Proteomic Analysis for Antiobesity Potential of ... - ACS Publications

Proteomic Analysis for Antiobesity Potential of Capsaicin on White Adipose Tissue in Rats Fed with a High Fat Diet Jeong In Joo, Dong Hyun Kim, Jung-Won Choi, and Jong Won Yun* Department of Biotechnology, Daegu University, Kyungsan, Kyungbuk 712-714, Korea Received December 18, 2009

It is well recognized that capsaicin increases thermogenesis through enhancement of catecholamine secretion from the adrenal medulla. In the present study of the antiobesity effect of capsaicin, rats (5-week old) received capsaicin (10 mg/kg) along with a high-fat diet (HFD). In comparison with salinetreated rats, body weight of those in the capsaicin-treated group decreased by 8%. We performed differential proteomic analysis using two-dimensional electrophoresis (2-DE) combined with MALDITOF mass spectrometry to elucidate the molecular action of capsaicin on the antiobesity effect in epididymal white adipose tissue (WAT). Protein mapping of WAT homogenates using 2-DE revealed significant alterations to a number of proteins: 10 spots were significantly up-regulated and 10 spots were remarkably down-regulated in HFD fed rats treated with capsaicin. Among them, significant downregulation of heat shock protein 27 (Hsp27) and Steap3 protein, as well as up-regulation of olfactory receptor (Olr1434) in obese WAT was reported for the first time in association with obesity. Most of the identified proteins are associated with lipid metabolism and redox regulation, in which levels of vimentin, peroxiredoxin, and NAD(P)H:quinone oxidoreductase 1 (NQO1) were significantly reduced (>2-fold), whereas aldo-keto reductase, flavoprotein increased with capsaicin treatment. These data demonstrate that thermogenesis and lipid metabolism related proteins were markedly altered upon capsaicin treatment in WAT, suggesting that capsaicin may be a useful phytochemical for attenuation of obesity. Keywords: proteomics • obesity • white adipose tissue • thermogenesis • fatty acid oxidation

Introduction Obesity is a major threat to public health and is recognized as a cause of health issues that include insulin resistance, diabetes, hyperlipidemia, hypertension, and cardiovascular disease.1-3 Nevertheless, molecular and cellular studies of novel biomarkers and molecular pathways closely associated with obesity are limited. Through secretion of adipokines into the blood, adipose tissue plays a central role in development of these syndromes.4,5 In particular, white adipose tissue (WAT) functions as an energy storage organ through formation of triacylglycerol and release of fatty acids into the bloodstream during a shortage of energy.6 In association with overnutrition, excess WAT play a major role in obesity and obesity-related disorders through dysregulation of adipokine secretion from WAT.7,8 Therefore, inhibition of excess WAT can be an efficient strategy for prevention of obesity and metabolic disorders. Capsaicin, a major ingredient in hot pepper that is widely used as a spice in food products, shows numerous bioactive activities in humans. For example, capsaicin is used to relieve the pain of peripheral neuropathy,9 and can inhibit a variety of cancer cells;10-12 and it shows anti-inflammatory, as well as antioxidant activity.12,13 Moreover, capsaicin inhibits obesity * To whom correspondence should be addressed. Tel: +82-53-850-6556. Fax: +82-53-850-6559. E-mail: [email protected]. 10.1021/pr901175w

 2010 American Chemical Society

by decreasing energy intake,14 adipose tissue weight, and serum triglyceride through stimulation of lipid mobilization.15 Caterina et al. (1997) showed that capsaicin binds to a protein TRPV1, which activates sensory neurons as a transducer of painful thermal stimuli.16 Thus, capsaicin is known as a major compound linked to thermogenesis. In addition, capsaicin prevents adipogenesis and obesity by activation of TRPV1 channels.17 Thermogenesis play an important role in regulation of obesity. The most critical player in the cellular thermogenic process is UCP1, which is associated with uncoupling of oxidative phosphorylation in brown adipose tissue (BAT). UCP1 deficiency increases susceptibility to obesity in HFD-fed subjects.18,19 Previously, however, UCP1-deficient (Ucp1-/-) mice were reported to be resistant to obesity, which suggests alternative mechanisms that compensate for the loss of UCP1 function. Enerback et al. (1997) proposed that UCP2, a homologue of UCP1, is ubiquitously expressed and that it compensates for the role of UCP1.20,21 Despite recent reports on functions of the new UCP homologues, there are a number of controversies.22,23 Therefore, further research is needed to elucidate their physiological functions.24 BAT can be recruited under certain conditions; in addition, remodeling of mature WAT into mitochondria-rich cells with high capacity for fatty acid oxidation has been described in earlier studies.6,25 Several agents/conditions known to stimulate thermogenesis in BAT promote in vivo acquisition of BAT Journal of Proteome Research 2010, 9, 2977–2987 2977 Published on Web 04/01/2010

