Proteome-wide Dysregulation by Glucose-6-phosphate

Article pubs.acs.org/jpr

Proteome-wide Dysregulation by Glucose-6-phosphate Dehydrogenase (G6PD) Reveals a Novel Protective Role for G6PD in Aflatoxin B1‑Mediated Cytotoxicity Hsin-Ru Lin,†,▼ Chih-Ching Wu,*,†,‡,§,▼ Yi-Hsuan Wu,‡ Chia-Wei Hsu,†,§ Mei-Ling Cheng,*,†,∥,⊥ and Daniel Tsun-Yee Chiu*,†,‡,∥,△ †

Graduate Institute of Biomedical Science, College of Medicine, ‡Department of Medical Biotechnology and Laboratory Science, College of Medicine, §Molecular Medicine Research Center, ∥Healthy Aging Research Center, and ⊥Department of Biomedical Sciences, College of Medicine, Chang Gung University, Tao-Yuan, Taiwan △ Department of Laboratory Medicine, Chang Gung Memorial Hospital, Lin-Kou, Taiwan S Supporting Information *

ABSTRACT: Glucose-6-phosphate dehydrogenase (G6PD) is pivotal to reduced nicotinamide adenine dinucleotide phosphate (NADPH) production and cellular redox balance. Cells with G6PD deficiency are susceptible to oxidant-induced death at high oxidative stress. However, it remains unclear what precise biological processes are affected by G6PD deficiency due to altered cellular redox homeostasis, particularly at low oxidative stress. To further explore the biological role of G6PD, we generated G6PD-knockdown cell clones using lung cancer line A549. We identified proteins differentially expressed in the knockdown clones without the addition of exogenous oxidant by means of isobaric tags for relative and absolute quantification (iTRAQ) labeling coupled with multidimensional liquid chromatography−mass spectrometry (LC−MS/MS). We validated a panel of proteins that showed altered expression in G6PD-knockdown clones and were involved in metabolism of xenobiotic and glutathione (GSH) as well as energy metabolism. To determine the physiological relevancy of our findings, we investigated the functional consequence of G6PD depletion in cells treated with a prevalent xenobiotic, aflatoxin B1 (AFB1). We found a protective role of G6PD in AFB1-induced cytotoxicity, possibly via providing NADPH for NADPH oxidase to induce epoxide hydrolase 1 (EPHX1), a xenobiotic-metabolizing enzyme. Collectively, our findings reveal for the first time a proteome-wide dysregulation by G6PD depletion under the condition without exogenous oxidant challenge, and we suggest a novel association of G6PD activity with AFB1-related xenobiotic metabolism. KEYWORDS: glucose-6-phosphate dehydrogenase, NADPH, iTRAQ, aflatoxin B1, epoxide hydrolase 1, xenobiotic metabolism

■

Importantly, G6PD is involved in cell survival and death.13 Yeast cells with a defect in the G6PD gene are sensitive to oxidants.14 CHO cells deficient in G6PD have increased sensitivity to oxidizing agents and ionizing radiation.15,16 Embryonic stem cells derived from G6PD nullizygous mice are extremely susceptible to hydrogen peroxide- and diamideinduced decrease in cloning efficiency and viability.2,17 In line with the above, our previous studies have also shown that G6PD-deficient cells are sensitive to peroxynitrite- and diamide-induced cell death.11,18 These findings suggest that G6PD status determines sensitivity to oxidant-mediated cell death. Reactive oxygen species (ROS), a group of molecules produced in cells when oxygen is metabolized, exert biological effects covering a wide spectrum ranging from physiological regulatory functions to damaging cellular components, leading to the eventual pathogenesis of diseases.19,20 Excess ROS have been proven to induce cell death.21,22 ROS cause oxidative

INTRODUCTION Glucose-6-phosphate dehydrogenase (G6PD), the key enzyme in the hexose monophosphate shunt,1 is ubiquitously expressed in human tissues and involved in the oxidation of glucose 6phosphate to 6-phosphogluconolactone and the regeneration of reduced nicotinamide adenine dinucleotide phosphate (NADPH) to fulfill the cellular needs for reductive biosynthesis and maintenance of the cellular redox balance.2,3 G6PD deficiency clinically leads to neonatal jaundice, drug- or infection-induced hemolytic crisis, favism, and nonspherocytic hemolytic anemia.4,5 The hemolytic essence of these syndromes results from the incapability to maintain reduced-form NADPH in erythrocytes under oxidative stress. This then leads to oxidation of cellular components and ultimately removal of the damaged cells from circulation.6,7 During the last two decades, G6PD deficiency has been found to induce aberrations of cellular functions in nucleated cells in addition to erythrocytes. Fibroblasts carrying a G6PD mutation undergo premature senescence and have increased propensity to oxidant-induced senescence.3,8 Compared with normal cells, G6PD-deficient cells respond to signaling molecules in different ways.9−12 © XXXX American Chemical Society

Received: April 2, 2013

A

dx.doi.org/10.1021/pr4002959 | J. Proteome Res. XXXX, XXX, XXX−XXX

Journal of Proteome Research

Article

investigated the functional consequence of G6PD depletion in cells treated with aflatoxin B1 (AFB1), a prevalent xenobiotic and carcinogen. We provide evidence that G6PD can protect cells from AFB1-induced cytotoxicity via a redox mechanism to induce epoxide hydrolase 1 (EPHX1), a xenobiotic metabolizing enzyme. Collectively, our findings reveal a proteome-wide dysregulation by G6PD depletion and suggest a novel association of G6PD activity with AFB1-related xenobiotic metabolism.

modification to cellular macromolecules that, if not appropriately amended, brings about apoptosis or necrosis. The extent of oxidative stress and the type of macromolecular damage may settle the mode of cell death.23 Cells possess a number of antioxidant systems to balance ROS generation. For instance, glutathione (GSH) acts as a ROS scavenger or substrate for other antioxidant enzymes. Glutathione peroxidase catalyzes the reduction of hydroperoxides with coexistent oxidation of GSH to its disulfide form, glutathione disulfide (GSSG), which could be reduced by glutathione reductase (GSR) in the presence of NADPH. This highlights the importance of G6PD to provide NADPH. Indeed, G6PD-deleted embryonic stem cells enter into a condition of oxidative stress that strongly increases the cellular ROS level and activates a mitochondriadependent apoptotic pathway.2 We also demonstrated that the increased sensitivity of G6PD-deficient cells to diamide-induced oxidative damage is related to ineffective GSH regeneration in these cells.18 Conversely, G6PD can also act as a prooxidant enzyme in terms of providing NADPH oxidase or nitric oxide synthase with substrate NADPH to generate oxidants in cells.9,24,25 For instance, in rat insulin-secreting RINm5F cells, interleukin-1βmediated production of nitric oxide radical was significantly reduced either by inhibiting G6PD activity with an inhibitor (dehydroepiandrosterone) or by inhibiting G6PD expression with an antisense oligonucleotide to G6PD mRNA,26 indicating the dual roles of G6PD in the balance of cellular redox status. However, the underlying mechanisms regarding the effects of G6PD activity on changes of cellular signaling and protein expression remains to be clearly elucidated. Hence, it is clear that application of the “omics” approach to evaluate how G6PD status can modulate cellular function seems timely and needed. In fact, proteomics approaches have been applied to understand the role of G6PD in pathological conditions. Recently, Mendez et al.27 have identified the carbonylated membrane proteins with differential expression caused by G6PD deficiency in erythrocytes infected by Plasmodium falciparum. Romero-Ruiz et al.28 have performed a proteomic analysis of the ventral mesencephalon and the striatum between wild-type and G6PD-overexpressing mice to examine the neuroprotective effect of G6PD in chemical-induced neuronal damage. In these studies, the comparative proteome profiling was carried out by two-dimensional gels followed by in-gel tryptic digestion and analysis via MALDI-TOF MS. Alternatively, the proteome could be analyzed with trypsin-digested in solution combined with multidimensional liquid chromatography−mass spectrometry (LC−MS/MS). In general, the number of proteins resolved by the LC−MS/MS method is largely increased compared to that resolved by the MALDITOF MS method.29,30 Advanced protein separation and identification technologies have made it possible to identify more proteins, accordingly facilitating the discovery of dysregulated proteins in G6PD deficiency or overexpressing cells. To further assess the role of G6PD, we generated G6PDknockdown cell clones in A549 cells and used the clones to analyze the effect of G6PD deficiency on relevant biological processes in this study. By using the isobaric tags for relative and absolute quantification (iTRAQ) approach combined with LC−MS/MS, we discovered a panel of dysregulated proteins in G6PD-knockdown clones that participate in metabolism of energy and GSH as well as xenobiotic metabolism.31,32 To determine the physiological relevancy of our findings, we

■

EXPERIMENTAL PROCEDURES

Cell Culture

The human lung adenocarcinoma A549, hepatocarcinoma HepG2 cells, and cell lines derived from them were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 100 units/mL penicillin, and 100 μg/mL streptomycin (Gibco) at 37 °C in a humidified atmosphere of 5% CO2 with or without 300 μg/mL G418, depending on whether or not they were transfected. Gene Knockdown of G6PD

To generate RNAi plasmids for G6PD-knockdown stable clones, the sense and antisense oligonucleotides 5′-ACACACATATTCATCATCGAAGCTTGGATGATGAATATGTGTGT-3′ and 5′-GGATACACACATATTCATCATCCAAGCTTCGATGATGAATATGTGTGT-3′ were annealed and ligated into pTOPO-U6 to generate pTOPO G6PD-143. The plasmid was then removed to insert into the pCI-neo mammalian expression vector, as previously described.33 The vectors were transfected into A549 cells by use of Lipofectamine (Invitrogen, Carlsbad, CA). Twenty-four hours later, transfected cells were selected for 14 days with G418. Pooled populations of knockdown cells were further subcloned and maintained under G418 selection. Control cell lines were generated by transfecting cells with a pCI-neo vector construct, which did not yield any appreciable knockdown of the protein product in Western blot analysis. To generate recombinant short hairpin RNA (shRNA) lentivirus for G6PD transient knockdown, LKO.1.null-T plasmids were purchased from the National RNAi Core Facility (Academia Sinica, Taipei, Taiwan). The minicassette encoding shRNA against G6PD or scramble gene include overhangs that allow cloning into AgeI and EcoRI sites of pLKO.1.null-T. Scramble shRNA was used as a negative control. The sense and antisense sequences of G6PD shRNA cassettes were 5′CCGGGCTAACCTTCGTAGGACCGACGCTCGAGCGTCGGTCCTACGAAGGTTAGCTTTTT-3′ and 5′AATTAAAAAGGATACACACATATTCATCATCCTCGAGGATGATGAATATGTGTGTATCC-3′. The sense and antisense sequences of scramble shRNA cassettes were 5′CCGGGCTCAACCTGTACAACATATTACTCGAGTAATATGTTGTACAGGTTGAGCTTTTT-3′ and 5′-AATTAAAAAGCTCAACCTGTACAACATATTACTCGAGTAATATGTTGTACAGGTTGAGC-3′. HEK293 cells were cotransfected with the packing plasmid (pCMV-ΔR8.91), pLKO.1 plasmids expressing shRNA, and envelope plasmid (pMD.G) to produce shRNA lentivirus according to instructions from the supplier. G6PD Activity Assay

