Proteome Analysis of Responses to Ascochlorin in a Human Osteosarcoma Cell Line by 2-D Gel Electrophoresis and MALDI-TOF MS Jeong Han Kang,† Kwan-Kyu Park,† In-Seon Lee,# Junji Magae,‡ Kunio Ando,⊥ Cheorl-Ho Kim,§ and Young-Chae Chang*,† Department of Pathology, Catholic University of Daegu School of Medicine, Daegu 705-034, Korea, The Center for Traditional Microorganism Resources (TMR), Keimyung University, Daegu 704-701, Korea, Department of Biotechnology, Institute of Research and Innovation, Kashiwa 277-0861, Japan, NRL Pharma Inc., Kwasaki 213-0012, Japan, and Department of Biological Science, Sungkyunkwan University, Kyunggi-Do 440-746, Korea Received March 23, 2006
Ascochlorin is a prenyl-phenol compound that was isolated from the fungus Ascochyta viciae. Ascochlorin reduces serum cholesterol and triglyceride levels, suppresses hypertension and tumor development, and ameliorates type I and II diabetes. Here, to better understand the mechanisms by which ascochlorin regulates physiological or pathological events and induces responses in the pharmacological treatment of cancer, we performed differential analysis of the proteome of the human osteosarcoma cells U2OS in response to ascochlorin. In addition, we established the first twodimensional map of the U2OS proteome. The U2OS cell proteomes with and without treatment with ascochlorin were compared using two-dimensional electrophoresis, matrix-assisted laser desorption/ ionization mass spectrometry and bioinformatics. The largest differences in expression were observed for the epidermal growth factor receptor (4-fold decrease), ribulose-5-phosphate-epimerase (13-fold decrease), ATP-dependent RNA helicase (8-fold decrease), and kelch-like ECH-associated protein 1 (6fold decrease). The abundance of heterogeneous nuclear ribonucleoprotein L and minichromosome maintenance protein 7 increased 12- and 8.2-fold, respectively. In addition, Erk 2 was increased 3-fold in U2OS cells treated with ascochlorin. The expression of some selected proteins was confirmed by western blotting, zymography and RT-PCR analysis. Keywords: ascochlorin • human osteosarcoma cells • 2-D gel • MALDI-TOF-MS
Introduction Ascochlorin (ASC; see Figure 1A), a prenyl phenol compound isolated from the fungus Ascochyta viciae was originally found to have antiviral antibiotic activity.1 In addition to its antiviral and antifungal activity, natural and synthetic derivatives of ASC reduce serum cholesterol and triglyceride levels, suppress hypertension and tumor development, and ameliorate type I and II diabetes.2-6 Moreover, several ASC derivatives have been reported to be potent agonists of nuclear hormone receptors, including peroxisome proliferator-activated receptor-γ, suggesting that the structure of ascochlorin would be useful in * To whom correspondence should be addressed. Department of Pathology, Catholic University of Daegu School of Medicine, 3056-6, Daemyung4-Dong, Nam-gu, Daegu, 705-034, Korea. Phone: 82-53-650-4848. Fax: 8253-650-4834. E-mail:
[email protected]. † Department of Pathology, Catholic University of Daegu School of Medicine. ‡ Department of Biotechnology, Institute of Research and Innovation. § Department of Biological Science, Sungkyunkwan University. # The Center for Traditional Microorganism Resources (TMR), Keimyung University. ⊥ NRL Pharma Inc.
2620
Journal of Proteome Research 2006, 5, 2620-2631
Published on Web 08/31/2006
designing modulators of nuclear receptors.7-9 ASC and one of its derivatives inhibit oxidative phosphorylation by inhibiting ubiquinone-dependent electron transport in isolated mitochondria, which has been suggested as the mechanism of the antiviral activity of ASC.10,11 These molecules also modulate the activity of nuclear hormone receptors, and ascochlorin activates the transcription of the human estrogen receptor,9,12 suggesting that mechanisms other than those involving the respiratory chain contribute to their physiological activities. ASC-related compounds show profound antitumor activity against a variety of transplantable tumors, and suppress the metastasis of melanomas and lung carcinomas in murine experimental models.6 Osteosarcoma is the most common primary malignant tumor of bone in children and adolescents. Osteosarcomas account for approximately 5% of the tumors in childhood and 80% of these tumors originate around the knee.13 The first choice of treatment for osteosarcoma is neoadjuvant chemotherapy, and multiple anticancer drugs such as methotrexate, doxorubicin, cisplatin, etoposide, and cyclophosphamide are commonly used, either alone or in combination.14 Although 10.1021/pr060111i CCC: $33.50
2006 American Chemical Society
research articles
Responses to Ascochlorin in a Human Osteosarcoma Cell Line
gels made using U2OS cells treated with ASC. The association of two-dimensional electrophoresis with MALDI-TOF mass spectrometry and database interrogations allowed us to identify 115 proteins differentially expressed in U2OS cells following ASC treatment. In particular, we identified various proteins implicated in the regulation of apoptosis, protein synthesis, metabolic activity, growth and cell mobility.
Materials and Methods
Figure 1. Chemical structure of ASC and the effects of ASC on the viability of U2OS cells. A: chemical structure and molecular weight of ASC. B: effects of ASC on cell viability. U2OS cells were treated with ASC in the presence (open circle) or absence of serum (closed circle), and cell viability was tested by MTT assay after 24 h.
adjuvant chemotherapy is effective in improving patient survival and the treatment of the primary tumor,15 some groups of patients who present with metastatic disease and patients with tumors that recur after treatment continue to have a poor prognosis. In addition, the frequent acquisition of drugresistant phenotypes and the occurrence of “second malignancy” are often associated with chemotherapy, and remain as serious problems. Therefore, there is a clear need for newer effective agents for patients with osteosarcoma, especially for patients who present with metastatic disease or who develop disease recurrence. Two-dimensional electrophoresis (2-DE) is a commonly used high-resolution technique for arraying proteins by isoelectric point and molecular mass. When immobilized pH gradients (IPGs) are used for isoelectric focusing in the first dimension, excellent reproducibility and high protein load capacity can be achieved.16 Using Coomassie blue staining, protein spots on the gel can be visualized and differences in protein levels determined using appropriate 2-D analysis software. Digested proteins of interest can then be identified by matrix-assisted laser desorption/ionization-time-of-flight (MALDI-TOF) mass spectrometry. This combination of techniques makes it possible to study the profile of changes in protein levels. Studies can be facilitated by comparing the gels obtained, with 2-DE reference gels representing the typical pattern of the cells studied under normal conditions. To the best of our knowledge, a detailed 2-DE reference map for U2OS cells is not currently available to the scientific community. This is why we started with the U2OS cells reference map and then compared it with
Cell Culture and Biological Reagents. U2OS osteosarcoma cells were obtained from the American Type Culture Collection (Manassas, VA). Cells were cultured in Dulbecco’s modified Eagle’s medium (Invitrogen, Gland island, USA) containing 10% fetal bovine serum, 20 mM HEPES buffer, and 100 µg/mL gentamicin. The cells were maintained at 37 °C. ASC produced by A. viciae was purified as described previously.1 Cytotoxicity Assays. Reduction of 3-[4,5-dimethylthiazol-2yl]-2,5-diphenyltetrazolium bromide (MTT; Roche Applied Science) assays was performed as described in the manufacturer’s protocol to evaluate the cytotoxicity of ASC. Protein Extraction. U2OS cells were washed three times with ice-cold PBS. Cells were lysed with a buffer containing 5 mM EDTA, 9.5 M urea, 4% (v/v) CHAPS, 65 mM DTT, and protease inhibitors (Complete kit, Roche Diagnostics, Germany) over 1 h at 24 °C. Cellular debris was removed by centrifugation for 15 min at 20 000 × g at 4 °C. Protein samples were stored at -70 °C. Protein concentrations were quantified using the Amersham Biosciences PlusOne 2-D Quant Kit (Uppsala, Sweden). In some cases, U2OS cells were treated with ASC for 12 h. Two-Dimensional Gel Electrophoresis. Protein samples were mixed with loading buffer for the IPG strips. The mixture was applied to dry 170 mm immobilized pH 3-10 linear gradient strips (ReadyStrip IPG strip, Bio-Rad) in a PROTEAN IEF cell (Bio-Rad). Complete sample uptake into the strips was achieved after 12 h at 20 °C. Focusing was performed at 250 V for 30 min, at 10 000 V for 3 h, and at 10 000 V for 65 000 Vhours. Current was limited to 50 µA per strip, and temperature maintained at 20 °C for all IEF steps. For SDS-PAGE, the IPG strips were incubated in equilibration buffer containing 37.5 mM Tris-HCl (pH 8.8), 6 M urea, 2% (w/vol) SDS, 30% (vol/ vol) glycerol, and 2% (w/vol) DTT for 15 min, and then incubated for 15 min in equilibration buffer supplemented with 2.5% (w/vol) iodoacetamide. The equilibrated IPG strips were transferred for the second dimension SDS-PAGE onto 12% Duracryl gels (180 × 160 × 1.5 mm). Electrophoresis was carried out using a SE600 system (Amersham Pharmacia), with 25 mM Tris, 192 mM glycine and 0.1% w/vol SDS as the running buffer, at 20 °C at 120 V per gel for 8 h, or until the bromophenol blue had reached the bottom of the gel. Data shown are means of three independent experiments. For the differential analysis, statistical significance was estimated with Student’s t-test. Values of p < 0.05 were considered significant. Staining of 2-DE Gels. Coomassie blue staining was performed according to Neuhoff et al.17 Gels were fixed overnight in 50% vol/vol ethanol containing 2% w/vol phosphoric acid. Gels were then incubated for 1 h in 34% vol/vol ethanol containing 17% ammonium sulfate, 2% w/vol phosphoric acid and 1 g of Coomassie blue G-250, and then stained in this solution for 1 day. 2-D Image Analysis. The staining patterns on the 2D gels were digitalized at 300 dpi resolutions using a UMAX PowerLook 1120 (UMAX Technologies, Inc., Dallas, USA) scanner. A Journal of Proteome Research • Vol. 5, No. 10, 2006 2621
research articles
Kang et al.