research articles features in WAT depots of rodents, including cold exposure and β3-adrenoceptor agonist treatment,26 bezafibrate treatment, recombinant adenovirus-induced hyperleptinemia, and chronic feeding of a diet enriched with n-3 polyunsaturated fatty acids of marine origin.27-29 In rats, capsaicin has been reported to increase thermogenesis by dose-dependent enhancement of catecholamine secretion from the adrenal medulla.30,31 Catecholamine mediates these effects through R- and β-adrenoceptors.32 In addition, both animal and human studies have shown that the increase in thermogenesis is abolished after administration of β-adrenergic blockers, such as propranolol,30 which implies that capsaicin-induced thermogenesis is likely based upon β-adrenergic stimulation.33 Accumulating evidence shows that reduced oxidation of lipids and a reduced BAT phenotype in white fat may contribute to obesity and type 2 diabetes in humans; therefore, remodeling of WAT is of interest.26,34-36 In this study, we therefore investigated possible remodeling effects of capsaicin in WAT depots. Proteome analysis has recently been used in many studies of obesity, diabetes, aging, cancer, etc.37-41 The combination of 2-DE and PMF using mass spectrometry is a powerful method for discovery of new biomarkers and pathways in a number of diseases.42,43 Nowadays, profiling and discovery of novel biomarkers for diagnosis and care of obesity-related patients, as well as for accurate understanding of mechanisms and causes of metabolic disorders are needed. Therefore, in the present study, HFD-fed rats were used as an in vivo model to address the mode of action of capsaicin in obesity prevention or thermogenesis. To this end, proteomic analysis of WAT was performed using protein mapping by 2-DE and PMF by MALDITOF mass spectrography for identification of novel biomarkers of thermogenesis and lipid oxidation.

Materials and Methods Animals and Breeding Conditions. Five-week-old male Sprague-Dawley rats (Daehan Experiment Animals, Seoul, Korea) weighing 130-150 g were used in this study. Animals were allowed 2 weeks for acclimatization prior to experiments. Rats were maintained on a diet of standard rodent chow or HFD containing 45% fat-derived calories (Sam Yang, Seoul, Korea), with 12 h light and dark cycles at a temperature of 23 ( 2 °C, and under relative humidity of 55% throughout the experimental period. These experiments were approved by the Committee for Laboratory Animal Care and Use of Daegu University. All procedures were conducted in accordance with the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health. Experimental Design. All animals were randomly divided into three groups, with six animals in each: the normal control group (Nor), the high-fat diet group without capsaicin (HFDCap), the high fat diet group with capsaicin (HFD+Cap). Animals in the HFD+Cap group were injected by oral administration of capsaicin (10 mg/kg BW, dissolved in 0.9% saline with 2% ethanol and 10% Tween 80). Normal control and HFDCap groups were injected by oral administration of vehicle (0.9% saline with 2% ethanol and 10% Tween 80) once a day for 9 weeks. Histological Analysis. Epididymal WAT was fixed in 4% buffered formaldehyde for 24 h. Tissues were embedded in paraffin wax and cut at 4 µm thickness, followed by deparaffinization and rehydration. Paraffin-embedded tissues were then mounted on glass slides and stained with hematoxylin and eosin (H&E). 2978

Journal of Proteome Research • Vol. 9, No. 6, 2010

Joo et al. Preparation of the WAT Sample. WAT were excised immediately after sacrifice, and then washed with a cold saline solution. WAT were pulverized under liquid nitrogen and stored at -80 °C. Tissues were lysed in 200 µL rehydration buffer solution containing 7 M urea, 2 M thiourea, 4% CHAPS, 20 mM DTT, 1 mM PMSF, 2% IPG buffer, and a trace of bromophenol blue. A homogenizer (PT 1200E, Kinematica Ltd., Luzern, Switzerland) was used on ice. Extracts were centrifuged at 14 000× g for 20 min; the supernatant was then stored at -80 °C for future analysis. Protein content was determined by the Bradford method (Bradford, 1976) using Bradford reagent (Sigma-Aldrich, St. Louis, MO). 2-Dimensional Gel Electrophoresis (2-DE). IPG drystrips (18 cm, pH 3-10; Amersham Biosciences, Little Chalfont, Buckinghamshire, England) were used for isoelectric focusing (IEF); 150 µg of protein was adjusted to a volume of 350 µL with rehydration buffer solution and the IPG drystrips were rehydrated overnight in a strip holder. According to the protocol suggested by the manufacturer, IEF was then carried out using the PROTEIN IEF cell (Bio-Rad, Hercules, CA). After focusing, the gel strips were equilibrated in a solution containing 6 M urea, 2% SDS, 1% DTT, 30% glycerol, and 50 mM Tris-HCl (pH 6.8) for 15 min, followed by further incubation in the same solution, except that DTT was replaced with 2.5% iodoacetamide for an additional 15 min. Equilibrated IPG strips were then rinsed with electrophoresis buffer. The strips were placed on a 20 × 20 cm SDS-polyacrylamide gel for resolution in the second dimension. 2-DE was performed at a constant voltage of 15 mA per gel for 15 h; the separated gels were then visualized using silver staining. Image Acquisition. Gels were scanned on a UMAX PowerLook 1120 (Maxium Technologies, Inc., Taipei, Taiwan); prior to analysis, the resulting images were converted to TIF format. Prior to gel image capture, intensity calibration was carried out using an intensity step wedge. Comparison of images was performed using a modified version of ImageMaster 2D software V4.95 (Amersham Biosciences). For each experiment, a reference gel was selected at random from the gels of the control group, and detected spots from other gels in the control data set were matched to those in the selected reference gel. Relative optical density and relative volume were also calculated to correct for differences in gel staining. Each spot intensity volume was processed by background subtraction and total spot volume normalization; the resulting spot volume percentage was used for comparison. Enzymatic Digestion of Protein in Gel. Using modified porcine trypsin, protein spots were enzymatically digested in gel in a manner similar to that previously described by Shevchenko et al.44 Gel pieces were washed with 50% ACN to remove SDS, salts, and stain. The gel was then dried to remove solvent, rehydrated with trypsin (8-10 ng/mL), and incubated for 8-10 h at 37 °C. The proteolytic reaction was terminated by addition of 5 mL 0.5% TFA. Tryptic peptides were recovered by combining the aqueous phase from repeated extractions of gel pieces with 50% ACN. Once concentrated, the peptide mixture was redissolved in the buffer and desalted using C18ZipTips (Millipore, Watford, Herts, UK); peptides were then eluted with 1-5 mL of ACN. An aliquot of this solution was mixed with an equal volume of a saturated solution of CHCA in 50% ACN, and 1 µL of the mixture was spotted onto a target plate. Protein Identification. Protein analysis was performed using an Ettan MALDI-TOF mass spectrometer (Amersham Bio-