G6PD activity was measured by the reduction of NADP+ in the presence of glucose 6-phosphate as previously described.12 Briefly, cells were collected at 4 °C in lysis buffer containing 50 B



Article

buffer B for 2.5 min, and 100% buffer B for 7.5 min. The elution was monitored by absorbance at 220 nm, and fractions were collected every 1 min. Each fraction was vacuum-dried and then resuspended in 0.1% formic acid (20 μL) for further desalting and concentration by use of a Ziptip home-packed with C18 resin (5−20 μm, LiChroprep RP-18, Merck, Taipei, Taiwan).

mM Tris-HCl (pH 7.4), 1% Triton X-100, 0.05% SDS, 150 mM NaCl, 1 mM EGTA, and 1 mM NaF. Then the cells were disrupted by mordant vortex on ice. After centrifugation at 10000g for 20 min at 4 °C, the supernatant was collected. The protein extracts (50 μg) were diluted with 1 mL of assay buffer (50 mM Tris-HCl, pH 8.0, 50 mM MgCl2, 4 mM NADP+, and 4 mM glucose 6-phosphate). The absorbance at 340 nm was then immediately measured with a DU800 spectrophotometer (Beckman Coulter, Brea, CA).

LC−ESI MS/MS Analysis by LTQ-Orbitrap PQD

Cells were lysed in buffer containing 100 mM triethylammonium bicarbonate (TEABC, Sigma−Aldrich) and 0.1% RapiGest SF (Waters Corp., Milford, MA) on ice for 15 min. The cell lysates were collected and then sonicated on ice, followed by centrifugation at 10000g for 25 min at 4 °C. The resulting supernatants were used as cell extracts. For tryptic insolution digestion, the protein mixtures were denatured with 8 M urea containing 50 mM TEABC, reduced with 10 mM Tris(2-carboxyethyl)phosphine (TCEP, Sigma−Aldrich) at 37 °C for 90 min, and then alkylated with 10 mM methyl methanethiosulfonate (MMTS, Sigma-Aldrich) at room temperature for 20 min. After desalting, the protein mixtures were in-solution digested with modified, sequencing-grade trypsin (Promega, Madison, WI) at 37 °C overnight.31,32

To analyze the iTRAQ-labeled peptide mixtures, each peptide fraction was reconstituted in buffer C (0.1% formic acid), loaded across a trap column (Zorbax 300SB-C18, 0.3 × 5 mm, Agilent Technologies, Wilmington, DE) at a flow rate of 0.2 μL/min in buffer C, and separated on a resolving 10-cm analytical C18 column (inner diameter 75 μm) with a 15-μm tip (New Objective, Woburn, MA). The peptides were eluted with a linear gradient of 2−30% buffer D (acetonitrile containing 0.1% formic acid) for 63 min, 30−45% buffer D for 5 min, and 45−95% buffer D for 2 min with a flow rate of 0.25 μL/min across the analytical column. The LC setup was coupled online to a linear ion trap mass spectrometer LTQ-Orbitrap (Thermo Fisher, San Jose, CA) operated via Xcalibur 2.0 software (Thermo Fisher). Intact peptides were detected in the Orbitrap at a resolution of 30 000. Internal calibration was performed with the ion signal of [Si(CH3)2O]6H+ at m/z 445.120 025 as a lock mass. Peptides were selected for MS/MS in PQD operating mode with a normalized collision energy setting of 27%, and fragment ions were detected in the LTQ.31,32,34 The data-dependent procedure that alternated between one MS scan followed by three MS/MS scans for the three most abundant precursor ions in the MS survey scan was applied. The m/z values selected for MS/MS were dynamically excluded for 180 s. The electrospray voltage applied was 1.8 kV. Both MS and MS/MS spectra were acquired via the 4 microscan with maximum fill times of 1000 and 100 ms for MS and MS/MS analysis, respectively. Automatic gain control was used to prevent overfilling of the ion trap, and 5 × 104 ions were accumulated in the ion trap for generation of PQD spectra. For MS scans, the m/z scan range was 350−2000 Da.

iTRAQ Reagent Labeling and Fractionation by Reversed Phase Chromatography

Sequence Database Searching and Quantitative Data Analysis

The peptides were labeled with the iTRAQ reagent (Applied Biosystems, Foster City, CA) according to the manufacturer’s protocol. Briefly, one unit of label (defined as the amount of reagent required to label 100 μg of protein) was thawed and reconstituted in ethanol (70 μL). The peptide mixtures were reconstituted with 25 μL of iTRAQ dissolution buffer. The aliquots of iTRAQ 114 and 115 were combined with peptide mixtures from the control and G6PD-knockdown samples, respectively, and incubated at room temperature for 1 h. The peptide mixtures were then pooled and dried by vacuum centrifugation. The dried peptide mixture was reconstituted with 0.5 mL of buffer A (10 mM NH4HCO3, pH 10) for fractionation by reversed-phase chromatography on the Ettan MDLC system (GE Healthcare, Taipei, Taiwan). For peptide fractionation, the iTRAQ-labeled peptides were loaded onto a 4.6 mm × 100 mm Gemini column containing 3μm particles with 110-Å pore size (Phenomenex, Torrance, CA). The peptides were eluted at a flow rate of 100 μL/min with a gradient of 2% buffer B for 5 min (10 mM NH4HCO3 in acetonitrile, pH 10), 2−25% buffer B for 30 min, 25−50% buffer B for 20 min, 50−75% buffer B for 5 min, 75−100%

MS/MS spectra were searched by use of MASCOT engine (Matrix Science, London, U.K.; version 2.2.04) against a nonredundant International Protein Index (IPI) human sequence database v3.55 (released February 2009; 75 574 sequences, 31 556 873 residues) from the European Bioinformatics Institute (http://www.ebi.ac.uk/). For protein identification, 10 ppm mass tolerance was permitted for intact peptide masses and 0.5 Da for PQD fragment ions, with allowance for two missed cleavages made from the trypsin digest, oxidized methionine (+16 Da) as a potential variable modification, and iTRAQ (N terminal, +144 Da), iTRAQ (K, +144 Da), and MMTS (C, +46 Da) as the fixed modifications. The MASCOT search results for each strong cation exchange (SCX) elution were further processed by use of the TransProteomic Pipeline (TPP, version 4.0), which includes the programs PeptideProphet, ProteinProphet, and Libra.34−36 PeptideProphet, a peptide probability score program, aids in the assignment of peptide MS spectra.37 The ProteinProphet program, which assigns and groups peptides to a unique protein or protein family in cases where peptides are shared among several isoforms, allows the filtering of large-scale data sets with

Western Blotting Analysis

The prepared samples (50 μg of proteins) were resolved by SDS-10% polyacrylamide gel electrophoresis, electrotransferred onto poly(vinylidene difluoride) membrane (Millipore, Billerica, MA), and probed with various antibodies [i.e., anti-G6PD (Genesis Biotech, Taiwan), anti-EPHX-1, anti-Nrf2, anti-βactin, anti-lamin A/C (Santa Cruz Biotechnology, Santa Cruz, CA), anti-histone H3 (Millipore), and anti-AKR1C3 (Sigma− Aldrich, St. Louis, MO)] as described previously. Proteins of interest were detected with horseradish peroxidase-conjugated secondary antibodies (Santa Cruz Biotechnology) and visualized by enhanced chemiluminescence (Pierce ECL, Thermo Scientific) on Fuji SuperRx films. Tryptic Digestion of Protein Mixtures for Proteome Analysis

C



Article

Subcellular Fractionation

assessment of predictable sensitivity and false positive identification error rates.38 We used the ProteinProphet probability score ≥0.92 to ensure an overall false positive rate below 1%, and we excluded the proteins identified with single peptide hits. Protein quantification was achieved with the Libra program at the default setting. A weighted average of the peptide iTRAQ ratios per protein was used to quantify the protein. Peptides with iTRAQ reporter ion intensities lower than 30 were removed to improve the reliability of protein quantification; peptides with an iTRAQ ratio beyond 2-fold deviation from the mean ratio were also excluded as outliers. Each quantified protein contained at least three Libra spectra. Proteins with iTRAQ ratios below the mean of all iTRAQ ratios minus standard deviation (SD) of all iTRAQ ratios were considered to be underexpressed (0.84 and 0.76 for experiments 1 and 2, respectively), while those above the mean plus SD were considered overexpressed (1.23 and 1.37 for experimetns 1 and 2, respectively). Information about PeptideProphet, ProteinProphet, and Libra programs in the TPP can be accessed from the Institute for Systems Biology of the Seattle Proteome Center (http://www.proteomecenter. org/).

To enrich nuclear proteins, cells were subjected to subcellular fractionation with the NE-PER nuclear and cytoplasmic extraction reagents kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. The efficacy of fractionation was determined via Western blotting with lamin A/C and histone H3 as the nuclear control proteins. Detection of Intracellular Superoxide

Cellular superoxide level was monitored with the redox indicator dihydroethidium (DHE; Sigma−Aldrich). Briefly, 3 × 105 A549 cells cultured in six wells were treated with 50 μM aflatoxin B1 for the indicated time intervals and then stained with PBS containing 10 μM DHE for 30 min at 37 °C in the dark. Finally, cells were detached by trypsinization and resupended in PBS. The DHE-derived fluorescence was analyzed by the Becton Dickinson FACScan system.