Table 1. Conditions for PCR Amplification of the Genes Studied gene
prohibitin phosphoglycerate mutase EGFR erk 2
primer sequence (5′ to 3′)
forward: actctgccttatataatgtg reverse: gagttggcaatcagctcagc forward: actatgggggtctaaccggt reverse: aactgcatgggcttgataggc forward: cccactcatgctctacaacc reverse: gccgcgtatgatttctaggt forward: cattcagctaacgttctg reverse: cttgtgtgggttgaatgtca
calibration filter using different shades of gray was applied to transform pixel intensities into optical density units. The scans were exported in TIFF format and imported into PDQUEST (Bio-Rad) image analysis software for analysis. Briefly, after automatic spot detection, the background was removed from each gel and the images were edited manually, i.e., adding, splitting, and removing spots. One gel was chosen as the master gel and used for the automatic matching of spots in the other 2-DE gels. In-Gel Trypsin Digestion. To identify the protein spots, preparative 2-DE gels were excised, cut into 1-2 mm2 pieces and destained at room temperature in 50 mM NH4HCO3 buffer, pH 8.8, containing 50% acetonitrile (ACN) for 1 to 2 h. After washing with 50 µL ACN, the gel pieces were dehydrated and dried thoroughly in a vacuum centrifuge (Concentrator 5301, Eppendorf, Hamburg, Germany) for a few minutes. The dried gel pieces were rehydrated with 20 µL of 50 mM NH4HCO3, pH 8, containing 20 µg/mL trypsin (Promega, Madison, WI), and protein digestion proceeded at 37 °C overnight. The samples were then dried in a vacuum centrifuge, and resuspended in 3 µL of 0.1% TFA before MALDI MS analysis. MALDI-TOF-MS and Database Search. For acquisition of the mass spectrometric peptide maps of the proteins, 1 µL of the generated cleavage products was mixed with 1 µL of matrix solution (10 mg/mL R-cyano-4-hydroxycinnamic acid in 50% ACN/0.1% TFA) and the mixed solution was spotted onto a 96spot MALDI target. The mixture was air-dried at room temperature before the acquisition of the mass spectra. MALDITOF-MS analyses were performed on a Voyager DE-STR MALDI-TOF mass spectrometer (Applied Biosystems, Foster City, CA). The MALDI-TOF mass spectrometer was operated in positive-ion, delayed-extraction (200 ns delay time) reflector mode. Results were analyzed with Data Explorer software (Applied Biosystems) to obtain accurate masses for all the peptides in the tryptic digest. The resulting peptide mass fingerprints, together with the pI and MW values (estimated from the 2-DE gels), were used to search the Swiss-Prot or NCBInr protein databases with a special search tool [MS-FIT from Protein Prospector V 4.0.4 (http://prospector.ucsf.edu)], which compares the experimentally determined tryptic peptide masses with theoretical peptide masses calculated for proteins contained in the Swiss-Prot or NCBInr protein databases. Search parameters were (50-100 ppm peptide mass tolerance and one maximum missed cleavage. Western Blot Analysis. Total protein extracts were prepared as previously described.18 Protein concentrations were quantified with the micro-BCA Protein Assay Reagent kit (Pierce, Rockford). Caspase-3 expression was assessed by western blot analysis. Briefly, 20-50 µg of protein extracts were run on 10% SDS-PAGE gels, transferred, and incubated with an anticaspase-3-specific polyclonal antibody (Calbiochem; 1:1000), 2622
Journal of Proteome Research • Vol. 5, No. 10, 2006
no. of cycles
annealing temp
linear cycle range
22
55 °C
18-25
23
67 °C
18-23
25
60 °C
18-27
23
65 °C
18-27
followed by a human anti-rabbit-specific antibody (1:10000) (Amersham Pharmacia) and developed using enhanced chemiluminescent detection methods (ECL Kit, Amersham Pharmacia Biotech, UK). Analysis of annexin I was performed with an antiannexin I polyclonal antibody (1/1000) (Santa Cruz). Matrix metalloproteinase-2 (MMP-2) protein detection was performed with an anti-MMP-2 polyclonal antibody (1/1000) (Santa Cruz). Erk 2 protein detection was performed with an anti-Erk 2 polyclonal antibody (1/1000) (Santa Cruz). In addition, analysis of epidermal growth-factor receptor (EGFR) was performed with an anti-EGFR monoclonal antibody (1/500) (Cell Signaling). Gelatin Substrate Gel Zymography. The matrix-degrading activity of MMP-2 was assayed by zymography, which was performed using a previously described procedure with minor modifications.19 U2OS cells were suspended in medium containing 10% fetal bovine serum and plated at 3 × 105 cells/35 mm dish. The dishes were incubated until the cultures were 80% confluent; then, the medium was changed to fresh serumfree medium with or without ASC compounds. Supernatants were collected after incubation for 12 h. The medium was subjected to SDS-PAGE in 10% polyacrylamide gels that had been copolymerized with 1 mg/mL gelatin. After electrophoresis, the gels were washed several times in 2.5% Triton X-100 for 1 h at room temperature, then incubated for 24 h at 37 °C in buffer containing 5 mM CaCl2 and 1 µM ZnCl2. Gels were stained with Coomassie brilliant Blue R-250 (Bio-Rad) for 1 h and destained. Proteolytic activity was evidenced as clear bands against the blue background of the stained gelatin Reverse Transcription-Polymerase Chain Reaction. After treatment of cells with ASC, total RNA was isolated from treated and untreated cells using TRIzol reagent (Sigma), according to the manufacturer’s instructions. RNA yield and purity were assessed by spectrophotometric analysis. Total RNA (10 µg) from each sample was subjected to reverse transcription with random hexamers, dNTPs, and M-MLV reverse transcriptase (Promega) in a 20 µL total reaction volume. PCR of cDNA was performed using specific primers for the protein of interest. The gene-specific primers and PCR conditions for each gene are listed in Table 1. PCR products were resolved electrophoretically on 1.0% agarose gels, and DNA bands were visualized by staining the gel with ethidium bromide. The expression of the measured genes in each sample was normalized to β-actin expression. All samples were analyzed in triplicate. Immunofluorescent Confocal Microscopy. Cells were cultured and treated on poly-L-lysine-coated coverslips before being fixed in 4% paraformaldehyde (10 min at room temperature). After a 5 min wash with 2 mg/mL glycine in PBS, cells were permeabilized with 0.2% Triton X-100 in PBS for 5 min. After two washes with PBS, the cells were blocked with 10%
Responses to Ascochlorin in a Human Osteosarcoma Cell Line
normal goat serum in PBS for 1 h in a humidified chamber. Then, the cells were incubated with primary antibodies (1:100, diluted in PBS containing 2% normal goat serum) overnight at 4 °C with gentle shaking. The cells were then washed three times before being incubated with TRITC-conjugated secondary antibody for 60 min and with DAPI for 3 min at room temperature. Finally, the cells were washed five times with PBS containing 0.05% Tween 20 and 1% BSA; coverslips were mounted with 90% glycerol and sealed with nail polish. Slides were examined and scanned on a confocal laser microscope. For selected images, both the fluorescent and the DIC images were collected and merged electronically.
