P.; Wilson, M. C.; Heddle, C.; Brown, M. H.; Barclay, A. N.; Halestrap, A. P. CD147 is tightly associated with lactate transporters MCT1 and MCT4 and facilitates their cell surface expression. EMBO J. 2000, 19 (15), 3896–904. (13) Yurchenko, V.; Zybarth, G.; O’Connor, M.; Dai, W. W.; Franchin, G.; Hao, T.; Guo, H.; Hung, H. C.; Toole, B.; Gallay, P.; Sherry, B.; Bukrinsky, M. V.; Zybarth, G.; O’Connor, M. Active site residues of cyclophilin A are crucial for its signaling activity via CD147. J. Biol. Chem. 2002, 277 (25), 22959–65. (14) Yang, J. M.; Xu, Z.; Wu, H.; Zhu, H.; Wu, X.; Hait, W. N. Overexpression of extracellular matrix metalloproteinase inducer in multidrug resistant cancer cells. Mol. Cancer Res. 2003, 1 (6), 420–7. (15) Misra, S.; Ghatak, S.; Zoltan-Jones, A.; Toole, B. P. Regulation of multidrug resistance in cancer cells by hyaluronan. J. Biol. Chem. 2003, 278 (28), 25285–8. (16) Marieb, E. A.; Zoltan-Jones, A.; Li, R.; Misra, S.; Ghatak, S.; Cao, J.; Zucker, S.; Toole, B. P. Emmprin promotes anchorage-independent growth in human mammary carcinoma cells by stimulating hyaluronan production. Cancer Res. 2004, 64 (4), 1229–32.
research articles
(17) Yang, Y. X.; Xiao, Z. Q.; Chen, Z. C.; Zhang, G. Y.; Yi, H.; Zhang, P. F.; li, J. N.; Zhu, G. Proteome analysis of multidrug resistance in vincristine-resistant human gastric cancer cell line SGC7901/ VCR. Proteomics 2006, 6 (6), 2009–21. (18) Chen, X.; Su, J.; Chang, J.; Kanekura, T.; Li, J.; Kuang, Y. H.; Peng, S.; Yang, F.; Lu, H.; Zhang, J. L. A small interfering CD147-targeting RNA inhibits the proliferation, activation, adhesion and migration of Jurkat cells. Cancer Invest. 2008, 26 (7), 689–697. (19) Brummelkamp, T. R.; Bernards, R.; Agami, R. A system for stable expression of short interfering RNAs in mammalian cells. Science 2002, 296 (5567), 550–3. (20) Holen, T.; Amarzguioui, M.; Wiiger, M. T.; Babaie, E.; Prydz, H. Positional effects of short interfering RNAs targeting the human coagulation trigger tissue factor. Nucleic Acids Res. 2002, 30 (8), 1757–66. (21) Zou, W.; Yang, H.; Hou, X.; Zhang, W.; Chen, B.; Xin, X. Inhibition of CD147 gene expression via RNA interference reduces tumor cell invasion, tumorigenicity and increases chemosensitivity to paclitaxel in HO-8910 pm cells. Cancer Lett. 2007, 248 (2), 211–8. (22) Verrills, N. M.; Kavallaris, M. Drug resistance mechanisms in cancer cells: A proteomics perspective. Curr. Opin. Mol. Ther. 2003, 5 (3), 258–65. (23) Gehrmann, M. L.; Fenselau, C.; Hathout, Y. Highly altered protein expression profile in the adriamycin resistant MCF-7 cell line. J. Proteome Res. 2004, 3 (3), 403–9. (24) Wadhwa; Taira, K.; Kaul, S. C. Mortalin: A potential candidate for biotechnology and biomedicine. Histol. Histopathol. 2002, 17 (4), 1173–7. (25) Galat, A. Peptidylproline cis-trans-isomerases: Immunophilins. Eur. J. Biochem. 1993, 216 (3), 689–707. (26) Handschumacher, R. E.; Harding, M.; Rice, J.; Drugge, R. J.; Speicher, D. W. Cyclophilin: A specific cytosolic binding protein for cyclosporin A. Science 1984, 226 (4674), 544–7. (27) Li, M.; Wang, H.; Li, F.; Fisher, W. E.; Chen, C.; Yao, Q. Effect of cyclophilin A on gene expression in human pancreatic cancer cells. Am. J. Surg. 2005, 190 (5), 739–45. (28) Campa, M. J.; Wang, M. Z.; Howard, B.; Fitzgerald, M. C.; Patz, E. F., Jr. Protein expression profiling identifies macrophage migration inhibitory factor and cyclophilin A as potential molecular targets in non-small cell lung cancer. Cancer Res. 2003, 63 (7), 1652–6. (29) Yurchenko; Zybarth, V. G.; O’Connor, M.; Dai, W. W.; Franchin, G.; Hao, T.; Guo, H.; Hung, H. C.; Toole, B.; Gallay, P; Sherry, B.; Bukrinsky, M. Active-site residues of cyclophilin A are crucial for its signaling activity via CD147. J. Biol. Chem. 2002, 277 (25), 22959–65. (30) Chen, S.; Zhang, M.; Ma, H.; Saiyin, H.; Shen, S.; Xi, J.; Wan, B.; Yu, L. Oligo-microarray analysis reveals the role of cyclophilin A in drug resistance. Cancer Chemother. Pharmacol. 2008, 61 (3), 459–69. (31) Gonza´lez-Santiago, L.; Alfonso, P.; Sua´rez, Y.; Nu ´n ˜ ez, A.; Garcı´aFerna´ndez, L. F.; Alvarez, E.; Mun ˜ oz, A.; Casal, J. I. Proteomic analysis of the resistance to aplidin in human cancer cells. J. Proteome Res. 2007, 6 (4), 1286–94. (32) Yang, Y.; Zhu, P. CD147 Facilitates Cyclophilin A-induced MMP-9 expression on monocytes/macrophages in rheumatoid arthritis. J US-China Med. Sci. 2007, 4 (3), 55–62. (33) Aouali, N.; Eddabra, L.; Macadre´, J.; Morjani, H. Immunosuppressors and reversion of multidrug-resistance. Crit. Rev. Oncol. Hematol. 2005, 56 (1), 61–70. (34) Chen, J. Y.; Yan, Z.; Shen, C.; Fitzpatrick, D. P.; Wang, M. A systems biology approach to the study of cisplatin drug resistance in ovarian cancers. J. Bioinf. Comput. Biol. 2007, 5 (2a), 383–405. (35) Liu, F. T.; Rabinovich, G. A. Galectins as modulators of tumour progression. Nat. Rev. Cancer 2005, 5 (1), 29–41. (36) Chiang, W. F.; Liu, S. Y.; Fang, L. Y.; Lin, C. N.; Wu, M. H.; Chen, Y. C.; Chen, Y. L.; Jin, Y. T. Overexpression of galectin-1 at the tumor invasion front is associated with poor prognosis in earlystage oral squamous cell carcinoma. Oral Oncol. 2008, 44 (4), 325– 34. (37) Reichelt, J.; Breiden, B.; Sandhoff, K.; Magin, T. M. Loss of keratin 10 is accompanied by increased sebocyte proliferation and differentiation. Eur. J. Cell Biol. 2004, 83 (11-12), 747–59. (38) Chen, X.; Kanekura, T.; Kanzaki, T. Expression of basigin in human fetal, infantile and adult skin and in basal cell carcinoma. J. Cutaneous Pathol. 2001, 28 (4), 184–90.
PR800355B
Journal of Proteome Research • Vol. 7, No. 11, 2008 4791