research articles

Antiobesity Potential of Capsaicin on White Adipose Tissue sciences). Peptide ions were desorbed with a N2 laser at 337 nm using a delayed extraction mode. Acceleration was performed using a 20 kV injection pulse for TOF analysis. Each spectrum was the cumulative average of 300 laser shots. The search program, ProFound, developed by The Rockefeller University (http://129.85.19.192/profound_bin/ WebProFound.exe), was used for protein identification by PMF. Spectra were calibrated with trypsin autodigestion ion peak m/z (842.510, 2211.1046) as internal standards. If at least two different keratins were identified from the same sample, keratin contamination peaks and trypsin ion peak m/z (1045) were excluded from the list. Using the MASCOT search program (http://www.matrixscience.com), peptide masses were matched with theoretical peptides of all proteins in the NCBI database. The following parameters were used for the database search: trypsin as a cleaving enzyme; a maximum of one missed cleavage; 0.01% of maximum as peak threshold; iodoacetamide (Cys) as a complete modification; methionine as a partial modification; monoisotopic masses; and mass tolerance of 60.1 Da.37,45 Western Blot Analysis. Tissue lysates were prepared with RIPA buffer (Sigma-Aldrich, St. Louis, MO), homogenized and centrifuged at 14 000× g for 20 min. Extracts were diluted in sample buffer (50 mM Tris (pH 6.8), 2% SDS, 10% glycerol, 0.1% bromophenol blue, and 5% β-mercaptoethanol) and heated for 5 min in a boiling bath. The samples were then subjected to SDS-polyacrylamide gel for electrophoresis and transferred to PolyScreen membranes (NEN, Boston, MA). Membranes were subsequently blocked with 5% nonfat dry milk in Tris-buffered saline (TBS, 10 mM Tris-HCl, 150 mM NaCl, pH 7.5) containing 0.1% Tween-20 (TBS-T). After washing with TBS-T, the membrane was probed with primary antibody. The following antibodies were used in this study: antirabbit p-AMPK, AMPK, p-ACC, ACC, antigoat UCP1, 2, 3 (Santa Cruz Biotechnology, Santa Cruz, CA), and antimouse vimentin, antirabbit peroxiredoxin1 (Ab Frontier Seoul Korea). After washing with TBST, the membrane was incubated for 2 h with horseradish peroxidase-conjugated antigoat IgG, antimouse IgG, and antirabbit IgG secondary antibody (1:1000; Santa Cruz Biotechnology) and developed using enhanced chemiluminescence (Intron, Seoul, Korea). Western blot was analyzed by scanning with a UMAX PowerLook 1120 (Maxium Technologies, Akron, OH) and digitalized using image analysis software (KODAK 1D, Eastman Kodak, Rochester, NY). Quantitative Real-Time RT-PCR Analysis. Total RNA was isolated from WAT samples with TRIZOL (QIAGEN), and was then cleaned with ribonuclease-free deoxyribonuclease and the RNeasy Mini kit (QIAGEN Inc., Valencia, CA). The samples were then processed following the manufacturer’s instructions. Quality of the RNA was analyzed on a 1% agarose gel and the concentration by a Qubit quantitation system (Invitrogen, Eugene, OR). Briefly, reverse transcription of 2 µg RNA was carried out using the iScript cDNA synthesis kit, according to the supplier’s protocol. Quantitative real-time PCR was performed using the Applied Stratagene mx 3000p QPCR System (San Diego, CA), according to the manufacturer’s protocol. Statistical Analysis. All experimental results were compared by one-way analysis of variance (ANOVA) using the Statistical Package of Social Science (SPSS) program; data were expressed as the mean ( SE. Group means were considered significantly different at p < 0.05, as determined by the technique of protective least-significant difference (LSD) when ANOVA indicated an overall significant treatment effect.