■

RESULTS

Identification of Proteins Differentially Expressed in G6PD-Knockdown Cells by iTRAQ−LC−MS/MS Analysis

G6PD is the rate-limiting enzyme in the pentose phosphate pathway and plays roles in cellular redox homeostasis and cell death. To investigate the cellular function of G6PD, we generated G6PD-knockdown cells by persistent expression of G6PD shRNA in A549 cells. No significant change in the cell proliferation rate was observed between control and G6PDknockdown cells (data not shown). The knockdown efficacy (exceeding 80% reduction) was validated by G6PD activity (Figure 1A) and Western blot analysis (Figure 1B). We then sought to elucidate the G6PD function in the aspect of altered protein expression in the G6PD-knockdown cells. To identify proteins that are differentially expressed in G6PDknockdown cells compared with the controls, we conducted two replicates of iTRAQ-based quantitative proteomics analyses (experiments 1 and 2), each of which contained two measurements of G6PD-knockdown and control single clones (Figure 2A). The iTRAQ-labeled samples were then analyzed by two-dimensional (2D) liquid chromatography−mass spectrometry (LC−MS/MS) for quantitative proteomic analysis. Recently, it has been demonstrated that 2D reversed phase (RP)/RP LC scheme provides better overall fractionation of a complex protein digest when compared with other chromatographic modes. The application of 2D RP/RP LC method can simplify fraction manipulation and instrument maintenance.39−41 The other benefit is that the first dimension, unlike the use of SCX as the first dimension, does not require the use of high salt content buffers and consequently the fractions do not need desalting. The 2D fractionation of the labeled peptides involved the use of an offline RP-based separation in the first dimension, followed by an online RP fractionation (Figure 2A). Each fraction was analyzed in two independent mass spectrometer runs. The resulting MS/MS spectra were analyzed against the nonredundant IPI human sequence database (version 3.55) with the MASCOT algorithm. The search results were further evaluated with the open-source TPP software (version 4.0) with stringent criteria regarding protein probability (≥0.92) and at least two peptide hits for one protein identification. The false discovery rate (FDR) of protein detection was empirically determined by searching the data set against a random IPI human database (version 3.55) with the same search parameters and TPP cutoffs. The estimated FDR of 0.99% was calculated as the

Bioinformatics Analysis

Gene Ontology (GO) information on differentially expressed proteins was acquired from the Web site UniProt (http://www. uniprot.org/). Biological function classifications and signaling pathway analysis were performed with the tools on the Database for Annotation, Visualization and Integrated Discovery (DAVID, v6.7, http://david.abcc.ncifcrf.gov/) and the Kyoto Encyclopedia of Genes and Genome (KEGG) database (http://www.genome.jp/kegg/pathway.html), respectively. Quantitative Real-Time Polymerase Chain Reaction

Cells were harvested and subjected to RNA extraction (Trizol, Invitrogen) followed by cDNA synthesis with a random hexamer as the RT primer with reverse transcriptase (Superscript III, Invitrogen). Quantitative PCR was performed by use of SYBR (Yeastern Biotech, Taipei, Taiwan) and a real-time thermocycler (iQ5, Bio-Rad, Taipei, Taiwan). The experiments were repeated at least three times, and mean fold changes were calculated. An endogenous control β-actin was used for the normalization. The primers used in the experiments are listed in Table 2. Determination of Cell Viability and Death

Cell viability was evaluated with the 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Briefly, cells were plated in 96-well plates and cultured for the indicated time intervals. After culture, MTT solution (0.5 mg/mL, Sigma− Aldrich) was added and the cells were incubated at 37 °C for 1.5 h. The supernatant was aspirated, cells were treated with dimethyl sulfoxide (100 μL), and absorbance was measured at 540 nm on a SpectraMax M2 (Molecular Devices). Cell death was assayed with annexin V/propidium iodide (PI) staining [annexin V−fluorescein isothiocyanate (FITC) apoptosis detection kit; BioVision, Milpitas, CA] according to the manufacturer’s instructions. Briefly, 3 × 105 cells were washed with phosphate-buffered saline (PBS), then resuspended in 500 μL of binding buffer and incubated with 5 μL of PI and 5 μL of annexin V−FITC for 5 min in the dark at room temperature. The cells were immediately analyzed by flow cytometry (Becton Dickinson FACScan system, Mountain View, CA). D



Article

1 member C3 (AKR1C3)] of the 34 differentially expressed proteins were assessed in the two single stable clones used in iTRAQ experiments with Western blotting. The consistency between Western blotting and MS-based quantitative results supports the theory that the iTRAQ strategy represents a reliable and feasible method to analyze differentially expressed protein profiles in G6PD-knockdown cells (Figure 3A). In addition, we compared mRNA levels of the 15 proteins (including 11 upregulated and four downregulated proteins) between the two single clones with qPCR analysis. As shown in Table 2, mRNA levels of EPHX1, AKR1C3, FKBP4, and TGM2 were decreased and those of PIG3, TAGLN2, FSCN1, AKR1C10, CYCS, ACTR3, TNFAIP2, PDIA4, and HDLBP were increased in G6PD knockdown cells compared with control cells, in which mRNA fold changes were positively correlated to the iTRAQ quantitative ratios. However, the mRNA fold changes of NCAPD2 and EHD1 did not correlate with the iTRAQ ratios. To ensure that the probability for identification of candidates potentially affected by G6PD knockdown was irrespective of the cell clone background, protein and mRNA levels of those candidates were also assessed in mixed clones. Compared with mixed-clone control cells, the protein levels of EPHX1 and AKR1C3 were decreased in G6PD-knockdown cells (Figure 3A). mRNA levels of EPHX1, AKR1C3, and FKBP4 were decreased and those of PIG3, TAGLN2, CYCS, ACTR3, TNFAIP2, and PDIA4 were increased in G6PD knockdown cells, compared with the control cells (Table 2). These results confirmed the trend reported by the iTRAQ experiments (Table 1). However, in the comparison between G6PD knockdown and control mixed clones, the fold changes of TGM2, FSCN1, AKR1C10, NCAPD2, EHD1, and HDLBP mRNA did not correlate with the iTRAQ ratios.

Figure 1. Generation of G6PD-knockdown A549 cell clone. (A) Protein extracts (50 μg) of G6PD-knockdown A549 (G6PD-kd) and control (Ctrl) clones were used to measure G6PD activities. Results were expressed as mean values ± SD from three independent experiments. (B) Equal amounts of proteins from G6PD-kd and Ctrl cells were applied individually to Western blot analysis with G6PD antibodies. β-Actin was used as a loading control. Numbers represent relative fold differences of protein levels on the basis of densitometer quantitation.

Ontological and Biological Process Network Analysis of iTRAQ Candidates

Gene ontological analysis of these 34 proteins highlighted the seven (CTSD, CSTB, ANXA1, TGM2, ANXA4, FSCN1, and CYCS), five (G6PD, COASY, LDHA, AKR1B10, and TALDO1), four (TP53I3, FEBP1, PDIA4, and PNPT1), three (AKR1C2, EHD1, and HDLBP), and three (EPHX1, ALDH1A1, and AKR1C3) proteins that reportedly contribute to cell death, energy metabolism, redox homeostasis, lipid metabolism, and xenobiotic metabolism, respectively (Table 1). To clarify the potential biological processes involving G6PD, the differentially expressed proteins identified in either iTRAQ experiment (Figure 2C) were further uploaded into DAVID v6.7 and analyzed for enrichment of categories belonging to biological processes. As shown in Table 3, the analysis revealed that the differentially expressed proteins are highly correlated with metabolism of energy (citrate cycle, glycolysis/gluconeogenesis, and metabolism of pyruvate, propanoate, and butanoate), protein (proteasome and ribosome), glutathione, and xenobiotics. The processes listed were most consistent with the previous finding that G6PD is involved in energy metabolism42 and cells with G6PD deficiency are susceptible to oxidant-induced death.2,3 Among the enriched processes (Table 3), xenobiotic metabolism was selected for further study, because it was also highlighted in the gene ontological analysis (Table 1) and has not been previously correlated with G6PD.

number of reverse proteins divided by the number of forward proteins. Using this approach, we identified 1191 nonredundant proteins and quantified 1016 of them in experiment 1 (Figure 2B; Table S1 in Supporting Information). Smaller numbers of proteins were identified (690) and quantified (596) in experiment 2 (Figure 2B; Table S2 in Supporting Information). Among the quantified proteins, 495 proteins were identified in both experiments (Figure 2B). The considerable candidates included 233 and 128 differentially expressed proteins, identified in experiments 1 and 2, respectively (Figure 2C). To maximize the possibility that the proteome-wide changes actually resulted from G6PD depletion, only the proteins differentially displayed in both analyses were considered as potential candidates that were differentially expressed in G6PDknockdown cells. On this basis, 14 proteins with higher expression levels and 20 proteins, including G6PD itself, with lower expression levels in the knockdown cells were consistently shown in two experimental replicates (Figure 2C and Table 1). Verification of Proteins Differentially Expressed in G6PD-Knockdown A549 Cells

To confirm that MS-based quantitative information reflects the protein expression levels in vivo, the expression levels of two [epoxide hydrolase 1 (EPHX1) and aldo-keto reductase family E



Article

Figure 2. Identification of differentially expressed proteins in G6PD-knockdown cells. (A) Schematic diagram showing the workflow designed for profiling of the G6PD-affected proteins by iTRAQ-based analysis. The cell extracts were individually harvested from a control (Ctrl) and a G6PDknockdown (G6PD-kd) cell clone. These protein extracts were trypsin-digested, and the resulting peptides from each sample were labeled with corresponding iTRAQ reporters in parallel. The iTRAQ-labeled peptides were then pooled and applied to the first reversed-phase liquid chromatography (RPLC) for fractionation, followed by the second RPLC for further separation. The peptide identities and intensities were analyzed by LTQ-Orbitrap MS in PQD mode. Data analyses were then performed with the PeptideProphet, ProteinProphet, and Libra programs in the Trans-Proteomic Pipeline by use of the MASCOT algorithm as the search engine. As indicated, the iTRAQ experiment was conducted in duplicate (shown as Exp 1 and Exp 2). (B) Number of proteins identified or quantified in two iTRAQ-based experiments. Venn diagrams show overlap between proteins identified or quantified in the two experiments. The total number of proteins identified or quantified in each experiment is listed in parentheses. (C) Number of proteins identified to be up- or downregulated in two iTRAQ-based experiments. Venn diagrams show overlap between proteins up- or downregulated in the two experiments. The total number of proteins up- or downregulated in each experiment is listed in parentheses.

Association of G6PD with Expression Levels of Affected Proteins Involved in Xenobiotic Metabolism

Protective Role of G6PD in Aflatoxin B1 (AFB1) Induced Cytotoxicity

To further substantiate the effect of G6PD knockdown on the levels of the affected proteins EPHX1 and AKR1C3, which are involved in xenobiotic metabolism (Table 3), we examined their expression levels in A549 cells that had been infected with recombinant shRNA lentivirus for G6PD transient knockdown. As shown in Figure 3B,C, shRNA-mediated depletion of G6PD caused reduced protein and mRNA levels of EPHX1 (0.72- and 0.74-fold, respectively) and AKR1C3 (0.75- and 0.64-fold, respectively) as compared to the controls, indicating that transient knockdown of G6PD led to downregulation of the two proteins. To reinforce the G6PD effect, we next examined whether reintroduction of G6PD into its knockdown cell clone was able to restore G6PD function in relation to the protein levels of the affected proteins. As shown in Figure 3D, ectopically expressed G6PD in the knockdown cells was able to mitigate the dysregulated expression of EPHX1 and AKR1C3. The data collectively demonstrated a role of G6PD in regulating the expression levels of EPHX1 and AKR1C3. Based on the fact that G6PD has not been characterized as the expression regulator of the two proteins, the results suggest that dysregulation of the network xenobiotic metabolism likely arose as a consequence of altered EPHX1 and AKR1C3 expression affected by G6PD knockdown.