Results and Discussion Effect of ASC on the Viability of U2OS Cells. The structure of the ASC used in this study is shown in Figure 1A. Because it is known to have antibiotic activity, we first tested the cytotoxic effects of ASC on U2OS cells in serum-free and 10% serumcontaining medium using an MTT assay. Treatment of cells with ASC ranging from 1 to 100 µM showed a 10-20% decrease in cell viability in serum-free medium (Figure 1B). 2-DE Pattern of U2OS Cells. We used 2-D electrophoresis in conjunction with quantitative image analysis and sequencing mass spectrometry to investigate changes in the protein expression profiles of U2OS cells. A 2-DE protein map of this cell type was constructed as a prerequisite for subsequent comparative proteomic studies of ASC-treated cells. Three gels per sample were processed simultaneously and analyzed with PDQUEST 2-D software. Figure 2 shows the 2-D patterns for U2OS cells cultured in the absence and presence of ASC. More than 2500 spots were detected. Of those proteins with molecular masses ranging from 17 kDa to 130 kDa, 60% had acidic pIs, whereas 40% of polypeptide spots fell within the alkaline region. There were few protein spots over 130 kDa, and a few spots were detected with a pI > 9.5. Identification of Differentially Expressed Proteins by MS. Protein spots from the 2-D gel were subjected to trypsin digestion and MALDI-TOF analysis. At least 250 spots were differentially expressed, and the proteins corresponding to 117 were successfully identified. Table 2 lists the most strongly differentially expressed proteins, which were up- or downregulated more than 2-fold by ASC treatment. More than 95% of spots had a sequence coverage exceeding 10%. Identification was validated by agreement between the apparent Mr and pI determined from 2-D gels and the theoretical values of the identified proteins (∆Mr < 20% or ∆pI < 0.5). Function Groups Identified. The differentially expressed proteins were classified in terms of their physiological functions using information from PubMed (http://www.ncbi.nlm.nih.gov/PubMed) and the Swiss-Prot/TrEMBL protein knowledgebase (http://au.expasy.org/sport). As shown in Figure 3, a large number of the proteins identified were metabolic proteins, and other groups were involved in signal transduction. Many other unidentified proteins were also present. Metabolic Proteins. Various proteins involved in the regulation of several metabolic pathways were identified. A large group of the proteins identified were metabolic proteins (24%). The typical metabolic capabilities of U2OS cells were illustrated by the identification of several metabolic enzymes, i.e., glutathione-S-transferase, inorganic pyrophosphatase, phosphoglycerate mutase 1, aldehyde reductase, aspartate aminotransferase, and aldose reductase.
research articles Several proteins involved in the glycolytic pathway also appear to be regulated by ASC; some are downregulated (inorganic pyrophosphatase, aspartate aminotransferase), and others are upregulated (phosphoglucomutase-like protein 5, fructose-bisphosphate aldolase A, phosphoglycerate mutase 1). The protein phosphoglycerate mutase 1 has conserved nucleophilic serine and metal-binding residues; however, the substrate-binding residues are not conserved.20 This protein has been reported at a high level in dermal fibroblast cells from healthy human subjects.21 Phosphoglycerate mutase 1 catalyzes the isomerization of 2- and 3-phosphoglycerates and is thus essential for glucose metabolism in most organisms.22 Monoubiquitination of phosphoglycerate mutase 1, as well as the formation of a noncovalent complex containing ubiquitin and phosphoglycerate mutase 1 are increased in colorectal cancer, which may suggest a potential pathophysiological event.23 A decreased level of phosphoglycerate mutase isoenzymes was reported in breast carcinoma, indicating its differential expression.24 Proteomic approaches to the investigations related to these modifications by ASC will reveal their clinical importance and unique functional mechanisms. In this study, this enzyme was upregulated 2-fold in U2OS cells treated with ASC. Inorganic pyrophosphatase (PPase) catalyzes the hydrolysis of inorganic pyrophosphate (PPi) into two orthophosphates (Pi).10,25,26 In living cells, PPase actively controls the level of intracellular or extracellular PPi, which is continuously produced because of ATP use in the biosynthesis of proteins, RNA, and DNA. Thus, PPase is considered to be essential for life, being involved intimately in cell survival, growth, and differentiation.25-27 Whereas PPases cloned from prokaryotes, yeasts, and mammalian tissues have been widely investigated,28 human PPase is poorly understood. Only one study, by Todd et al., has demonstrated the expression of PPase mRNA in normal organs-human heartssuggesting its housekeeping function.25 PPase expressed was increased in U2OS cells stimulated with ASC. Aldehyde reductase is an oxidoreductase that catalyzes the NADPH-dependent reduction of a variety of aromatic and aliphatic aldehydes.29 This enzyme is important because of its ability to detoxify a variety of reductive aldehyde species and metabolize certain steroid and neurotransmitter metabolites and glucuronate;30 however, little is known of its physiological role. The protein expression profiles of G250-treated and -untreated RCC cell lines were investigated to identify tumor markers that may allow the selection of patients prior to specific immunotherapy. Seliger et al. found decreased expression of aldehyde reductase in G250-treated RCC cells.31 Our results show that its expression is decreased about 2-fold by ASC. Cell Growth and Maintenance. Of the proteins identified, 17% are involved in cell growth and maintenance, including tropomodulin 3, amphiphysin II, tropomyosins, cofilin-1, and lamin A/C, which typically constitute the framework of the cytoskeletal machinery. Actin-related proteins are particularly important in regulating actin filament length and concentration in this cell type. We identified various actin-related proteins that regulate actindriven assembly, such as tropomodulin, tropomyosin 1 and tropomyosin 2. Some of these actin-binding proteins are essential for the reorganization of actin filaments as a cellular response to various growth factors, chemoattractants, and tumor target binding, and could play crucial roles in human disorders. Currently, tropomodulin (Tmod) is the only protein known whose sole function is to cap pointed ends of actin Journal of Proteome Research • Vol. 5, No. 10, 2006 2623
research articles
Kang et al.
Figure 2. Protein expression maps of U2OS cells. U2OS cells were incubated for 12 h with ASC (10 µM). A: proteins from whole U2OS cells were separated on a pH 3-10 IPG strip in the first dimension and on an SDS-PAGE (12%) gel in the second dimension. The bottom left sections show a representative Coomassie-stained gel of proteins derived from U2OS control cells. Around the typical control gel, enlarged areas of gels derived from control cells and cells exposed to ASC are shown. B: proteins were separated on a pH 4-7 IPG strip followed by SDS-PAGE (12%). Protein spots significantly affected by ASC treatment are marked by arrows. The numbers indicated on the gels correspond to the gel numbers given in Table 2. 2624
Journal of Proteome Research • Vol. 5, No. 10, 2006
research articles
Responses to Ascochlorin in a Human Osteosarcoma Cell Line Table 2. Differentially Expressed Proteins in Ascochlorin-Treated U2OS Cells spot no.