Figure 1. Capsaicin treated rats showed decreased weight-gain and decreased adiposity. (A) Effects of capsaicin on body weight profiles of rats fed with high fat diet (HFD) with or without capsaicin treatment. Data are mean ( SE (n ) 6 per group). (B) Representative images of H&E staining in epididymal WAT from normal, HFD-Cap, and HFD+Cap rats. Haematoxylin and eosin (H&E) staining of white dipose tissue was performed in the ninth week. Scale bars ) 50 µm. HFD+Cap: High fat diet group with capsaicin feeding. HFD-Cap: High fat diet group without capsaicin feeding.

Results Effect of Capsaicin on Body and WAT Weights. Results of our animal experiment revealed that weight gain in the capsaicin-fed group (HFD+Cap) was reduced by 8% compared with the HFD-Cap group (Figure 1A). In addition, HFD increased the weight of WAT normalized with body weight, and capsaicin feeding significantly decreased WAT weight (Table 1). Furthermore, results of H&E staining of WAT showed a striking decrease in the size of lipid droplets of WAT in HFDfed rats treated with capsaicin (Figure 1B), indicating that capsaicin can have a significant inhibitory effect against fat accumulation (Table 2). Proteomic Analysis of WAT. To detect HFD-associated markers, WAT tissue from obese (n ) 6) and lean control (n ) 6) SD rats were arrayed using 2-DE. Results of protein mapping of WAT using 2-DE revealed that more than 1000 individual spots, ranging from 7-240 kDa masses over pH 3-10, were detected in the silver-stained gel image (Figure 2). Image analysis and further statistical analysis allowed detection and identification of 37 proteins whose expression was modulated in response to HFD. Among these, 20 proteins showed a sensitive response to capsaicin treatment. Results of 2-DE image analysis showed that 17 proteins were up-regulated upon HFD feeding. Among these, expression levels of 10 proteins were partially or fully restored to near those of normal rats by capsaicin feeding (Table 3). In particular, protein levels of NQO1, FABP4, heat shock protein 27, vimentin, GAPDH, preoxiredoxin (PRX), steap3, Tra 1, aldehyde reductase (AKR), and alcohol sulforansferase were up-regulated after HFD feeding, and their expression levels were either partially or fully normalized by capsaicin (Table 3, Figures 3A and B). To identify the effects of capsaicin in HFD-induced obese rats, we characterized the statistical difference between HFD-Cap and HFD+Cap. Consequently, there were 7 differential proteins between two groups. Among these, expression levels of PRX, ARK, and Tra 1 proteins in HFD+Cap group were significantly increased by capsaicin compared with normal and HFD-Cap Journal of Proteome Research • Vol. 9, No. 6, 2010 2979

research articles

Joo et al.

Table 1. Sequences of Primers Used for Real-Time PCR in This Study gene name

accession no.

forward

reverse

GAPDH UCP1 UCP2 PGC-1 CPT-1R PPARR PPARγ C/EBPR FABP4 TNFR Leptin

NM_017008.3 NM_012682.1 NM_019354.2 NM_031347.1 NM_031559.2 NM_013196.1 NM_011146 NM_007678 NM_053365.1 NM_012675.2 NM_013076.2

GGTCTCGCTCCTGGAAAGA GGGACCTACAATGCTTACAG CAAGCTTATGGTTGGTTTCAAGGCCACCGA ATGAATGCAGCGGTCTTAGC CGGTTCAAGAATGGCATCATC CCC CAC CAGTAC AGA TGA GTC GGTGAAACTCTGGGAGATTC AGGTGCTGGAGTTGACCAGT CATGGCCAAGCCCAACAT AGGCCTTGTGTGTTTCCA TTTCACACACGCAGTCGGTATC

GTATGACTCCACTCACGGCAA GGTCATATGTCACCAGCTCT CAAGCTTCAAAAGGGTGCCTCCCGGGATTC AACAATGGCAGGGTTTGTTC TCACACCCACCACCACGAT GGA GTT TTG GGA AGAGAA AGG CAACCATTGGGTCAGCTCTT CAGCCTAGAGATCCAGCGAC CGCCCAGTTTGAAGGAAATC TGGGGGACAGCTTCCTT GGTCTGGTCCATCTTGGACAA

Table 2. Effects of Capsaicin on Body and Epididymal WAT Weight Gain in Rats Fed with a High-Fat Diet in Respond to Capsaicin Treatment groupa

initial weight (g)

final weight (g)

WAT weight (g)

Normal HFD-Cap HFD+Cap

204.2 ( 6.6 197.8 ( 9.3 195.8 ( 9.7

444.83 ( 24.96 511.50 ( 56.53 480.83 ( 48.73

14.14 ( 1.98 14.66 ( 2.40 13.25 ( 1.23

a HFD-Cap: Group of high fat diet without capsaicin feeding; HFD+Cap: group of high fat diet with capsaicin feeding. Values for body weight, tissue weights are mean ( SE of 6 rats.