EPHX1 is crucial for metabolism and detoxification of xenobiotics due to its extraordinarily wide substrate selectivity and prominent expression in the liver and other metabolizing organs, assuring effective defense against potential genotoxic epoxides.43 EPHX1 presents a high capacity for detoxifying genotoxic metabolite of aflatoxin B1 (AFB1), a mycotoxin widely found as a cereal contaminant.43,44 The results that G6PD affected the expression level of EPHX1 prompted us to evaluate whether G6PD knockdown affected survival or death of cells treated with AFB1. As shown in Figure 4A, cell viabilities between the tested A549 cell clones were similar within the first 24 h post-AFB1 treatment. The G6PDknockdown cells showed statistical reduction of cell survival at 48 and 72 h compared to the control cells. Accordingly, the cell death rate of G6PD-knockdown cells was significantly augmented after AFB1 treatment, compared with control cells (Figure 4B). The results suggest that G6PD may perform a protective role in AFB1-induced cytotoxicity via regulation of EPHX1 expression. Verification of EPHX1 Expression in G6PD-Knockdown Hep G2 Cells

To exclude the possibility that the previous findings concerning the effect of G6PD knockdown are cell-type-specific, we generated G6PD-knockdown clone in a liver cancer cell line, Hep G2, since the liver is clearly the principal target organ for F



Article

Table 1. List of Differentially Expressed Proteins in G6PD-Knockdown A549 Cells Identified in both Experiments 1 and 2a iTRAQ ratio (G6PD-kd/ Ctrl) accession no.

protein name (gene name)

exp 1

exp 2

no. of identified peptides

no. of spectra for protein quantification

exp 1 exp 2

exp 1

exp 2

GO biological process categoryb

Downregulated isoform long of glucose-6-phosphate 1-dehydrogenase 0.11 (G6PD) aldo-keto reductase family 1 member C2 (AKR1C2) 0.60 importin-7 (IPO7) 0.79 epoxide hydrolase 1 (EPHX1) 0.62

Proteins 0.27 24

7

139

73

carbohydrate metabolism

0.65 0.56 0.54

2 7 8

3 4 2

6 17 34

11 4 12

cathepsin D (CTSD) cystatin-B (CSTB) transferrin receptor protein 1 (TFRC) serpin H1 (SERPINH1) isoform 1 of bifunctional coenzyme A synthase (COASY) isoform 2 of WD repeat-containing protein 1 (WDR1) isoform 1 of L-lactate dehydrogenase A chain (LDHA) retinal dehydrogenase 1 (ALDH1A1) annexin A1 (ANXA1)

0.75 0.61 0.83 0.67 0.75

0.66 0.75 0.62 0.74 0.75

7 2 3 5 3

2 2 2 4 3

11 3 10 6 11

8 4 6 7 7

lipid and steroid metabolism protein transport xenobiotics metabolism and detoxification cell death and proteolysis cell death/apoptosis cellular iron ion homeostasis stress response pantothenate metabolic process

0.79

0.75

6

3

15

14

0.76 0.80 0.82

0.75 0.66 0.53

21 14 17

13 15 13

304 169 182

147 79 87

0.44 0.80 0.81

0.54 0.72 0.75

4 3 4

2 2 2

12 6 8

4 3 10

0.62 0.27

0.51 0.42

10 4

2 9

52 6

4 24

IPI00793199.1 IPI00843975.1

FK506-binding protein 4 (FKBP4) phosphatidylethanolamine-binding protein 1 (FEBP1) activated RNA polymerase II transcriptional coactivator p15 (SUB1) aldo-keto reductase family 1 member C3 (AKR1C3) isoform 1 of protein-glutamine γ-glutamyltransferase 2 (TGM2) annexin IV (ANXA4) ezrin (EZR)

0.74 0.83

0.59 0.66

7 9

5 4

25 24

5 11

IPI00009904.1 IPI00017184.2

protein disulfide-isomerase A4 (PDIA4) EH domain-containing protein 1 (EHD1)

9 5

5 4

38 12

14 6

IPI00022228.2 IPI00028091.3 IPI00105407.1 IPI00163187.10 IPI00299524.1 IPI00304866.4

vigilin (HDLBP) actin-related protein 3 (ACTR3) aldo-keto reductase family 1 member B10 (AKR1B10) fascin (FSCN1) condensin complex subunit 1 (NCAPD2) tumor necrosis factor, α-induced protein 2 (TNFAIP2) isoform 1 of putative quinone oxidoreductase (TP53I3) cytoplasmic dynein 1 heavy chain 1 (DYNC1H1) cytochrome c (CYCS) transgelin-2 (TAGLN2) transaldolase (TALDO1) polyribonucleotide nucleotidyltransferase 1, mitochondrial (PNPT1)

IPI00216008.4 IPI00005668.4 IPI00007402.3 IPI00009896.1 IPI00011229.1 IPI00021828.1 IPI00022462.2 IPI00032140.4 IPI00184821.1 IPI00216256.3 IPI00217966.7 IPI00218914.5 IPI00218918.5 IPI00219005.3 IPI00219446.5 IPI00221222.7 IPI00291483.3 IPI00294578.1

IPI00384643.2 IPI00456969.1 IPI00465315.6 IPI00550363.3 IPI00744692.1 IPI00744711.2

Upregulated Proteins 1.35 1.59 1.56 1.74 1.30 1.38 1.64 1.52 1.42 1.50

1.44 1.39 1.40 1.85 1.39 2.53

6 4 22 5 9 3

4 2 9 2 4 2

16 8 187 11 21 4

8 6 48 3 6 6

1.94

2.28

5

3

24

9

1.28 1.55 1.55 1.27 1.25

1.47 1.75 1.85 1.45 1.51

37 5 15 8 3

22 2 10 2 2

80 23 121 29 8

44 9 74 8 6

platelet activation glycolysis (metabolism) xenobiotic metabolic process cell death/apoptosis and inflammatory protein folding response to oxidative stress and toxin transcription regulation xenobiotics metabolism cell death/apoptosis and inflammatory antiapoptosis cytoskeletal anchoring at plasma membrane cell redox homeostasis cholesterol homeostasis and endocytic recycling cholesterol metabolism cilium biogenesis/degradation cellular aldehyde metabolic process cell proliferation and migration cell cycle and division angiogenesis and cell differentiation NADP metabolic process vesicle transport apoptosis and respiratory chain muscle organ development pentose shunt cellular response to oxidative stress

a

Each protein listed in the table has ProteinProphet probability exp 1/exp 2 = 1.00/1.00. bFunctional classification of the dysregulated proteins as revealed by annotation in the biological process categories of Gene Ontology (GO).

AFB1. Enzyme activity assay and Western blotting analysis revealed the efficiency of G6PD knockdown in Hep G2 cells (Figure 5A,B). We next examined the functional consequence of G6PD knockdown by validating the levels of EPHX1 and AKR1C3. As shown in Figure 5B and C (left panel), depletion of G6PD caused reduced protein and mRNA levels of EPHX1 (0.42- and 0.68-fold, respectively) and AKR1C3 (0.34- and 0.72-fold, respectively) as compared to the control Hep G2 cells. The mRNA levels of EPHX1 and AKR1C3 (0.56- and 0.36-fold, respectively) also decreased in Hep G2 cells with

shRNA lentivirus-mediated transient knockdown of G6PD, compared with controls (Figure 5C, right panel). More importantly, G6PD-knockdown Hep G2 cells showed significant reduction of cell survival at 24 and 48 h compared to control cells (Figure 5D), supporting the protective role of G6PD in AFB1-mediated cell death. G



Article

Figure 3. Validation of protein levels of selected candidates discovered by iTRAQ in G6PD-knockdown A549 cells. (A) Protein lysates individually collected from G6PD-knockdown (G6PD-kd) single and mixed A549 cell clones. (B) Protein extracts were individually harvested from A549 cells, which have been infected with lentivirus containing G6PD shRNA (G6PD-transient kd) or scramble control shRNA (Scramble Ctrl) for 72 h. (C) Relative mRNA levels of EPHX1 and AKR1C3 in G6PD knockdown cells. Total RNA from A549 cells infected with lentivirus containing G6PD shRNA or scramble control shRNA for 72 h was purified and reverse-transcribed, and the resultant cDNA was subjected to qPCR analysis with genespecific primers. Fold change of the mRNA level for each protein in G6PD-knockdown cells was calculated as a ratio relative to control cells. Results were expressed as mean values ± SD from four independent experiments (*P < 0.05; paired t-test). (D) G6PD-kd single clone was pretransfected with plasmids encoding G6PD (G6PD re-expression). The extracts were then analyzed by Western blot with antibodies as indicated. β-actin was used as a loading control. Numbers represent relative fold differences of protein levels on the basis of densitometer quantitation.

G6PD Activity Is Required for ROS-Mediated EPHX1 Production

Nuclear translocation of Nrf2 is principally dependent on oxidative insult.49,50 After AFB1 treatment, the nuclear Nrf2 levels were not increased in the G6PD-knockdown cells, indicating that induction of ROS post-AFB1 treatment is defective in those cells. On this basis, we monitored the cellular superoxide level with the redox indicator dihydroethidium (DHE). As shown in Figure 6B, the levels of cellular superoxide were obviously elevated in the control A549 cells after AFB1 treatment. With the same treatment, however, superoxide generation in G6PD-deficient cells was not significantly increased, suggesting that nuclear Nrf2 translocation may be impaired by G6PD-mediated reduced induction of cellular superoxide.

According to previous reports, hepatic EPHX1 expression is downregulated in nuclear factor erythroid-2-related factor 2 (Nrf2) null mice.45−47 Nrf2, a transcription factor, mediates induction of defensive genes in response to oxidative/ electrophilic stress. Upon oxidative/electrophilic stimuli, Nrf2 translocates into the nucleus, binds to antioxidant responsive elements (ARE), and promotes expression of cytoprotective genes.45−47 In addition, the EPHX1 promoter also contains a putative binding site for Nrf2 on the ARE.48 To further evaluate whether Nrf2 is involved in G6PD-mediated downregulation of EPHX1, we detected Nrf2 levels in nuclear fractions. We hypothesized that nuclear transport of Nrf2 is attenuated in G6PD-knockdown cells, leading to reduced expressions of EPHX1. As shown in Figure 6A, Nrf2 was translocated to the nucleus upon AFB1 treatment in A549 cells. Nrf2 was slightly reduced in the nuclear fraction of the G6PD-knockdown cells compared to that of control cells. Notably, the levels of nuclear Nrf2 in the G6PD-knockdown cells were not altered in response to AFB1 treatment (Figure 6A).