protein
1 Epidermal growth factor receptor 2 Ubiquitin thiolesterase 24 3 Villin 1 4 Fragile X mental retardation 1 protein 5 Kelch-like ECH-associated protein 1 6 Dihydroxyacetone phosphate acyltransferase 7 Heat shock 70 kDa protein 4 8 Ubiquitin thiolesterase 11 9 Nucleoporin Nup107 10 MMP-2 11 SH3-binding protein CBL-B 12 LIM domains containing protein 1 13 Protein-glutamine gammaglutamyltransferase 6 14 Hepatocellular carcinomaassociated antigen 66 15 NY-REN-43 antigen 16 CDC47 (MCM7) 17 Phosphoglucomutase-like protein 5 18 Heterogeneous nuclear ribonucleoprotein L 19 G protein-coupled receptor kinase 7 20 DNA-repair protein XRCC1 21 Glutamate receptor 2 22 Tyr-DNA phosphodiesterase 1 23 Fructose-bisphosphate aldolase A 24 Heterogeneous nuclear ribonucleoprotein H 25 Rab GDP dissociation inhibitor beta 26 Septin-5 27 Flotillin-1 28 Pre-B-cell leukemia transcription factor-2 29 Enolase 3 30 TCP-1-theta 31 Transcription factor E4TF1-60 32 Vimentin 33 Tropomodulin 3
34 Phosducin-like protein 35 gamma-soluble NSF attachment protein 36 Aldehyde reductase 37 X-linked protein STS1769 38 Heterogeneous nuclear ribonucleoproteins C1/C2 39 Tropomyosin 1 alpha chain 40 Leucine-rich B7 protein 41 IFIT-2 (interferon-induced 54 kDa protein 42 Erk 2 43 Annexin A3 44 Tropomyosin beta chain 45 Prohibitin
sequence MW accession coverage pI (kDa) no. (%)
fold tchange
6.3 134 P00533
14
-4 ( 0.2
6.2 112 Q9UPU5 6.0 92 P09327 7.0 71 Q06787
15 17 14
-2 ( 0.3 5 ( 0.5 -3 ( 0.4
cytoplasmic
6.1
69 Q14145
19
-6 ( 0.2
catalytic activity
peroxisomal
6.2
77 O15228
10
4 ( 0.6
chaperone catalytic activity nucleocytoplasmic transporter activity catalytic activity signal transduction signal transduction
cytoplasmic nuclear cytoplasmic and nuclear
5.2 94 P34932 5.2 105 P51784 5.3 106 P57740
10 14 11
-6 ( 0.7 -3.5 ( 0.2 -2 ( 0.2
nuclear
5.3 73 P08253 8.1 109 Q13191 6.2 72 Q9UGP4
18 10 11
-2 ( 0.1 3.8 ( 0.4 2 ( 0.2
7.3
80 O95932
14
-2 ( 0.1
7.2
70 Q9NYH9
14
2 ( 0.3
7.2
68 Q9NVW2
19
2.2 ( 0.2
6.1
81 P33993
15
8.2 ( 0.6
6.8
55 Q15124
15
2 ( 0.4
function
localization
the control of cell growth and membrane differentiation Ubiquitin-dependent proteolysis protein complex assembly cytoplasmic RNA-binding protein cytoplasmic and nuclear
catalytic activity nuclear negative regulation of transcription DNA replication and cell proliferation structural molecule activity
nuclear
RNA binding
nuclear
6.7
60 P14866
12
12 ( 1
membrane
6.2
62 Q8WTQ7
15
2.1 ( 0.2
nuclear integral membrane nuclear
6.0 7.5 7.3
69 P18887 98 P42262 68 Q9NUW8
9 18 15
-2.2 ( 0.2 2 ( 0.3 -2.1 ( 0.3
8.3
39 P04075
19
2 ( 0.4
protein binding signal transduction DNA repair catalytic activity RNA binding
nuclear
5.9
49 P31943
16
2.1 ( 0.2
regulates the GDP/GTP exchange reaction protein binding protein binding transcription
cytoplasmic and membrane 6.1
50 P50395
17
2 ( 0.3
membrane nuclear
6.2 7.1 7.2
42 Q99719 47 O75955 45 P40425
16 17 17
-2.2 ( 0.2 4.2 ( 0.5 2 ( 0.3
catalytic activity molecular chaperone transcription
cytoplasmic cytoplasmic nuclear
7.6 5.4 4.9
46 P13929 59 P50990 51 Q06546
11 12 11
-2.3 ( 0.2 2 ( 0.4 -2.1 ( 0.2
structural constituent of cytoskeleton blocks the elongation and depolymerization of actin filaments signal transduction protein binding
cytoplasmic
5.1
53 P08670
17
-2 ( 0.2
5.1
39 Q9NYL9
21
-2.2 ( 0.3
cytoplasmic
4.7 5.3
34 Q13371 34 Q99747
28 13
-2 ( 0.4 2.3 ( 0.5
catalytic activity
cytoplasmic
6.3 4.7
36 P14550 39 Q99871
18 16
-2.1 ( 0.2 -5.5 ( 0.7
ribonucleosome assembly
nuclear
5.0
33 P07910
18
-2 ( 0.3
binding to actin filaments
cytoplasmic
4.7 4.5 6.3
32 P09493 39 Q8N6K6 54 P09913
23 12 15
2 ( 0.2 2 ( 0.1 2.2 ( 0.4
6.5 5.6 4.7 5.6
41 36 32 29
15 15 24 34
4 ( 0.5 -2 ( 0.2 -2.6 ( 0.4 -2.3 ( 0.4
induction of apoptosis inhibitor of phospholipase A2 binding to actin filaments regulating proliferation
cytoplasmic mitochondrial inner membrane
P28482 P12429 P07951 P35232
Journal of Proteome Research • Vol. 5, No. 10, 2006 2625
research articles
Kang et al.
Table 2. (Continued) spot no.
46
protein
52
F-actin capping protein alpha-1 subunit Annexin A1 Glutathione S-transferase Mu 2 60S acidic ribosomal protein P0 Caspase-3 precursor Cytochrome c-type heme lyase Zeta-sarcoglycan
53
Spry-3
54 55 56 57 58
Inhibitor of growth protein 4 Hypothetical protein Inorganic pyrophosphatase Heat-shock 27 kDa protein Proteasome subunit beta type 3 Peroxiredoxin 2 ATP synthase D chain, mitochondrial Glutathione S-transferase A5-5 Cofilin-1
47 48 49 50 51
59 60 61 62
63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82
83 84 85 86 87 88 89 90 2626
Thyroid receptor interacting protein 3 Heat-shock protein beta-7 Nucleoside diphosphate kinase A MHC class I antigen Ribulose-5-phosphateepimerase p53 and DNA damageregulated protein Heat-shock protein beta-8 WDR43 protein Eukaryotic translation initiation factor 4E Visinin-like protein 3 Aspartate aminotransferase Aldose reductase 40S ribosomal protein SA Fibulin-5 precursor Eukaryotic translation initiation factor 5A Melanoma-associated antigen G1 Retinoic acid- and interferon -inducible 58 kDa protein Phosphatidylinositol transfer protein alpha isoform Phosphoglycerate mutase 1 PPAR-beta
ATP-dependent RNA helicase DDX1 Extracellular matrix protein 1 precursor Aldehyde dehydrogenase X, mitochondrial precursor TCP-1-zeta Lamin A/C General transcription factor III cyclin H lysine carboxypeptidase
function
localization
cell mobility regulates phospholipase catalytic activity
cytoplasmic
ribosomal activity induction of apoptosis electron transport
cytoplasmic mitochondrial inner membrane membrane
maintenance of striated muscle membrane stability negatively modulates respiratory cytoplasmic organogenesis apoptosis nuclear catalytic activity stress resistance multicatalytic proteinase
pI
MW (kDa)
5.4
32
accession no.
sequence coverage (%)
fold tchange
P52907
24
-2 ( 0.2
38 P04083 6.0 P28161
40 15
2 ( 0.3 -2 ( 0.2
5.7
34
P05388
24
-2.1 ( 0.4
6.1 6.2
31 30
P42574 P53701
20 13
2 ( 0.2 2 ( 0.1
7.6
32
Q96LD1
22
2.2 ( 0.3
7.4
31
O43610
14
2 ( 0.2
7.5 6.1 5.5 6.0 6.1
28 28 32 22 22
Q9UNL4 31874085 Q15181 P04792 P49720
14 32 28 22 20
2.1 ( 0.5 2 ( 0.3 -2.1 ( 0.2 -2 ( 0.3 2 ( 0.2
5.7 5.2
21 18
P32119 O75947
20 50
-2 ( 0.1 -2 ( 0.4
6.6 25
redox regulation catalytic activity
cytoplasmic cytoplasmic cytoplasmic and nuclear cytoplasmic mitochondrial
catalytic activity
cytoplasmic
7.7
25
Q7RTV2
13
-2 ( 0.4
controls reversibly actin polymerization and depolymerization regulation of transcription
intranuclear and cytoplasmic
8.2
18
P23528
37
3.4 ( 0.6
5.5
17
Q15649
18
-2 ( 0.3
6.0 5.8
18 17
Q9UBY9 P15531
21 35
-2.1 ( 0.4 -2 ( 0.3
5.5 5.6
21 19
Q6Q3G4 Q96AT9
20 16
-2.4 ( 0.5 -13 ( 1
protein binding
5.8
15
Q9NUG6
13
-4 ( 0.5
Chaperone
5.0
21
Q9UJY1
21
-2 ( 0.3
4.0 6.0
15 25
Q8TB67 P06730
36 19
-2.2 ( 0.2 -2 ( 0.4
5.0
22
P37235
29
2 ( 0.2
6.5 6.5 4.8 4.6 5.1
46 35 32 50 16
P17174 P15121 P08865 Q9UBX5 Q7L7L3
15 15 19 15 51
-2.2 ( 0.5 2 ( 0.4 -2.3 ( 0.4 2 ( 0.3 -2 ( 0.1
9.3
34
Q96MG7
13
3.3 ( 0.5
7.0
55
Q13325
18
2 ( 0.2
cytoplasmic.