groups (p < 0.05). Especially, increment of steap3, vimentin, NQO1, and HSP27 proteins was the most significant compared with other proteins (p < 0.01) (Table 3). Ten proteins were down-regulated in the HFD-fed group; levels of these proteins were then partially or fully reverted to normal levels after capsaicin feeding (Table 3). Flavoprotein, beta 1 globulin, myosin light chain, malate dehydrogenase, coiled-coil domain containing like, Olr1434, aldehyde reductase, aldo-keto reductase 1, EF-2, E3 ubiquitin protein ligase, were down-regulated in HFD-Cap, and their protein levels were increased, again approaching the levels of the normal group with capsaicin administration (HFD+Cap) (Table 3, Figures 3A and B). As in the analysis of increased proteins in HFD+Cap group, we also characterized the statistical difference between HFD-Cap and HFD+Cap groups to investigate the effects of capsaicin in HFD-induced obese rats. Among these, expression levels of 7 proteins were significantly decreased in HFD+Cap group, including flavoprotein, myosin light chain, beta 1 globulin, EF-2 (p < 0.05) and malate dehydrogenase, aldo-keto reductase (p < 0.01) in response to capsaicin treatment (Table 3). Validation of Proteomic Results by Immunoblot Analysis. To validate the results of proteomic analysis, Western blot analysis was performed for the two proteins of interest, proxiredoxin 1 and vimentin, which were identified by proteomic analysis. As shown in Figure 4, results of 2-DE and Western blot analysis showed good agreement in expression levels of these two proteins. Capsaicin Treatment Increased Expression of Thermogenic and β-Oxidation Related Genes in WAT. mRNA expression levels of several genes associated with thermogenesis, respiratory chain function, and fat oxidation in WAT depots were analyzed before and after capsaicin treatment. Selected genes included those encoding uncoupling proteins (UCP1 and UCP2) and carnitine palmitoyltransferase 1 (CPT1). All examined mRNA levels were up-regulated in WAT of HFD-fed rats (Figure 5). UCP1 mRNA was increased upon HFD feeding, and capsaicin 2980


exhibited additional increment. In contrast, UCP2 mRNA was remarkably decreased after HFD treatment and was completely reversed to that of normal rats (Figure 5). For elucidation of the biomolecular actions of capsaicin, several key proteins associated with thermogenesis and fatty acid oxidation were further investigated using Western blot analysis. Protein levels of UCP1, UCP2, UCP3, p-AMPK, and p-ACC were increased, whereas ACC was decreased upon capsaicin treatment (Figure 7). Effect of Capsaicin on Expression of Obesity Genes. To investigate the inhibitory mechanism of capsaicin in adipogenesis, changes in expression of PPARγ, PGC1R, and C/EBPR were examined in response to capsaicin treatment. mRNA levels of PPARγ and C/EBPR (key transcriptional factors for adipocyte differentiation) were significantly down-regulated in WAT of rats fed with capsaicin (HFD+Cap) (Figure 6). mRNA levels of leptin and TNFR were also down-regulated in WAT of capsaicin-treated rats (Figure 6). Interestingly, the PGC1R gene was extremely elevated in the HFD+Cap group (Figure 6).

Discussion The present study was designed to investigate the antiobesity effect of capsaicin on HFD-fed rats through proteomic analysis of WAT. The proteome profiling technique provided an effective approach for identification of protein alterations in WAT in response to capsaicin treatment. The most striking results from our proteomic study showed global changes in causative proteins associated with obesity; three of these proteins were examined for the first time for their regulatory actions in regard to obesity. Our protein profile data revealed significant alterations in levels of many proteins associated with lipid and carbohydrate metabolism. Of these, Glycerol-3-phosphate dehydrogenase (GPDH) and malate dehydrogenase (MDH) were significantly down-regulated in the HFD+Cap group, which correlated with enhanced glycolytic activity and fatty acid synthesis46 these proteins are well-known for adipogenesis in both in vivo and in vitro studies.47 Furthermore, MDH catalyzes oxidation of malate to produce oxaloacetate, the final step in the TCA cycle. As it is one of the molecules linking glucose metabolism and synthesis of fatty acids, it is an important enzyme in de novo lipogenesis.48 MDH has been reported to increase in liver and WAT of obese models due to increased rates of lipogenesis (Table 3).48 In the present study, it was observed that the concentration of NAD(P)H:quinone oxidoreductase 1 (NQO1) was significantly decreased in WAT after capsaicin treatment, suggesting a potential role for this protein in obesity. NQO1 expression has been reported in abdominal adipose tissue49,50 and adipo-

research articles

Antiobesity Potential of Capsaicin on White Adipose Tissue

Figure 2. Representative 2-DE gel images of silver-stained proteins of WAT. Arrows indicate differentially regulated proteins. HFD+Cap: High fat diet group with capsaicin feeding. HFD-Cap: High fat diet group without capsaicin feeding.