■

DISCUSSION Using iTRAQ-based proteomics analysis, we have demonstrated for the first time that even without exogenous oxidant challenge, inhibition of G6PD expression led to a global change in cellular protein levels (Figure 2 and Table 1). Networks regulating cellular lipid homeostasis, cell death, energy metabolism, and redox homeostasis are linked to a group of H



Article

Table 2. mRNA Expression Level of Differentially Expressed Proteins in G6PD-Knockdown A549 Cells mRNA expression ratio (SD) of G6PD-kd/Ctrl cellsa gene name

single-clone cells

primer sets for qRT-PCR analysis of target genes

mixed-clone cells

EPHX1 AKR1C3 FKBP4 TGM2

0.37 0.67 0.37 0.55

(0.09) (0.03) (0.05) (0.13)

0.79 0.71 0.80 1.13

(0.12) (0.24) (0.12) (0.32)

PIG3 TAGLN2 FSCN1 AKR1C10 NCAPD2 CYCS EHD1 ACTR3 TNFAIP2 PDIA4 HDLBP

1.73 1.29 1.68 1.28 0.61 1.61 1.03 1.78 1.30 1.75 1.39

(0.29) (0.15) (0.28) (0.05) (0.07) (0.55) (0.01) (0.65) (0.33) (0.25) (0.57)

1.41 1.22 0.97 0.80 0.72 1.21 1.12 1.72 1.58 1.42 1.12

(0.07) (0.16) (0.23) (0.08) (0.11) (0.21) (0.02) (0.49) (0.11) (0.35) (0.12)

sense primer (5′ to 3′)

antisense primer (5′ to 3′)

Downregulated Proteins ATCTCCACCTGCTTCTTCC GCTTTGCCTGATGTCTAC GGTAGAAGAGGCAAGTGGTAG GAGAGGTGTGATCTGGAG Upregulated Proteins TGGTCGATGGGTTCTCTATG GAGAAGCATACTTGTAGAAGC ACCGCCTCCAGCAAGAATG ACCAGCCTGTCTCTACTAAC TGAACTGTTATGCTCTGATAC GCTGGCACAACGAACACTC TCTTCAAGGACATCCAGTC ATCCCTTCCTGTATTGCTATTAAG GTGATGCTGAAGATGATGAC CATCAAGGACTTCGTGCTGA GGCAATTCATTGCAGGAGAT

TCCACGACTTACACCAGAG AGAGGTGATATGTCCAGTC TGGGAGAGGGAAAGGATGAG ACTGAAGGTGAGACTGTC TCTTCTCCAGGTTTGCTCT GTGTCCTCCGTTCATTCC GCCATTGGACGCCCTCAG TCACTACAACCTCTGTCTCC ACGGATGTCCAACTGAAG GCGGAGCGAGTTTGGTTG TTGAGGGAGCTGATGATG TCACTTGCTCCATAAACCTTTC TCTGATGTGGACTGCAAC TTCACCTCCCCAGCATAGTC GACAGAGGAGACGGTGAAGC

Target gene expression was analyzed by quantitative RT-PCR with the mRNA level of β-actin as internal control. Expression of target genes in Ctrl cells was defined as 1.0, and other values were normalized accordingly. a

Table 3. Pathway Analysis of Differentially Expressed Proteins in G6PD-Knockdown A549 Cells term in KEGG pathwaya pyruvate metabolism proteasome ribosome propanoate metabolism xenobiotic metabolism spliceosome

citrate cycle (TCA cycle) glycolysis/ gluconeogenesis butanoate metabolism glutathione metabolism

identified proteins involved in pathway

p value

MDH2, LDHA, ACACA, ALDH1B1, ME1, ALDH9A1, ACAT2, DLD, and LDHB PSMD7, PSMC1, PSMD13, PSME3, PSMA5, PSMD11, PSMB4, PSMA6, and PSME1 FAU, RPL3, RPS10, RPS21, RPL27, RPS9, RPL8, RPL24, RPL18, RPL15, and RPS15A LDHA, ACACA, ALDH1B1, HADHA, ALDH9A1, ACAT2, and LDHB AKR1C2, GSTA5, EPHX1, AKR1C3, MGST1, and ALDH1A1 SNRNP200, USP39, PRPF8, BUD31, RBM25, SNRPF, HNRNPA3, DDX39B, SF3B1, HSPA1, RBMX, and CDC5L ACLY, ACO1, MDH2, IDH1, DLST, and DLD PFKP, LDHA, ALDH1B1, ALDH9A1, HK1, DLD, and LDHB AKR1B10, HMGCS1, ALDH1B1, HADHA, ALDH9A1, and ACAT2 G6PD, GSTA5, IDH1, GSR, ANPEP, MGST1, and RRM1

2.63 × 10−5 8.92 × 10−5 3.56 × 10−4 4.06 × 10−4 7.40 × 10−4 1.89 × 10−3 2.54 × 10−3 2.54 × 10−3 3.85 × 10−3 4.46 × 10−3

a

The Database for Annotation, Visualization, and Integrated Discovery (DAVID) was applied to functionally annotate enriched proteins. The knowledge base used was the KEGG pathway database. Processes with at least five protein members and p-values less than 0.01 were considered significant. Figure 4. G6PD deficiency augments AFB1-induced cell death. (A) G6PD-knockdown (G6PD-kd) and control (Ctrl) A549 cells were treated with 25 μM (left panel) or 50 μM (right panel) AFB1 for the indicated time intervals. Cell viabilities were evaluated with MTT assay and calculated as a ratio relative to cells without AFB1 treatment. Results were expressed as mean values ± SD from four independent experiments (*P < 0.01; paired t-test). (B) Cell death was monitored with annexin V/PI staining. Either annexin V- or PI-positive cells are classified as dead cells. Results were expressed as mean values ± SD from three independent experiments (*P < 0.01; paired t-test).

proteins with altered protein levels. In addition to these wellrecognized functions of G6PD in cellular redox homeostasis and energy metabolism, we herein further demonstrate that G6PD plays a role in modulating AFB1 metabolism/ detoxification (Tables 1 and 3). The ratios of affected proteins revealed by iTRAQ quantification varied between experiments 1 and 2 (Table 1). In general, quantification variations are ascribable to technical, biological, and experimental effects.51 Experiments 1 and 2 were conducted with identical samples in two independent mass I



Article

Figure 5. Evaluation of EPHX1 expression and AFB1-induced death in G6PD-knockdown Hep G2 cells. (A) Protein extracts (50 μg) of G6PDknockdown Hep G2 (G6PD-kd) and control (Ctrl) clones were used to measure G6PD activities. Results were expressed as mean values ± SD from three independent experiments. (B) Protein lysates individually collected from G6PD-kd and Ctrl Hep G2 cell clones were analyzed by Western blot with antibodies as indicated. β-Actin was used as a loading control. Numbers represent relative fold differences of protein levels on the basis of densitometer quantitation. (C) Relative mRNA levels of EPHX1 and AKR1C3 in G6PD-knockdown clone (left panel) or Hep G2 cells infected with lentivirus containing G6PD shRNA (right panel) were determined by qPCR analysis. Fold change of mRNA level for each protein in G6PDknockdown cells was calculated as a ratio relative to its own control. Results were expressed as mean values ± SD from four independent experiments (*P < 0.05; paired t-test). (D) G6PD-kd and Ctrl Hep G2 clones were treated with 6.25 μM (left), 12.5 μM (middle), or 25 μM (right) AFB1 for the indicated time intervals. Cell viabilities were evaluated with MTT assay and calculated as a ratio relative to cells without AFB1 treatment. Results were expressed as mean values ± SD from four independent experiments (*P < 0.01; paired t-test).

spectrometer runs (Figure 2A), indicating that the measurable deviations mainly are due to experimental variations. We believe that the PQD application is the major cause of experimental effects. Although the PQD mode was developed to assist in detecting low-mass reporter ions via iTRAQ or TMT on LTQ platforms, the use of PQD in quantitative proteomics is limited, primarily due to the scanty reproducibility of reporter ion ratios.52,53 To allow accurate protein quantification with iTRAQ on LTQ platforms, an applicable strategy is needed. For instance, a scan configuration combining collision-induced dissociation (CID) with higher-energy colli-

sional dissociation (HCD) has been developed recently to improve measurement of iTRAQ-labeled samples on newly launched LTQ platforms.54,55 With properly designed experiments, users can rely on iTRAQ-reported trends. For that matter, we first confirmed the levels of selected proteins in the stable clones (Table 2 and Figure 3A) and then observed the effect of G6PD transient knockdown on selected protein expression (Figure 3B,C). Finally, we conducted experiments reintroducing G6PD expression in knockdown cells to restore its function in relation to the relevant protein expression (Figure 3D). In short, we used combinatorial approaches to J



Article

Figure 7. Model depicting the protective role of G6PD in AFB1mediated cytotoxicity. AFB1 treatment induces cytotoxicity via production of AFB1−DNA adducts. Physiologically, stimulus by low level of AFB1 causes cellular ROS production via oxidation of NADPH, the product in the pentose phosphate pathway catalyzed by G6PD. The induced ROS accordingly leads to Nrf2 nuclear translocation and expression of EPHX1, an enzyme involved in detoxification of AFB1. G6PD knockdown results in reduced generation of cellular NADPH, thereby causing impairment of AFB1-induced ROS production. Consequently, EPHX1 expression is less active in G6PD-depletion cells, suggesting a protective role of G6PD upon AFB1-inducible cytotoxicity.