6.1
31
Q00169
18
-2.5 ( 0.5
nuclear
6.7 7.5
28 49
P18669 Q03181
31 16
2 ( 0.3 -2 ( 0.4
6.8
82
Q92499
12
-8 ( 1
response to unfolded protein nucleoside triphosphate biosynthesis MHC class I receptor activity catalytic activity
protein biosynthesis regulates the inhibition of rhodopsin phosphorylation catalytic activity catalytic activity cell adhesion cell-matrix adhesion protein biosynthesis growth suppressor
lipid metabolism catalytic activity binds peroxisome proliferators such as hypolipidemic drugs and fatty acids
nuclear and cytoplasmic
nuclear and cytoplasmic cytoplasmic cytoplasmic cytoplasmic. secreted nuclear and cytoplasmic cytoplasmic and nuclear
signal transduction
extracellular
6.2
60
Q16610
12
2.2 ( 0.5
catalytic activity
mitochondrial
6.4
57
P30837
14
2 ( 0.4
molecular chaperone muscle development regulation of transcription cell cycle control proteolysis
cytoplasmic nuclear nuclear nuclear extracellular
6.2 58 6.6 74 6.4 106 6.7 37 6.9 52
P40227 P02545 Q9UHL9 P51946 P15169
21 17 12 18 15
-8 ( 2 -2 ( 0.3 2 ( 0.1 3 ( 0.5 2 ( 0.2
Journal of Proteome Research • Vol. 5, No. 10, 2006
research articles
Responses to Ascochlorin in a Human Osteosarcoma Cell Line Table 2. (Continued) spot no.
protein
91 fructose-bisphosphate aldolase C 92 atlastin 93 acidic nucleoplasmic DNAbinding protein 1 94 glucose-regulated protein precursor 95 transmembrane protease 96 squamous cell carcinoma antigen 1 97 neurogenic differentiation factor 2 98 phenol-sulfating phenol sulfotransferase 1 99 spindlin-like protein 3 100 endoplasmic reticulum protein ERp29 precursor 101 PI3-kinase p85-beta subunit 102 Ubiquinol-cytochrome-c reductase complex core protein I 103 Ras-related protein Rab-3B 104 epsilon-coat protein 105 Tropomyosin 4 106 Disulfide isomerase ER-60 107 Matrilin-3 precursor 108 Breast carcinoma amplified sequence 1 109 Protein phosphatase 2C beta isoform 110 Mdm4 protein 111 Amphiphysin II 112 Isopentenyl pyrophosphate isomerase 2 113 Protein FAM49B 114 A-kinase anchor protein 5 115 Pyridoxal phosphate phosphatase 116 Potassium voltage-gated channel subfamily A member 1 117 Pulmonary surfactantassociated protein D precursor
function
localization
fructose metabolism immune response protein-protein interaction
nuclear
assembly of protein complexes
pI
MW accession (kDa) no.
sequence coverage (%)
6.4
39 P09972
11
2 ( 0.3
5.8 63 Q8WXF7 5.4 125 O75717
11 16
2 ( 0.1 -4 ( 0.6
5.1
72 P11021
30
2 ( 0.2
fold tchange
proteolysis protease inhibitor
membrane cytoplasmic
6.2 6.3
49 Q9H3S3 44 P29508
14 13
2 ( 0.4 2.1 ( 0.5
neuronal differentiation
nuclear
6.3
41 Q15784
14
2 ( 0.2
catalytic activity
cytoplasmic
6.2
34 P50225
43
-2 ( 0.5
cell cycle control protein folding
endoplasmic reticulum
6.5 6.8
29 Q99865 29 P30040
23 36
2 ( 0.4 2 ( 0.1
regulation of phosphorylation aerobic respiration
mitochondrial
6.1 5.9
81 O00459 52 P31930
12 22
2 ( 0.5 2 ( 0.3
protein transport intracellular protein transport actin binding signal transduction skeletal development
cytoplasmic membrane cytoskeleton endoplasmic reticulum secreted
4.8 5.0 4.7 6.0 6.3 5.0
24 34 28 56 52 61
P20337 O14579 P67936 P30101 O15232 O75363
18 21 35 23 10 14
2.2 ( 0.2 -14 ( 0.8 -2 ( 0.3 2 ( 0.2 2 ( 0.4 3 ( 0.5
4.9
52 O75688
18
-7 ( 0.7
apoptosis tumor suppressor catalytic activity
nuclear 4.9 nuclear and cytoplasmic 5.0 peroxisome 6.0
54 O15151 64 O00499 26 Q9BXS1
14 17 22
2.5 ( 0.4 10 ( 1 2 ( 0.3
signal transduction catalytic activity
plasma membrane cytoplasmic
5.8 4.8 6.1
36 Q9NUQ9 47 P24588 31 Q96GD0
27 13 15
8 ( 0.6 11 ( 1 -2 ( 0.2
membrane
5.1
56 Q09470
12
-3 ( 0.5
secreted
6.3
37 P35247
23
2 ( 0.1
amino acid dephosphorylation
regulation of phagocytosis
a The MS spectra of protein digests were compared with the NCBInr database using the MS-FIT database-searching program. Protein names and functions have been assigned according to PubMed and Swiss-Prot/TrEMBL. The table shows the differentially expressed proteins (ratio g 2) that were up- or downregulated (-) in response to ascochlorin treatment for 12 h. The fold change columns correspond to the expression of each protein relative to its expression in control cells. Results are means of three independent experiments performed for each condition. The spot numbers are identical to those given in Figure 2.
filaments.32,33 It was previously thought that Tmod was only involved in capping the pointed ends of filaments in stable, nondynamic cytoskeleton structures because it was originally found associated with actin filaments that were strictly regulated in length and persisted over many days (e.g., erythrocyte membrane skeletons and striated muscle sarcomere thin filaments; Fowler, 1996). Tmod expression was decreased about 2-fold by ASC. Vimentin, one of the cytoskeletal proteins, was significantly decreased in U2OS cells stimulated with ASC. Vimentin is often associated with cellular differentiation, invasion, migration and the metastatic potential of tumors.34 In addition, vimentin is a well-defined intermediated filament important for cell adhesion. Vimentin expression was significantly decreased by ASC treatment. EGFR is the prototypic member of the EGFR family of receptors, which also contains HER2/neu (ErbB2), HER3 (ErbB3), and HER4 (ErbB4).35,36 EGFR is involved in regulating signaling pathways implicated in the proliferation, invasion, migration, survival, adhesion, and differentiation of cancer
cells.37 EGFR is expressed at high levels in many human malignancies of epithelial origin, including lung, breast, head and neck, and bladder cancers.38,39 High expression levels of EGFR are associated with disease progression and poor prognosis in patients with various malignancies.40 The EGFR protein is therefore an attractive target for novel anticancer therapies.41 EGFR expression was significantly decreased by ASC treatment. Annexins are characterized as calcium-dependent phospholipid-binding proteins involved in various cellular functions such as adhesion, exocytosis, and interaction with cytoskeletal proteins; however, the detailed functions of annexins remain to be determined. Annexin I expression was elevated in U2OS cells treated with ASC. Annexin I is involved in exocytotic processes, as well as in the regulation of intracellular vesicular trafficking. Recent work has shown that annexins may play a pivotal role at sites of tissue damage in resolving inflammatory episodes and preventing autoimmune responses.42 Annexin I expression was increased in U2OS cells stimulated with ASC. Signaling Proteins. Of the proteins identified, 14% are involved in cell signal transduction, such as SH3-binding Journal of Proteome Research • Vol. 5, No. 10, 2006 2627
research articles
Kang et al.