Table 3. List of Identified Proteins in WAT of Rats Fed with a High Fat Diet (HFD) with (+Cap) and without (-Cap) Capsaicin Treatment

spot ID

acc no.a

proteinb

73864 73608 72661 72974 73485 73495 72659 72945 73214 72649 72881 71971 73724 74003

gi54261546 gi56611127 gi204070 gi205474 gi546056 gi311662 gi47576041 gi6435547 gi22652804 gi37590235 gi8248633 gi51858886 gi55715850 gi57527192

72600 73467 71962 72454 72779 72902

gi13591894 gi546056 gi2130649 gi14389299 gi50403677 gi51948400

Fabp4 protein GAPDH flavoprotein myosin light chain beta 1 globin alcohol sulfotransferase olfactory receptor Olr1434 Peroxiredoxin 1 aldehyde reductase Malate dehydrogenase heat shock protein 27 Tra1 protein Steap3 protein coiled-coil domaincontaining-like aldo-keto reductase 1 beta 1 globin EF-2 Vimentin E3 ubiquitin-protein ligase NAD(P)H quinone oxidoreductase1

molecular theoretical no. of matched mass (kDa) pI peptides

alteration (vol %) normal

HFD-Cap

HFD+Cap

coveragec Z-scored

14.83 36.06 31.44 20.94 15.93 33.36 34.75 22.25 16 36.64 22.86 74.42 55.11 32.93

7.9 8.4 8.9 5.0 8.2 7.7 8.0 8.5 7.9 5.9 6.1 5.0 9.7 5.8

7 4 3 5 4 5 2 4 4 7 4 14 5 3

2.272 ( 0.233 2.539 ( 0.583 0.494 ( 0.031 0.478 ( 0.025 0.301 ( 0.025 0.637 ( 0.222 0.381 ( 0.032 0.461 ( 0.027* 0.523 ( 0.207 0.425 ( 0.053 0.147 ( 0.004 0.148 ( 0.02 0.154 ( 0.012 0.143 ( 0.040

2.409 ( 0.194 2.107 ( 0.213 0.086 ( 0.029* 0.065 ( 0.0002** 0.558 ( 0.005** 0.923 ( 0.036* 0.162 ( 0.008** 0.387 ( 0.033* 0.127 ( 0.019* 0.272 ( 0.023* 0.179 ( 0.014* 0.283 ( 0.059* 0.139 ( 0.006** 0.047 ( 0.013**

1.534 ( 0.058* 1.060 ( 0.236* 0.122 ( 0.013** 0.144 ( 0.007**† 0.463 ( 0.038*† 0.565 ( 0.137 0.243 ( 0.075 0.231 ( 0.064† 0.198 ( 0.016*† 0.107 ( 0.038*†† 0.083 ( 0.004**†† 0.188 ( 0.045** 0.063 ( 0.005**†† 0.073 ( 0.025*

38 14 19 23 44 21 8 25 16 27 25 26 13 17

2.19 1.19 0.54 2.15 1.36 1.13 0.37 1.31 0.69 2.30 1.08 2.35 0.90 1.66

36.72 15.93 35.0 53.77 37.68 26.49

6.8 8.2 5.8 5.1 5.7 6.9

4 4 5 8 3 2

0.207 ( 0.116 0.230 ( 0.067 0.037 ( 0.037 0.065 ( 0.001 0.100 ( 0.004 0.043 ( 0.001

0.085 ( 0.014* 0.128 ( 0.004** 0.081 ( 0.023* 0.083 ( 0.002** 0.061 ( 0.002** 0.086 ( 0.003*

0.256 ( 0.044*†† 0.265 ( 0.021* 0.122 ( 0.009**† 0.039 ( 0.002**†† 0.066 ( 0.003** 0.031 ( 0.004**††

15 35 23 21 8 12

0.40 0.95 1.16 1.83 0.36 0.43

a Acc. No.: NCBlnr database accession number. b For protein nomenclatures, see the Abbreviation section. Statistical significance was determined by a t-test, where p-value is *p < 0.05 and **p < 0.01: Normal vs HFD-Cap or HFD+Cap, †p < 0.05 and ††p < 0.01: HFD-Cap vs HFD+Cap. For each protein, the relative intensity was averaged and expressed as a mean ( SEM of three separate experiments. c Coverage: percent of identified sequence to the complete sequence of the known protein. d Z-score corresponds to the percentile of the search in the random match population: Z-score 1.65 ) 95%, 2.33 ) 99%, 99.9% confidence.

cytes.51 It is a flavoprotein that utilizes NAD(P)H as an electron donor, catalyzing the two-electron reduction and detoxification of quinones and their derivatives. Gaikward et al (2001) demonstrated that NQO1-/- mice exhibit significantly lower levels of abdominal adipose tissue compared with wild-type mice.49 In our study, up-regulation of NQO1 in HFD-fed rats was observed upon treatment with capsaicin, suggesting that NQO1 was stimulated by capsaicin and may have potential as a therapeutic target for obesity (Table 3, Figures 3A and B). Earlier studies showed that during differentiation of 3T3-L1 preadipocytes, vimentin intermediate filaments were reorganized to form cage-like structures around nascent lipid droplets.52,53 In this study, the protein level of vimentin was

significantly reduced in WAT after capsaicin treatment, suggesting a preventative role for this protein in adipogenesis (Table 3, Figures 3A and B). Of particular interest to us was the up-regulation of heat shock protein (HSP) 27. It is well recognized that HSPs serve as chaperones in control of protein folding in the endoplasmic reticulum and subsequent intracellular trafficking.54 A growing body of literature has linked chaperone-like molecules to adipogenesis, obesity, and diabetes.54-57 For example, adipogenesis in 3T3-L1 cells is accompanied by increased expression of the chaperone-related immunophilin, FK-binding protein 51.58 Reports of adipogenic induction of HSP27, crystalline, HSP20, and HSP60 in human adipose-derived adult stem Journal of Proteome Research • Vol. 9, No. 6, 2010 2981

research articles

Joo et al.