Figure 6. Impairment of nuclear Nrf2 translocation by G6PD knockdown. (A) Nuclear localization of Nrf2 was assessed immunochemically by using Nrf2-specific antibody in A549 cells treated with AFB1. Each lane contained 20 or 50 μg of nuclear extracts or whole cell extracts, respectively. Equal protein loading of nuclear extracts was verified by histone H3 and lamin A/C immunoblotting. Numbers represent relative fold differences of protein levels on the basis of densitometer quantitation. (B) Superoxide level was monitored with DHE and flow cytometry in A549 cells treated with 50 μM AFB1 for the indicated time intervals. Fold superoxide induction in the AFB1-treated cells was calculated as a ratio relative to their own controls. Results were expressed as mean values ± SD from four independent experiments (*P < 0.01; paired t-test).

with elevated levels of serum AFB1 adducts and increases sensitivity to toxic effects of 1,3-butadiene in exposed workers.59,60 This polymorphism is significantly overrepresented among patients with liver cancers, indicating that individuals with the low-level EPHX1 may be at greater risk of developing liver cancer when exposed to AFB1.60 It is suspected that G6PD may be functionally linked to Nrf2 via ROS production. Under physiological conditions, Nrf2 is bound to its cytoplasmic repressor Keap1, which in turn aids in the ubiquitination and subsequent degradation of Nrf2.46,49 Modification of Keap1 by ROS can impede Keap1 binding to Nrf2 and thereby allow Nrf2 translocation into the nucleus to activate gene expression.46,49 Alternatively, it is possible that G6PD may have a direct regulatory yet undefined effect on Nrf2 (Figure 7). Further efforts will be made to investigate the detailed molecular basis underlying the interplay of G6PD with Nrf2. AFB1 is the most prevalent and carcinogenic of the aflatoxins, toxic metabolites principally produced by Aspergillus flavus and Aspergillus parasiticus. The major risk factors of hepatocellular carcinomas are hepatitis B infection and ingestion of foods contaminated with aflatoxins.44,61 Interestingly, we have found that in male patients with liver disorders, a higher prevalence of G6PD deficiency (5%) has been observed as compared to the incidence among the general male population in Taiwan (3%, unpublished observation). Although the liver is clearly the principal target organ for AFB1, the lung can also be a target following dietary and inhalational exposure. Both epidemiological and laboratory evidence strongly support a role for AFB1 in the induction of human lung cancer.44,62,63 However, it has been reported that elevated G6PD activities have been found in various human cancers, including gastric cancer,64 breast cancer,65 bladder cancer,66 lung cancer,67 and renal cell carcinoma.68 In this study, we have conducted the experiments in lung and liver cancer cells (A549 and Hep G2, respectively)

clearly demonstrate that G6PD indeed affected the levels of proteins initially selected by iTRAQ quantification. The mechanism underlying how G6PD reduces cytotoxicity of AFB1 awaits in-depth clarification. However, a possible mechanism could be attributed to G6PD-catalyzed generation of NADPH (Figure 7). AFB1 treatment induces cytotoxicity (Figures 4 and 5) mainly by forming AFB1−DNA adducts.44,56 Stimulus with low level of AFB1 causes a cellular adaptive response via the oxidation of NADPH to generate ROS as a signaling molecule.57 The induced ROS accordingly leads to nuclear translocation of Nrf2 (Figure 6A) and expression of EPHX1, an enzyme involved in detoxification of AFB1 (Figure 7). G6PD knockdown results in reduced generation of cellular NADPH, thereby causing impairment of AFB1-induced ROS production (Figure 6B). Consequently, EPHX1 expression is less active in G6PD-depletion cells (Figures 3 and 5B), suggesting a protective role of G6PD against AFB1-inducible cytotoxicity (Figure 7). Although the downregulation of EPHX1 expression is up to 50% in the G6PD-depletion cells, the cells are apparently more susceptible to AFB1-inducible toxicity. Previously, the Tyr/His 113 polymorphism of EPHX1 has been described. Substitution of His 113 for the more commonly occurring Tyr 113 residue reduces the amount of EPHX1 protein, and consequently its activity, by 50%.58 Importantly, this polymorphism is associated K



■

to reveal the protective role of G6PD in AFB1-inducible cytotoxicity, which may be useful to address the roles of G6PD in carcinogenesis and/or tumorigenesis. Apart from xenobiotic metabolism, network analysis based on dysregulated proteins in G6PD-knockdown cells is consistent with the conventional paradigm that G6PD plays roles in GSH and lipid metabolism (Tables 1 and 3). Hydroperoxide reduction is catalyzed by GSH peroxidase with coexistent oxidation of GSH to GSSG, which could be reduced by glutathione reductase (GSR) in the presence of NADPH. This highlights the role of G6PD, as the NADPHproducing enzyme, in cellular homeostasis of GSH. We have demonstrated that G6PD-deficient Hep G2 cells are more susceptible to diamide-induced oxidative damage due to ineffective GSH regeneration in these cells.18 Moreover, the levels of GSR and glutathione S-transferases A5 (GSTA5), which catalyze reaction of GSH with various exo- and endogenous chemicals, are shown to be dysregulated in G6PD-knockdown A549 cells (Table 3), indicating that the altered GSH metabolism may result from G6PD-mediated expression regulation of enzymes involved in GSH generation. NADPH also contributes to the synthesis of fatty acids and cholesterol by providing the required reducing power,69 suggesting involvement of G6PD in lipid or cholesterol metabolism. Consistent with our ontology analysis (Table 1), it has been reported that G6PD-deficient patients show a decrease in lipogenic rate and serum lipoprotein levels, implying the importance of G6PD in lipid metabolism.70 Park et al.71 have displayed that G6PD plays a role in adipogenesis and that its increase is tightly associated with the dysregulation of lipid metabolism. G6PD knockdown in 3T3-L1 cells attenuated adipocyte differentiation with less lipid droplet accumulation. How G6PD participates in regulating lipid biosynthesis should be clearly defined. Glucose is catabolized in cells via two routes, glycolysis and hexose monophosphate shunt. In addition to NADPH, the hexose monophosphate shunt produces the essential nucleotide component ribose 5-phosphate (R5P).1 However, R5P can be also converted from glycolytic intermediates such as fructose 6phosphate and glyceraldehyde 3-phosphate by the enzymes transketolase and transaldolase in cells,72 suggesting that glycolysis pathway should be activated in G6PD-knockdown cells to generate R5P. Indeed, we find that the protein levels of transaldolase are elevated in G6PD-knockdown cells compared with control cells (Table 1). The pathways involved in glucose metabolism (pyruvate metabolism, citrate cycle, and glycolysis) are dysregulated in G6PD-knockdown cells (Table 3). The observations herein can be strengthened by experiments revealing that G6PD activity is dispensable in pentose phosphate synthesis or proliferation but is crucial only in protection against oxidative stress.73,74 In conclusion, we discover that G6PD is involved in metabolism of xenobiotics, GSH, cellular energy, and lipids in aspects of a proteome-wide effect on protein expression and function. We also reveal a protective role of G6PD in AFB1induced cytotoxicity via providing NADPH for induction of EPHX1, a xenobiotic metabolizing enzyme. Since G6PD is ubiquitously expressed in human tissues, this study will provide new avenues for exploring the roles of G6PD in normal cellular physiology and diseases, particularly that are associated with lipid abnormalities, AFB1-induced damage, and metabolic syndrome.

Article

ASSOCIATED CONTENT

* Supporting Information S

Two tables listing all identified proteins and quantified peptides in iTRAQ measurements in experiments 1 and 2, respectively. This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author

*C.-C.W.: Phone 886-3-2118800, ext 5093; fax 886-3-2118449; e-mail [email protected]. M.-L.C.: Phone 886-32118800, ext 3650; fax 886-3-2118449; e-mail chengm@mail. cgu.edu.tw. D.T.-Y.C.: Phone 886-3-2118800, ext 5097; fax 886-3-2118449; e-mail [email protected]. Author Contributions ▼

H.-R.L. and C.-C.W. contributed equally to this paper.

Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS The work was supported by grants to Chang Gung University from the Ministry of Education, Taiwan (EMRPD1C0021 and EMRPD1B0321), a grant to C.-C.W. from the National Science Council, Taiwan (NSC 101-2325-B-182-014), and grants to D.T.-Y.C. from Chang Gung Memorial Hospital (CMRPD190423 and CMRPD1B0331) and the National Science Council, Taiwan (Grant NSC 100-2320-B-182-010MY3).

■

ABBREVIATIONS AFB1, aflatoxin B1; AKR1C3, aldo-keto reductase family 1 member C3; ARE, antioxidant responsive element; DAVID, Database for Annotation, Visualization and Integrated Discovery; DHE, dihydroethidium; EGTA, ethylene glycol bis(βaminoethyl ether)-N,N,N′,N′-tetraacetic acid; EPHX1, epoxide hydrolase 1; ESI, electrospray ionization; G6PD, glucose-6phosphate dehydrogenase; GSH, glutathione; GSR, glutathione reductase; GSSG, glutathione disulfide; GSTA5, glutathione Stransferases A5; iTRAQ, isobaric tags for relative and absolute quantification; KEGG, Kyoto Encyclopedia of Genes and Genome; MALDI-TOF MS, matrix-assisted laser desorption ionization time-of-flight mass spectrometry; NADP+/NADPH, nicotinamide adenine dinucleotide phosphate (oxidized form/ reduced form); Nrf2, nuclear factor erythroid-2-related factor 2; PQD, pulsed Q dissociation; ROS, reactive oxygen species; SDS, sodium dodecyl sulfate; TPP, Trans-Proteomic Pipeline; Tris-HCl, tris(hydroxymethyl)aminomethane hydrochloride

■

REFERENCES

(1) Miclet, E.; Stoven, V.; Michels, P. A.; Opperdoes, F. R.; Lallemand, J. Y.; Duffieux, F. NMR spectroscopic analysis of the first two steps of the pentose-phosphate pathway elucidates the role of 6phosphogluconolactonase. J. Biol. Chem. 2001, 276 (37), 34840− 34846. (2) Fico, A.; Paglialunga, F.; Cigliano, L.; Abrescia, P.; Verde, P.; Martini, G.; Iaccarino, I.; Filosa, S. Glucose-6-phosphate dehydrogenase plays a crucial role in protection from redox-stress-induced apoptosis. Cell Death Differ. 2004, 11 (8), 823−831. (3) Ho, H. Y.; Cheng, M. L.; Lu, F. J.; Chou, Y. H.; Stern, A.; Liang, C. M.; Chiu, D. T. Enhanced oxidative stress and accelerated cellular senescence in glucose-6-phosphate dehydrogenase (G6PD)-deficient human fibroblasts. Free Radical Biol. Med. 2000, 29 (2), 156−169.