Figure 3. Classification of the differentially expressed proteins identified. Pie charts representing the distribution of the 117 identified proteins according to their biological functions are shown. Assignments were made based on information from the NCBI (www.ncbi.nlm.nih.gov/PubMed) and the Swiss-Prot/TrEMBL protein knowledgebase (http://au.expasy.org/sport) websites.
protein (CBLB), Extracellular signal-regulated kinase 2 (ERK2), Extracellular matrix protein 1 (ECM 1), disulfide isomerase ER-60 (ERp60), and Rab GDP dissociation inhibitor beta (GDI2). Most of these proteins were up-regulated in U2OS cells with ASC treatment. For example, we identified the LIM domains-containing protein1 (LIMD1). LIMD1 is encoded at chromosome 3p21.3, a region commonly deleted in many malignancies and specifically interacts with retinoblastoma protein (pRB), inhibits E2Fmediated transcription, and suppresses the expression of the majority of genes with E2F-responsive elements. LIMD1 blocks tumor growth in vitro and in vivo and is down-regulated in the majority of human lung cancer.43 Our results show that the LIMD1 was up-regulated 2-fold in U2OS cells treated with ASC. Extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. In this study, Erk2 expression was increased 3-fold by ASC treatment of U2OS cells. HSP27 is a ubiquitously expressed member of the heat shock protein family that has been implicated in various biological functions including the response to heat shock, oxidative stress, and cytokine treatment. HSP27 confers cellular protection against a variety of cytotoxic stresses and also against physiological stresses associated with growth arrest or receptormediated apoptosis. Previous studies have demonstrated that heat shock proteins are involved in regulating signal transduction pathways, including the NF-kB pathway. These studies indicate that HSP27 plays a negative role in down-regulating IkB kinase signaling by reducing its activity following TNF-a stimulation.44 Our results show that the HSP27 was downregulated 2-fold in U2OS cells treated with ASC. Tumor Marker Proteins. A number of the proteins identified were well-known tumor-related proteins. Prohibitin, amphiphysin II, and MMP-2 were detected in U2OS cells treated with ASC. Amphiphysin II is a nucleocytosolic adapter protein that was identified initially through its ability to interact with the Myc box regions at the N terminus of the Myc oncoprotein. Although its actions as an adapter are complex, several lines of evidence support a role for amphiphysin II in the negative regulation of cell proliferation and malignancy. First, amphiphysin II inhibits 2628
Journal of Proteome Research • Vol. 5, No. 10, 2006
the oncogenic activity of c-Myc, adenovirus E1A, and mutant p53 by domain-dependent mechanisms. Second, amphiphysin II is structurally related to Rvs167, a negative regulator of the cell cycle in yeast that is needed to maintain viability after nutrient deprivation.45 In contrast, if Myc is oncogenically activated and cell cycle exit is blocked, then cytokine deprivation will cause programmed cell death, and amphiphysin II appears to be important for that process.45 Finally, although normally ubiquitous, amphiphysin II is reduced or undetectable in some carcinomas, and its reintroduction blocks tumor cell proliferation. These results support the hypothesis that amphiphysin II is a tumor suppressor that may act in part by countering the transforming action of c-Myc. Amphiphysin II expression was significantly increased by ASC treatment. Prohibitin was recently described as a potential tumor suppressor protein.46 It is exported from the nucleus of breast cancer cell lines upon apoptotic or stress signaling, thereby inhibiting cell proliferation and interacting with p53.47 In this study, prohibitin expression was decreased 2.2-fold by ASC treatment of U2OS cells. Proteins of the MMP family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes such as arthritis and metastasis. Most MMPs are secreted as inactive proproteins, which are activated when cleaved by extracellular proteinases. In addition, MMPs are regulated at multiple levels including transcription, secretion, and activation of inactive zymogens, while their tissue activity is under the strict control of specific inhibitors, i.e., tissue inhibitors of metalloproteinases.48 The enzyme plays a role in menstrual endometrial breakdown, regulation of vascularization and the inflammatory response. In this study, MMP-2 expression was significantly decreased by ASC treatment. Moreover, proteins implied in RNA processing were found to be regulated by ASC treatment. For example, proteins involved in pre-mRNA splicing (heterogeneous nuclear ribonucleoprotein L), in ribosomal activity (heterogeneous nuclear ribonucleoproteins C1/C2, and 60S acidic ribosomal protein P0), in translation (eukaryotic translation initiation factor 4E, and eukaryotic translation initiation factor 5A (elF-5A)) were found to be modulated by ASC. These data suggest that ASC could play a role in mRNA maturation and export.
Responses to Ascochlorin in a Human Osteosarcoma Cell Line
research articles
Figure 5. RT-PCR analysis of gene expression in U2OS cells. The expression of selected genes in U2OS cells treated with ASC for 12 h were determined by RT-PCR. Total RNA was isolated from U2OS cells, reverse transcribed, and amplified with the specific primers indicated in Table 1. β-actin was used as the control, and the data presented are the averages of three experiments.
Figure 4. Validation of the 2-D gel electrophoresis data by western blot and zymography with U2OS cellseither untreated or treated with ASC for 12 h. A: 20-70 µg of total cell lysates were separated on an SDS-PAGE gel, and immunoblotting was performed with anti-caspase-3, anti-annexin I, anti-Erk-2 and antiEGFR antibodies. B: protein expression levels and activity of MMP-2 were demonstrated by western blot and zymography.
elF-5A is involved in cell proliferation and the apoptosis of tumor cells induced by inhibition of ubiquitin proteasomes.49,50 Many studies have indicated that downregulation or inhibition of hypusine synthesis impedes cancer cell growth, including lung and pancreatic cancer cells, strongly indicating that elF5A may be an appropriate target for cancer intervention. Consistent with the above result, ASC was found to be able to lower the synthesis of elF-5A, indicating that ASC might impede U2OS cell growth by downregulation of elF-5A hMCM7 is centrally involved in the activation of the ATRdependent S-phase checkpoint by agents that induce DNA replication stress.51 In this study, the expression of hMCM7 was increased 8.2-fold by ASC treatment of U2OS cells. Confirmation of Differentially Expressed Proteins. To confirm some of the changes in protein expression after ASC treatment, we performed western blot analysis for the differ-
entially expressed proteins MMP-2, caspase-3, annexin 1, Erk 2, and EGFR. In addition, we performed quantitative RT-PCR analysis of six selected genes-prohibitin, phosphoglycerate mutase, EGFR, and Erk 2. Confirmation of Selected Proteins by Western Blot and Zymography. From the protein list given in Table 2, five proteins were selected for confirmation experiments using western blot analysis. As shown in Figure 4, the expression of EGFR protein was reduced by 75% in the presence of ASC. In addition, MMP-2 expression was reduced in ASC-treated U2OS cells, and zymography demonstrated that extracts from culture medium contained low amounts of the activated form of MMP2. As shown in Figure 4B, treatment with ASC decreased MMP-2 activity in a dose-dependent manner. Conversely, caspase-3 increased by approximately the same degree. Annexin I protein levels increased 1.7-fold in cells treated with ASC. In addition, Erk 2 was significantly increased (4-fold) in ASC-treated cells compared with control cells. Thus, in all cases, the western blot results confirmed the changes observed by proteomic analysis. Validation of Selected Proteins by RT-PCR Analysis. To validate the proteomic data, we also performed quantitative RT-PCR analysis of six selected genes. Figure 5 shows the mRNA expression patterns of the genes for prohibitin, phosphoglycerate mutase 1, EGFR, and Erk 2. Prohibitin mRNA was significantly decreased (2.5-fold) in ASC-treated cells compared with control cells. In contrast, phosphoglycerate mutase 1 mRNA expression in U2OS cells was increased approximately 2-fold by ASC. These data are consistent with the results from the 2-D electrophoresis. We also demonstrated that compared with control cells, the expression of Erk-2 was increased 4-fold by ASC treatment. We also validated by RT-PCR the downregulation of EGFR. Immunofluorescent Confocal Microscopy. To confirm the change in EGFR protein expression after ASC treatment, we performed Western blotting and immunofluorescent confocal microscopy. As shown in Figure 6, treatment with ASC decreased EGFR protein expression in a dose-dependent manner. Journal of Proteome Research • Vol. 5, No. 10, 2006 2629
research articles
Kang et al.