Figure 3. Zoom-in gel images (A) and their volume density (B) for altered levels of five white adipose tissue proteins in Normal, HFDCap, HFD+Cap. Spot density was digitized with software and mean ( SEM of three independent experiments. Asterisk indicates statistically significant (*p < 0.05, **p < 0.01) when compared to normal group. HFD+Cap: High fat diet group with capsaicin feeding. HFD-Cap: High fat diet group without capsaicin feeding.

(ADAS) cells are intriguing.47 In this study, HSP27 was identified in the WAT proteome, showing its increased level after HFD feeding. Interestingly, capsaicin significantly decreased the level of this molecule, suggesting a possible role as a therapeutic target for obesity (Table 3, Figures 3A and B). Up-regulation of aldo-keto reductases (AKRs) by capsaicin treatment is another primary outcome of this study. AKR is a group of monomeric oxidoreductases that catalyze the reduced nicotinamide adenine dinucleotide phosphate-dependent conversion of aldehydes and ketones to their corresponding alcohols.59 Among members of the AKR superfamily, AKR1B1 has been a particular focus due to its potential role in development of secondary diabetic complications in humans.60 It is recognized that AKR1B7 is differently expressed in various mouse WAT, depending on location.61 Cells expressing AKR1B7 did not contain lipid droplets, and the expression level of 2982


AKR1B7 was very low in mature adipocytes.61 In vivo experiments demonstrated that AKR1B7-encoding mRNA expression was decreased in adipose tissues from mice where obesity was induced by HFD.61 With this connection, down-regulated AKR1 in HFD-fed rats and its reversal after capsaicin feeding supports a role for this protein in obesity (Table 3, Figures 3A and B). We also paid special attention to up-regulation of peroxiredoxin 1 (PRX 1) and its reversal by capsaicin treatment in normal and HFD-fed groups. In order to combat the toxic processes of ROS, all organisms are equipped with different defensive systems. These defensive systems include antioxidant enzymes, such as superoxide dismutases, catalases, glutathione peroxidases, and a new type of peroxidase, which is a part of the rapidly growing family of PRXs.62-64 PRX1 has been identified in a large variety of organisms, and is the most abundant and ubiquitously distributed member of the mam-


Figure 4. Western blot analysis for validation of the proteomic result of peroxiredoxin and vimentin. HFD+Cap: High fat diet group with capsaicin feeding. HFD-Cap: High fat diet group without capsaicin feeding.

Figure 5. Effects of capsaicin on fold change in mRNA expressions of thermogenic factors in WAT analyzed by quantitative real-time PCR. Capsaicin treatment increases the expression of thermogenic and β-oxidation relative genes in WAT. Spot densities were digitized with software and mean a ( SEM of three independent experiments and are significant at *p < 0.05, **p < 0.001 when compared to normal group. HFD+Cap: High fat diet group with capsaicin feeding. HFD-Cap: High fat diet group without capsaicin feeding.

malian PRX family.63 In the current study, PRX1 down-regulated by HFD was up-regulated again upon treatment with capsaicin, indicating its possible role in amelioration of obesogenic status (Table 3, Figures 3 and 4).

research articles Moreover, we attempted here to report on molecular data that would indicate an effect of capsaicin that favored remodeling of WAT toward acquisition of BAT features, particularly enhanced oxidative metabolism. AMPK activation in adipose tissue is concomitant with increased fatty acid oxidation. The uncoupling mitochondrial protein UCP-1 is overexpressed in adipocytes, which leads to an increase in the AMP/ATP ratio, activation of AMPK, inactivation of ACC, and decreased lipogenesis as well.65,66 This induces an increased capacity for fatty acid oxidation, which could be a result of decreased malonylCoA concentration, alleviating inhibition of CPT-1R, which catalyzes entry of fatty acids in mitochondria and constitutes the rate-limiting enzyme of fatty acid oxidation.66,67 Thus, CPT1R, and phosphorylation of AMPK, ACC are part of fat metabolism in WAT, which has been well studied in vivo and in vitro.66 In this study, capsaicin obviously increased phosphorylation of both AMPK and ACC, as well as expression levels of CPT-1R (Figure 7). UCP-1 overexpression is also concomitant with mitochondrial biogenesis in adipocytes.67 Several studies have described down-regulation of UCPs and PGC-1R by HFD in adipose tissue of rodents genetically prone to obesity.68-70 However, our experimental data showed a significant increase in UCP1 and PGC-1R mRNA levels in HFD-fed rats and additional increase with capsaicin treatment. Levels of PGC-1R are normally low in WAT and high in BAT, and forced expression of PGC-1R is responsible for activation of thermogenesis and oxidative metabolism, including both mitochondrial biogenesis and tissue-specific expression of UCP1 (Figures 5 and 6).71,72 We also investigated that the effect of capsaicin on UCP1 expression in BAT, because BAT is strongly associated with thermmogenesis and UCP1 plays a critical role in this process. To ascertain the variance in UCP1 expression by capsaicin in BAT, we performed immunoblotting analysis and found that protein levels of UCP1 in BAT of HFD+Cap group were increased upon capsaicin treatment compared with normal control and HFD-Cap group (data not shown here, see Supplementary Figure 1, Supporting Information). This result showed that capsaicin can also exhibited thermogenesis in BAT as in WAT. Similar to other earlier studies, we found that increased thermogenic effect of BAT in response to capsaicin was obvious in this study. It has been reported that capsaicin increased UCP1 protein expression, oxygen consumption, body temperature but did not link to size of BAT.73-77 To the best of our knowledge, this is the first report concerning thermogenic action of WAT in response to capsaicin treatment. In addition, UCP2 was originally discovered as a structural homologue of brown fat UCP1.78 Although UCP2 was proposed to function in adaptive thermogenesis in a manner equivalent to UCP1, it now appears that UCP2 primarily acts to dampen ROS generation. Although the exact biochemistry of this process is still under debate, UCP2 has been shown to decrease mitochondrial ROS production in a number of cell types and organs.79-83 Results from recent studies have suggested that UCP2 appears to protect against development of atherosclerosis in response to a fat and cholesterol diet. In our finding, UCP2 expression level was significantly decreased upon HFD feeding, and its level was shifted to normal level by capsaicin treatment. This result implies that capsaicin contributed to protection against endogenous oxidative stress (Figure 5). Quantitative real-time PCR analysis of representative adipocyte-associated mRNA levels was performed in order to gain further understanding of the molecular mechanism underlying Journal of Proteome Research • Vol. 9, No. 6, 2010 2983