L



Article

(4) Cappellini, M. D.; Fiorelli, G. Glucose-6-phosphate dehydrogenase deficiency. Lancet 2008, 371 (9606), 64−74. (5) Gurbuz, N.; Yalcin, O.; Aksu, T. A.; Baskurt, O. K. The relationship between the enzyme activity, lipid peroxidation and red blood cells deformability in hemizygous and heterozygous glucose-6phosphate dehydrogenase deficient individuals. Clin. Hemorheol. Microcirc. 2004, 31 (3), 235−242. (6) Scott, M. D.; Zuo, L.; Lubin, B. H.; Chiu, D. T. NADPH, not glutathione, status modulates oxidant sensitivity in normal and glucose-6-phosphate dehydrogenase-deficient erythrocytes. Blood 1991, 77 (9), 2059−2064. (7) Liu, T. Z.; Lin, T. F.; Hung, I. J.; Wei, J. S.; Chiu, D. T. Enhanced susceptibility of erythrocytes deficient in glucose-6-phosphate dehydrogenase to alloxan/glutathione-induced decrease in red cell deformability. Life Sci. 1994, 55 (3), PL55−PL60. (8) Cheng, M. L.; Ho, H. Y.; Wu, Y. H.; Chiu, D. T. Glucose-6phosphate dehydrogenase-deficient cells show an increased propensity for oxidant-induced senescence. Free Radical Biol. Med. 2004, 36 (5), 580−591. (9) Spencer, N. Y.; Yan, Z.; Boudreau, R. L.; Zhang, Y.; Luo, M.; Li, Q.; Tian, X.; Shah, A. M.; Davisson, R. L.; Davidson, B.; Banfi, B.; Engelhardt, J. F. Control of hepatic nuclear superoxide production by glucose 6-phosphate dehydrogenase and NADPH oxidase-4. J. Biol. Chem. 2011, 286 (11), 8977−8987. (10) Cheng, M. L.; Ho, H. Y.; Liang, C. M.; Chou, Y. H.; Stern, A.; Lu, F. J.; Chiu, D. T. Cellular glucose-6-phosphate dehydrogenase (G6PD) status modulates the effects of nitric oxide (NO) on human foreskin fibroblasts. FEBS Lett. 2000, 475 (3), 257−262. (11) Ho, H. Y.; Wei, T. T.; Cheng, M. L.; Chiu, D. T. Green tea polyphenol epigallocatechin-3-gallate protects cells against peroxynitrite-induced cytotoxicity: modulatory effect of cellular G6PD status. J. Agric. Food Chem. 2006, 54 (5), 1638−1645. (12) Lin, C. J.; Ho, H. Y.; Cheng, M. L.; You, T. H.; Yu, J. S.; Chiu, D. T. Impaired dephosphorylation renders G6PD-knockdown HepG2 cells more susceptible to H2O2-induced apoptosis. Free Radical Biol. Med. 2010, 49 (3), 361−373. (13) Tian, W. N.; Braunstein, L. D.; Pang, J.; Stuhlmeier, K. M.; Xi, Q. C.; Tian, X.; Stanton, R. C. Importance of glucose-6-phosphate dehydrogenase activity for cell growth. J. Biol. Chem. 1998, 273 (17), 10609−10617. (14) Izawa, S.; Maeda, K.; Miki, T.; Mano, J.; Inoue, Y.; Kimura, A. Importance of glucose-6-phosphate dehydrogenase in the adaptive response to hydrogen peroxide in Saccharomyces cerevisiae. Biochem. J. 1998, 330 (Pt 2), 811−817. (15) Tuttle, S. W.; Varnes, M. E.; Mitchell, J. B.; Biaglow, J. E. Sensitivity to chemical oxidants and radiation in CHO cell lines deficient in oxidative pentose cycle activity. Int. J. Radiat. Oncol. Biol. Phys. 1992, 22 (4), 671−675. (16) Tuttle, S.; Stamato, T.; Perez, M. L.; Biaglow, J. Glucose-6phosphate dehydrogenase and the oxidative pentose phosphate cycle protect cells against apoptosis induced by low doses of ionizing radiation. Radiat. Res. 2000, 153 (6), 781−787. (17) Pandolfi, P. P.; Sonati, F.; Rivi, R.; Mason, P.; Grosveld, F.; Luzzatto, L. Targeted disruption of the housekeeping gene encoding glucose 6-phosphate dehydrogenase (G6PD): G6PD is dispensable for pentose synthesis but essential for defense against oxidative stress. EMBO J. 1995, 14 (21), 5209−5215. (18) Gao, L. P.; Cheng, M. L.; Chou, H. J.; Yang, Y. H.; Ho, H. Y.; Chiu, D. T. Ineffective GSH regeneration enhances G6PD-knockdown Hep G2 cell sensitivity to diamide-induced oxidative damage. Free Radical Biol. Med. 2009, 47 (5), 529−535. (19) Alfadda, A. A.; Sallam, R. M. Reactive oxygen species in health and disease. J. Biomed. Biotechnol. 2012, 2012, No. 936486. (20) Groeger, G.; Quiney, C.; Cotter, T. G. Hydrogen peroxide as a cell-survival signaling molecule. Antioxid. Redox Signal. 2009, 11 (11), 2655−2671. (21) Marra, M.; Sordelli, I. M.; Lombardi, A.; Lamberti, M.; Tarantino, L.; Giudice, A.; Stiuso, P.; Abbruzzese, A.; Sperlongano, R.; Accardo, M.; Agresti, M.; Caraglia, M.; Sperlongano, P. Molecular

targets and oxidative stress biomarkers in hepatocellular carcinoma: an overview. J. Transl. Med. 2011, 9, 171. (22) Chen, H.; Yoshioka, H.; Kim, G. S.; Jung, J. E.; Okami, N.; Sakata, H.; Maier, C. M.; Narasimhan, P.; Goeders, C. E.; Chan, P. H. Oxidative stress in ischemic brain damage: mechanisms of cell death and potential molecular targets for neuroprotection. Antioxid. Redox Signal. 2011, 14 (8), 1505−1517. (23) Avery, S. V. Molecular targets of oxidative stress. Biochem. J. 2011, 434 (2), 201−210. (24) Serpillon, S.; Floyd, B. C.; Gupte, R. S.; George, S.; Kozicky, M.; Neito, V.; Recchia, F.; Stanley, W.; Wolin, M. S.; Gupte, S. A. Superoxide production by NAD(P)H oxidase and mitochondria is increased in genetically obese and hyperglycemic rat heart and aorta before the development of cardiac dysfunction. The role of glucose-6phosphate dehydrogenase-derived NADPH. Am. J. Physiol. Heart Circ. Physiol. 2009, 297 (1), H153−H162. (25) Tsai, K. J.; Hung, I. J.; Chow, C. K.; Stern, A.; Chao, S. S.; Chiu, D. T. Impaired production of nitric oxide, superoxide, and hydrogen peroxide in glucose 6-phosphate-dehydrogenase-deficient granulocytes. FEBS Lett. 1998, 436 (3), 411−414. (26) Guo, L.; Zhang, Z.; Green, K.; Stanton, R. C. Suppression of interleukin-1 beta-induced nitric oxide production in RINm5F cells by inhibition of glucose-6-phosphate dehydrogenase. Biochemistry 2002, 41 (50), 14726−14733. (27) Mendez, D.; Linares, M.; Diez, A.; Puyet, A.; Bautista, J. M. Stress response and cytoskeletal proteins involved in erythrocyte membrane remodeling upon Plasmodium falciparum invasion are differentially carbonylated in G6PD A- deficiency. Free Radical Biol. Med. 2011, 50 (10), 1305−1313. (28) Romero-Ruiz, A.; Mejias, R.; Diaz-Martin, J.; Lopez-Barneo, J.; Gao, L. Mesencephalic and striatal protein profiles in mice overexpressing glucose-6-phosphate dehydrogenase in dopaminergic neurons. J. Proteomics 2010, 73 (9), 1747−1757. (29) Wu, C. C.; Hsu, C. W.; Chen, C. D.; Yu, C. J.; Chang, K. P.; Tai, D. I.; Liu, H. P.; Su, W. H.; Chang, Y. S.; Yu, J. S. Candidate serological biomarkers for cancer identified from the secretomes of 23 cancer cell lines and the human protein atlas. Mol. Cell. Proteomics 2010, 9 (6), 1100−1117. (30) Yu, C. J.; Chang, K. P.; Chang, Y. J.; Hsu, C. W.; Liang, Y.; Yu, J. S.; Chi, L. M.; Chang, Y. S.; Wu, C. C. Identification of guanylatebinding protein 1 as a potential oral cancer marker involved in cell invasion using omics-based analysis. J. Proteome Res. 2011, 10 (8), 3778−3788. (31) Liu, H. P.; Wu, C. C.; Kao, H. Y.; Huang, Y. C.; Liang, Y.; Chen, C. C.; Yu, J. S.; Chang, Y. S. Proteome-wide dysregulation by PRA1 depletion delineates a role of PRA1 in lipid transport and cell migration. Mol. Cell. Proteomics 2011, 10 (3), No. M900641MCP200. (32) Wang, L. J.; Hsu, C. W.; Chen, C. C.; Liang, Y.; Chen, L. C.; Ojcius, D. M.; Tsang, N. M.; Hsueh, C.; Wu, C. C.; Chang, Y. S. Interactome-wide analysis identifies end-binding protein 1 as a crucial component for the speck-like particle formation of activated absence in melanoma 2 (AIM2) inflammasomes. Mol. Cell. Proteomics 2012, 11 (11), 1230−1244. (33) Wu, Y. H.; Tseng, C. P.; Cheng, M. L.; Ho, H. Y.; Shih, S. R.; Chiu, D. T. Glucose-6-phosphate dehydrogenase deficiency enhances human coronavirus 229E infection. J. Infect. Dis. 2008, 197 (6), 812− 816. (34) Chen, Y. T.; Chen, C. L.; Chen, H. W.; Chung, T.; Wu, C. C.; Chen, C. D.; Hsu, C. W.; Chen, M. C.; Tsui, K. H.; Chang, P. L.; Chang, Y. S.; Yu, J. S. Discovery of novel bladder cancer biomarkers by comparative urine proteomics using iTRAQ technology. J. Proteome Res. 2010, 9 (11), 5803−5815. (35) Nesvizhskii, A. I.; Vitek, O.; Aebersold, R. Analysis and validation of proteomic data generated by tandem mass spectrometry. Nat. Methods 2007, 4 (10), 787−797. (36) Mueller, L. N.; Brusniak, M. Y.; Mani, D. R.; Aebersold, R. An assessment of software solutions for the analysis of mass spectrometry based quantitative proteomics data. J. Proteome Res. 2008, 7 (1), 51− 61. M