Acknowledgment. This work supported by the Korea Research Foundation Grant funded by the Korean Government (MOEHRD) (KRF-2005-042-C00150). References
Figure 6. EGFR expression changes after ASC treatment. U2OS cells were either untreated or treated for 12 h with 0.1, 1, or 10 µM ASC. A: expression of EGFR in U2OS cells demonstrated by western blot. B: cells were double stained with anti-EGFR antibody and DAPI and observed by fluorescent microscopy.
Conclusion ASC is a potent antiviral and antifungal compound, and its derivatives are known to modulate a variety of physiological activities, and have a variety of antitumor, antimetastatic and antidiabetic activities in animals.1,2,3,5,6,52 In a previous study, we reported that ASC inhibits MMP-9 by suppressing AP-1mediated gene expression through the Erk 1/2 signaling pathway in Caki-1 human renal carcinoma cells. ASC reduced the invasive activity of Caki-1 cells and inhibited PMA-induced increases in MMP-9 expression and activity in a dose-dependent manner.18 In this study, we applied 2-D gel electrophoresis and the identification of proteins by mass spectrometry to the analysis of the proteome of U2OS human osteosarcoma cells. To our knowledge, this is the first proteomic analysis of human osteosarcoma cells treated with ASC. This map provides a valid basis for identifying possible differences in protein profiles of those cells in response to ASC or other stimulations. By this technique, we identified 117 proteins whose expression showed consistent differences in their expression patterns with ASC treatment. Most of the proteins downregulated in U2OS cells treated with ASC are associated with tumor growth, such as MMP-2, vimentin, and EGFR. Our results suggest that ASC may be useful as a potent clinical suppressant of tumor invasion, a topic of considerable interest in the biological chemistry of chemotherapeutic agents. In conclusion, more in-depth studies should be done to increase understanding of the mechanisms of ASC’s effects on cells and its potential as an anticancer drug. 2630
Journal of Proteome Research • Vol. 5, No. 10, 2006
(1) Tamura, G.; Suzuki, S.; Takatsuki, A.; Ando, K.; Arima, K. Ascochlorin, a new antibiotic, found by the paper-disc agar-diffusion method. I. Isolation, biological and chemical properties of ascochlorin. (Studies on antiviral and antitumor antibiotics. I). J. Antibiot. (Tokyo) 1968, 21, 539-544. (2) Sawada, M.; Hosokawa, T.; Okutomi, T.; Ando, K.; Hypolipidemic property of ascofuranone. J. Antibiot. (Tokyo) 1973, 26, 681-686. (3) Hosokawa, T.; Ando, K.; Tamura, G.; Effect of oral treatment with a new hypoglycemic agent, AS-6, on the metabolic activities of adipocytes in db/db mice: a comparative study. Biochem. Biophys. Res. Commun. 1985, 126, 471-476. (4) Hosokawa, T.; Sawada, M.; Ando, K.; Tamura, G.; Alteration of cholesterol metabolism by 4-O-methylascochlorin in rats. Lipids 1981, 16, 433-438. (5) Magae, J.; Suzuki, S.; Nagai, K.; Yamasaki, M.; Ando, K.; Tamura, G. In vitro effects of an antitumor antibiotic, ascofuranone, on the murine immune system. Cancer Res. 1986, 46 (3), 1073-1078. (6) Magae, J.; Hayasaki, J.; Matsuda, Y.; Hotta, M.; Hosokawa, T.; Suzuki, S.; Nagai, K.; Ando, K.; Tamura, G. Antitumor and antimetastatic activity of an antibiotic, ascofuranone, and activation of phagocytes. J. Antibiot. (Tokyo) 1988, 41 (7), 959-965. (7) Ando, M.; Hirosaki, S.; Tamura, K.; Taya, T. Multiple regression analysis of the cholinesterase activity with certain physiochemical factors. Environ. Res. 1984, 33 (1), 96-105. (8) Overall, C. M.; Wrana, J. L.; Sodek, J. Independent regulation of collagenase, 72-kDa progelatinase, and metalloendoproteinase inhibitor expression in human fibroblasts by transforming growth factor-beta. J. Biol. Chem. 1989, 264 (3), 1860-1869. (9) Togashi, M.; Ozawa, S.; Abe, S.; Nishimura, T.; Tsuruga, M.; Ando, K.; Tamura, G.; Kuwahara, S.; Ubukata, M.; Magae, J. Ascochlorin derivatives as ligands for nuclear hormone receptors. J. Med. Chem. 2003, 46 (19), 4113-4123. (10) Takatsuki, A.; Tamura, G.; Arima, K. Antiviral and antitumor antibiotics. XIV. Effects of ascochlorin and other respiration inhibitors on multiplication of Newcastle disease virus in cultured cells. Appl. Microbiol. 1969, 17 (6), 825-982. (11) Magae, J.; Munemura, K.; Ichikawa, C.; Osada, K.; Hanada, T.; Tsuji, R. F.; Yamashita, M.; Hino, A.; Horiuchi, T.; Uramoto, M.; et al. Effects of microbial products on glucose consumption and morphology of macrophages. Biosci., Biotechnol., Biochem. 1993, 57 (10), 1628-1631. (12) Togashi, M.; Masuda, H.; Kawada, T.; Tanaka, M.; Saida, K.; Ando, K.; Tamura, G.; Magae, J. PPARgamma activation and adipocyte differentiation induced by AS-6, a prenyl-phenol antidiabetic antibiotic. J. Antibiot. (Tokyo) 2002, 55, 417-422. (13) MP, L.; Eilber, F. Pediatric Osteosarcoma; Lippincott: Philadelphia, 1989. (14) Ferguson, W. S.; Goorin, A. M. Current treatment of osteosarcoma. Cancer Invest. 2001, 19 (3), 292-315. (15) Marina, N. M.; Pratt, C. B.; Rao, B. N.; Shema, S. J.; Meyer, W. H. Improved prognosis of children with osteosarcoma metastatic to the lung(s) at the time of diagnosis. Cancer 1992, 70 (11), 27222727. (16) Bjellqvist, B.; Ek, K.; Righetti, P. G.; Gianazza, E.; Gorg, A.; Westermeier, R.; Postel, W. Isoelectric focusing in immobilized pH gradients: principle, methodology and some applications. J. Biochem. Biophys. Methods 1982, 6 (4), 317-339. (17) Neuhoff, V.; Arold, N.; Taube, D.; Ehrhardt, W. Improved staining of proteins in polyacrylamide gels including isoelectric focusing gels with clear background at nanogram sensitivity using Coomassie Brilliant Blue G-250 and R-250. Electrophoresis 1988, 9 (6), 255-262. (18) Hong, S.; Park, K. K.; Magae, J.; Ando, K.; Lee, T. S.; Kwon, T. K.; Kwak, J. Y.; Kim, C. H.; Chang, Y. C. Ascochlorin inhibits matrix metalloproteinase-9 expression by suppressing activator protein1-mediated gene expression through the ERK 1/2 signaling pathway: inhibitory effects of ascochlorin on the invasion of renal carcinoma cells. J. Biol. Chem. 2005, 280 (26), 25202-25209. (19) Chung, T. W.; Lee, Y. C.; Kim, C. H. Hepatitis B viral HBx induces matrix metalloproteinase-9 gene expression through activation of ERK and PI-3K/AKT pathways: involvement of invasive potential. FASEB J. 2004, 18 (10), 1123-1125.