Article

(37) Keller, A.; Nesvizhskii, A. I.; Kolker, E.; Aebersold, R. Empirical statistical model to estimate the accuracy of peptide identifications made by MS/MS and database search. Anal. Chem. 2002, 74 (20), 5383−5392. (38) Nesvizhskii, A. I.; Keller, A.; Kolker, E.; Aebersold, R. A statistical model for identifying proteins by tandem mass spectrometry. Anal. Chem. 2003, 75 (17), 4646−4658. (39) Gilar, M.; Olivova, P.; Daly, A. E.; Gebler, J. C. Orthogonality of separation in two-dimensional liquid chromatography. Anal. Chem. 2005, 77 (19), 6426−6434. (40) Motoyama, A.; Yates, J. R., 3rd. Multidimensional LC separations in shotgun proteomics. Anal. Chem. 2008, 80 (19), 7187−7193. (41) Issaq, H. J.; Chan, K. C.; Blonder, J.; Ye, X.; Veenstra, T. D. Separation, detection and quantitation of peptides by liquid chromatography and capillary electrochromatography. J. Chromatogr. A 2009, 1216 (10), 1825−1837. (42) Ho, H. Y.; Cheng, M. L.; Shiao, M. S.; Chiu, D. T. Characterization of global metabolic responses of glucose-6-phosphate dehydrogenase-deficient hepatoma cells to diamide-induced oxidative stress. Free Radical Biol. Med. 2013, 54, 71−84. (43) Decker, M.; Arand, M.; Cronin, A. Mammalian epoxide hydrolases in xenobiotic metabolism and signalling. Arch. Toxicol. 2009, 83 (4), 297−318. (44) Bedard, L. L.; Massey, T. E. Aflatoxin B1-induced DNA damage and its repair. Cancer Lett. 2006, 241 (2), 174−183. (45) Kwak, M. K.; Itoh, K.; Yamamoto, M.; Sutter, T. R.; Kensler, T. W. Role of transcription factor Nrf2 in the induction of hepatic phase 2 and antioxidative enzymes in vivo by the cancer chemoprotective agent, 3H-1,2-dimethiole-3-thione. Mol. Med. 2001, 7 (2), 135−145. (46) Reisman, S. A.; Yeager, R. L.; Yamamoto, M.; Klaassen, C. D. Increased Nrf2 activation in livers from Keap1-knockdown mice increases expression of cytoprotective genes that detoxify electrophiles more than those that detoxify reactive oxygen species. Toxicol. Sci. 2009, 108 (1), 35−47. (47) Wu, K. C.; Cui, J. Y.; Klaassen, C. D. Effect of graded Nrf2 activation on phase-I and -II drug metabolizing enzymes and transporters in mouse liver. PLoS One 2012, 7 (7), No. e39006. (48) Zhu, Q. S.; Qian, B.; Levy, D. CCAAT/enhancer-binding protein alpha (C/EBPalpha) activates transcription of the human microsomal epoxide hydrolase gene (EPHX1) through the interaction with DNA-bound NF-Y. J. Biol. Chem. 2004, 279 (29), 29902−29910. (49) Cullinan, S. B.; Gordan, J. D.; Jin, J.; Harper, J. W.; Diehl, J. A. The Keap1-BTB protein is an adaptor that bridges Nrf2 to a Cul3based E3 ligase: oxidative stress sensing by a Cul3-Keap1 ligase. Mol. Cell. Biol. 2004, 24 (19), 8477−8486. (50) Sekhar, K. R.; Crooks, P. A.; Sonar, V. N.; Friedman, D. B.; Chan, J. Y.; Meredith, M. J.; Starnes, J. H.; Kelton, K. R.; Summar, S. R.; Sasi, S.; Freeman, M. L. NADPH oxidase activity is essential for Keap1/Nrf2-mediated induction of GCLC in response to 2-indol-3-ylmethylenequinuclidin-3-ols. Cancer Res. 2003, 63 (17), 5636−5645. (51) Gan, C. S.; Chong, P. K.; Pham, T. K.; Wright, P. C. Technical, experimental, and biological variations in isobaric tags for relative and absolute quantitation (iTRAQ). J. Proteome Res. 2007, 6 (2), 821−827. (52) Griffin, T. J.; Xie, H.; Bandhakavi, S.; Popko, J.; Mohan, A.; Carlis, J. V.; Higgins, L. iTRAQ reagent-based quantitative proteomic analysis on a linear ion trap mass spectrometer. J. Proteome Res. 2007, 6 (11), 4200−4209. (53) Wu, W. W.; Wang, G.; Insel, P. A.; Hsiao, C. T.; Zou, S.; Martin, B.; Maudsley, S.; Shen, R. F. Discovery- and target-based protein quantification using iTRAQ and pulsed Q collision induced dissociation (PQD). J. Proteomics 2012, 75 (8), 2480−2487. (54) Kocher, T.; Pichler, P.; Schutzbier, M.; Stingl, C.; Kaul, A.; Teucher, N.; Hasenfuss, G.; Penninger, J. M.; Mechtler, K. High precision quantitative proteomics using iTRAQ on an LTQ Orbitrap: a new mass spectrometric method combining the benefits of all. J. Proteome Res. 2009, 8 (10), 4743−4752. (55) Li, Z.; Adams, R. M.; Chourey, K.; Hurst, G. B.; Hettich, R. L.; Pan, C. Systematic comparison of label-free, metabolic labeling, and

isobaric chemical labeling for quantitative proteomics on LTQ Orbitrap Velos. J. Proteome Res. 2012, 11 (3), 1582−1590. (56) Rawal, S.; Kim, J. E.; Coulombe, R., Jr. Aflatoxin B1 in poultry: toxicology, metabolism and prevention. Res. Vet. Sci. 2010, 89 (3), 325−331. (57) Mary, V. S.; Theumer, M. G.; Arias, S. L.; Rubinstein, H. R. Reactive oxygen species sources and biomolecular oxidative damage induced by aflatoxin B1 and fumonisin B1 in rat spleen mononuclear cells. Toxicology 2012, 302 (2−3), 299−307. (58) Hassett, C.; Aicher, L.; Sidhu, J. S.; Omiecinski, C. J. Human microsomal epoxide hydrolase: genetic polymorphism and functional expression in vitro of amino acid variants. Hum. Mol. Genet. 1994, 3 (3), 421−428. (59) Abdel-Rahman, S. Z.; Ammenheuser, M. M.; Ward, J. B., Jr. Human sensitivity to 1,3-butadiene: role of microsomal epoxide hydrolase polymorphisms. Carcinogenesis 2001, 22 (3), 415−423. (60) McGlynn, K. A.; Rosvold, E. A.; Lustbader, E. D.; Hu, Y.; Clapper, M. L.; Zhou, T.; Wild, C. P.; Xia, X. L.; Baffoe-Bonnie, A.; Ofori-Adjei, D.; et al. Susceptibility to hepatocellular carcinoma is associated with genetic variation in the enzymatic detoxification of aflatoxin B1. Proc. Natl. Acad. Sci. U.S.A. 1995, 92 (6), 2384−2387. (61) London, W. T.; Evans, A. A.; McGlynn, K.; Buetow, K.; An, P.; Gao, L.; Lustbader, E.; Ross, E.; Chen, G.; Shen, F. Viral, host and environmental risk factors for hepatocellular carcinoma: a prospective study in Haimen City, China. Intervirology 1995, 38 (3−4), 155−161. (62) Hayes, R. B.; van Nieuwenhuize, J. P.; Raatgever, J. W.; ten Kate, F. J. Aflatoxin exposures in the industrial setting: an epidemiological study of mortality. Food Chem. Toxicol. 1984, 22 (1), 39−43. (63) Massey, T. E.; Smith, G. B.; Tam, A. S. Mechanisms of aflatoxin B1 lung tumorigenesis. Exp. Lung Res. 2000, 26 (8), 673−683. (64) Wang, J.; Yuan, W.; Chen, Z.; Wu, S.; Chen, J.; Ge, J.; Hou, F.; Chen, Z. Overexpression of G6PD is associated with poor clinical outcome in gastric cancer. Tumour Biol. 2012, 33 (1), 95−101. (65) Bokun, R.; Bakotin, J.; Milasinovic, D. Semiquantitative cytochemical estimation of glucose-6-phosphate dehydrogenase activity in benign diseases and carcinoma of the breast. Acta Cytol. 1987, 31 (3), 249−252. (66) Ohl, F.; Jung, M.; Radonic, A.; Sachs, M.; Loening, S. A.; Jung, K. Identification and validation of suitable endogenous reference genes for gene expression studies of human bladder cancer. J. Urol. 2006, 175 (5), 1915−1920. (67) Dessi, S.; Batetta, B.; Cherchi, R.; Onnis, R.; Pisano, M.; Pani, P. Hexose monophosphate shunt enzymes in lung tumors from normal and glucose-6-phosphate-dehydrogenase-deficient subjects. Oncology 1988, 45 (4), 287−291. (68) Langbein, S.; Frederiks, W. M.; zur Hausen, A.; Popa, J.; Lehmann, J.; Weiss, C.; Alken, P.; Coy, J. F. Metastasis is promoted by a bioenergetic switch: new targets for progressive renal cell cancer. Int. J. Cancer 2008, 122 (11), 2422−2428. (69) Salati, L. M.; Amir-Ahmady, B. Dietary regulation of expression of glucose-6-phosphate dehydrogenase. Annu. Rev. Nutr. 2001, 21, 121−140. (70) Dessi, S.; Batetta, B.; Spano, O.; Pulisci, D.; Mulas, M. F.; Muntoni, S.; Armeni, M.; Sanna, C.; Antonucci, R.; Pani, P. Serum lipoprotein pattern as modified in G6PD-deficient children during haemolytic anaemia induced by fava bean ingestion. Int. J. Exp. Pathol. 1992, 73 (2), 157−160. (71) Park, J.; Rho, H. K.; Kim, K. H.; Choe, S. S.; Lee, Y. S.; Kim, J. B. Overexpression of glucose-6-phosphate dehydrogenase is associated with lipid dysregulation and insulin resistance in obesity. Mol. Cell. Biol. 2005, 25 (12), 5146−5157. (72) Meijer, T. W.; Kaanders, J. H.; Span, P. N.; Bussink, J. Targeting hypoxia, HIF-1, and tumor glucose metabolism to improve radiotherapy efficacy. Clin. Cancer Res. 2012, 18 (20), 5585−5594. (73) Pandolfi, P. P.; Sonati, F.; Rivi, R.; Mason, P.; Grosveld, F.; Luzzatto, L. Targeted disruption of the housekeeping gene encoding glucose 6-phosphate dehydrogenase (G6PD): G6PD is dispensable for pentose synthesis but essential for defense against oxidative stress. EMBO J. 1995, 14 (21), 5209−5215. N



Article

(74) Sukhatme, V. P.; Chan, B. Glycolytic cancer cells lacking 6phosphogluconate dehydrogenase metabolize glucose to induce senescence. FEBS Lett. 2012, 586 (16), 2389−2395.

O


Proteome-wide Dysregulation by Glucose-6-phosphate

Recommend Documents