research articles
Responses to Ascochlorin in a Human Osteosarcoma Cell Line (20) Graham, D. E.; Xu, H.; White, R. H. A divergent archaeal member of the alkaline phosphatase binuclear metalloenzyme superfamily has phosphoglycerate mutase activity. FEBS Lett. 2002, 517 (13), 190-194. (21) Boraldi, F.; Bini, L.; Liberatori, S.; Armini, A.; Pallini, V.; Tiozzo, R.; Pasquali-Ronchetti, I.; Quaglino, D. Proteome analysis of dermal fibroblasts cultured in vitro from human healthy subjects of different ages. Proteomics 2003, 3 (6), 917-929. (22) Rigden, D. J.; Lamani, E.; Mello, L. V.; Littlejohn, J. E.; Jedrzejas, M. J. Insights into the catalytic mechanism of cofactor-independent phosphoglycerate mutase from X-ray crystallography, simulated dynamics and molecular modeling. J. Mol. Biol. 2003, 328 (4), 909-920. (23) Wattenberg, L. W.; Chemoprevention of cancer. Cancer Res. 1985, 45 (1), 1-8. (24) Durany, N.; Joseph, J.; Jimenez, O. M.; Climent, F.; Fernandez, P. L.; Rivera, F.; Carreras, J. Phosphoglycerate mutase, 2,3bisphosphoglycerate phosphatase, creatine kinase and enolase activity and isoenzymes in breast carcinoma. Br. J. Cancer 2000, 82 (1), 20-27. (25) Fairchild, T. A.; Patejunas, G. Cloning and expression profile of human inorganic pyrophosphatase. Biochim. Biophys. Acta 1999, 1447 (2-3), 133-136. (26) Islam, M. K.; Miyoshi, T.; Kasuga-Aoki, H.; Isobe, T.; Arakawa, T.; Matsumoto, Y.; Tsuji, N. Inorganic pyrophosphatase in the roundworm Ascaris and its role in the development and molting process of the larval stage parasites. Eur. J. Biochem. 2003, 270 (13), 2814-2826. (27) Yoshida, C.; Shah, H.; Weinhouse, S. Purification and properties of inorganic pyrophosphatase of rat liver and hepatoma 3924A. Cancer Res. 1982, 42 (9), 3526-3531. (28) Satoh, T.; Samejima, T.; Watanabe, M.; Nogi, S.; Takahashi, Y.; Kaji, H.; Teplyakov, A.; Obmolova, G.; Kuranova, I.; Ishii, K. Molecular cloning, expression, and site-directed mutagenesis of inorganic pyrophosphatase from Thermus thermophilus HB8. J. Biochem. (Tokyo) 1998, 124 (1), 79-88. (29) Flynn, T. G. Aldehyde reductases: monomeric NADPH-dependent oxidoreductases with multifunctional potential. Biochem. Pharmacol. 1982, 31 (17), 2705-2712. (30) Barski, O. A.; Gabbay, K. H.; Grimshaw, C. E.; Bohren, K. M. Mechanism of human aldehyde reductase: characterization of the active site pocket. Biochemistry 1995, 34 (35), 11264-11275. (31) Seliger, B.; Menig, M.; Lichtenfels, R.; Atkins, D.; Bukur, J.; Halder, T. M.; Kersten, M.; Harder, A.; Ackermann, A.; Beck, J.; Muehlenweg, B.; Brenner, W.; Melchior, S.; Kellner, R.; Lottspeich, F. Identification of markers for the selection of patients undergoing renal cell carcinoma-specific immunotherapy. Proteomics 2003, 3 (6), 979-990. (32) Weber, A.; Pennise, C. R.; Babcock, G. G.; Fowler, V. M. Tropomodulin caps the pointed ends of actin filaments. J. Cell. Biol. 1994, 127 (6 Pt 1), 1627-1635. (33) Littlefield, R.; Almenar-Queralt, A.; Fowler, V. M. Actin dynamics at pointed ends regulates thin filament length in striated muscle. Nat. Cell Biol. 2001, 3 (6), 544-551. (34) Droz, D.; Zachar, D.; Charbit, L.; Gogusev, J.; Chretein, Y.; Iris, L.; Expression of the human nephron differentiation molecules in renal cell carcinomas. Am. J. Pathol. 1990, 137 (4), 895-905. (35) Mendelsohn, J.; Baselga, J. The EGF receptor family as targets for cancer therapy. Oncogene 2000, 19 (56), 6550-6565. (36) de Bono, J. S.; Rowinsky, E. K. The ErbB receptor family: a therapeutic target for cancer. Trends Mol. Med. 2002, 8 (4 Suppl), S19-26.
(37) Woodburn, J. R. The epidermal growth factor receptor and its inhibition in cancer therapy. Pharmacol. Ther. 1999, 82 (2-3), 241-250. (38) Arteaga, C. L. Epidermal growth factor receptor dependence in human tumors: more than just expression? Oncologist 2002, 7 Suppl 4, 31-39. (39) Khazaie, K.; Schirrmacher, V.; Lichtner, R. B. EGF receptor in neoplasia and metastasis. Cancer Metastasis Rev. 1993, 12 (34), 255-274. (40) Brabender, J.; Danenberg, K. D.; Metzger, R.; Schneider, P. M.; Park, J.; Salonga, D.; Holscher, A. H.; Danenberg, P. V. Epidermal growth factor receptor and HER2-neu mRNA expression in nonsmall cell lung cancer is correlated with survival. Clin. Cancer Res. 2001, 7 (7), 1850-1855. (41) Ciardiello, F.; Tortora, G. A novel approach in the treatment of cancer: targeting the epidermal growth factor receptor. Clin. Cancer Res. 2001, 7 (10), 2958-2970. (42) Fan, X.; Krahling, S.; Smith, D.; Williamson, P.; Schlegel, R. A. Macrophage surface expression of annexins I and II in the phagocytosis of apoptotic lymphocytes. Mol. Biol. Cell 2004, 15 (6), 2863-2872. (43) Sharp, T. V.; Munoz, F.; Bourboulia, D.; Presneau, N.; Darai, E.; Wang, H. W.; Cannon, M.; Butcher, D. N.; Nicholson, A. G.; Klein, G.; Imreh, S.; Boshoff, C. LIM domains-containing protein 1 (LIMD1), a tumor suppressor encoded at chromosome 3p21.3, binds pRB and represses E2F-driven transcription. Proc. Natl. Acad. Sci. U.S.A. 2004, 101 (47), 16531-16536. (44) Charette, S. J.; Lavoie, J. N.; Lambert, H.; Landry, J. Inhibition of Daxx-mediated apoptosis by heat shock protein 27. Mol. Cell. Biol. 2000, 20 (20), 7602-7612. (45) Elliott, K.; Sakamuro, D.; Basu, A.; Du, W.; Wunner, W.; Staller, P.; Gaubatz, S.; Zhang, H.; Prochownik, E.; Eilers, M.; Prendergast, G. C. Bin1 functionally interacts with Myc and inhibits cell proliferation via multiple mechanisms. Oncogene 1999, 18 (24), 3564-3573. (46) Prendergast, G. C.; Mechanisms of apoptosis by c-Myc. Oncogene 1999, 18 (19), 2967-2987. (47) Fusaro, G.; Dasgupta, P.; Rastogi, S.; Joshi, B.; Chellappan, S. Prohibitin induces the transcriptional activity of p53 and is exported from the nucleus upon apoptotic signaling. J. Biol. Chem. 2003, 278 (48), 47853-47861. (48) Nagase, H.; Woessner, J. F., Jr. Matrix metalloproteinases. J. Biol. Chem. 1999, 274 (31), 21491-21494. (49) Caraglia, M.; Budillon, A.; Vitale, G.; Lupoli, G.; Tagliaferri, P.; Abbruzzese, A. Modulation of molecular mechanisms involved in protein synthesis machinery as a new tool for the control of cell proliferation. Eur. J. Biochem. 2000, 267 (13), 3919-3936. (50) Jin, B. F.; He, K.; Wang, H. X.; Wang, J.; Zhou, T.; Lan, Y.; Hu, M. R.; Wei, K. H.; Yang, S. C.; Shen, B. F.; Zhang, X. M. Proteomic analysis of ubiquitin-proteasome effects: insight into the function of eukaryotic initiation factor 5A. Oncogene 2003, 22 (31), 48194830. (51) Tsao, C. C.; Geisen, C.; Abraham, R. T. Interaction between human MCM7 and Rad17 proteins is required for replication checkpoint signaling. EMBO J. 2004, 23 (23), 4660-4669. (52) Hosokawa, T.; Ando, K.; Tamura, G. An ascochlorin derivative, AS-6, reduces insulin resistance in the genetically obese diabetic mouse, db/db. Diabetes 1985, 34 (3), 267-274.
PR060111I
Journal of Proteome Research • Vol. 5, No. 10, 2006 2631