research articles

Joo et al.

Figure 6. Effects of capsaicin on fold change in mRNA expressions of thermogenic factors and relative obesity gene in WAT analyzed by quantitative real-time PCR. Spot densities were digitized with software and mean a ( SEM of three independent experiments, and are significant at *p < 0.05, **p < 0.001 when compared to normal group. HFD+Cap: High fat diet group with capsaicin feeding. HFDCap: High fat diet group without capsaicin feeding.

the effects of capsaicin on diet-induced obese rats. The central role of PPARγ in differentiation of white adipocytes is well established.83 Expression levels of two key regulators of the adipocyte differentiation program (PPARγ and C/EBPR) were not significantly different in response to capsaicin treatment (Figure 6). These results imply that capsaicin did not contribute directly to suppression of adipocyte differentiation. However, capsaicin acted as a regulator in decreasing the levels of leptin, FABP4, and TNFR (Figure 6). Leptin is synthesized and secreted specifically from white adipose cells.84 Leptin has a variety of important central and peripheral actions in regulation of energy balance and metabolism, fertility, and bone metabolism that are mediated by specific cell surface leptin receptors.85,86 According to our results, the leptin gene was up-regulated upon HFD feeding, and the levels were repaired with capsaicin treatment, suggesting its role in reduction of fat accumulation in WAT of HFD-fed rats. Two common features of dyslipidemia and insulin resistance include adipose tissue dysfunction and elevated levels of tumor necrosis factor-alpha (TNF-R).87 The TNF-R gene is overexpressed in fat cells of both obese rodents and humans, whose expression is positively correlated with the degree of obesity and hyperinsulinemia.88,89 TNF-R reduces carbohydrate metabolism, lipogenesis, adipogenesis, and thermogenesis, and stimulation of lipolysis. TNF-R can also impact the endocrine functions of adipose tissue.87 In this study, as expected, the 2984


TNF-R gene was significantly up-regulated in HFD-fed rats, and their levels were markedly decreased again with capsaicin treatment (Figure 6). However, we have no confidence in these results due to the fact that decreased expression levels of this gene in capsaicin-treated HFD-fed rats were much lower than in normal rats. In conclusion, comparative proteome analysis of a rat model of diet-induced obesity allowed us to outline possible pathways involved in the response to capsaicin. Proteins identified here are involved in cellular functions that include lipid metabolism, redox processes, and signal and energy transduction. Some of these have already been linked to human obesity, suggesting that the newly identified proteins might also have importance in obesity and that they should be further investigated. These changes provide valuable new molecular insights into the mechanism of the antiobesity effects of capsaicin. Thus, we believe that the findings presented here open new insights into the study and potential treatments for this pathology. Abbreviations: 2-DE, 2 dimentional electrophoresis; PMF, peptide mass fingerprinting; UCP1, uncoupling protein 1; UCP2, uncoupling protein 2; FAS, fatty acid synthase; ACC, acetyl-CoA carboxylase; AMPK, AMP-activated protein kinase; Hsp27, heat shock protein 27; Olr, olfactory receptor; FABP4, fatty acid binding protein; AKR, aldo-keto reductase; PRX1, peroxiredoxin 1; NQO1, NAD(P-)H:quinone oxidoreductase 1

research articles


(8) (9)

(10)

(11)

(12)

(13) (14)

(15)

Figure 7. Effect of capsaicin in WAT of HFD-fed rats on protein expression levels of proteins associated with fatty acid oxidation and energy expenditure. HFD+Cap: High fat diet group with capsaicin feeding. HFD-Cap: High fat diet group without capsaicin feeding.

(16)

(17)

TRPV1, transient receptor potential cation channel, subfamily V, member 1.

Acknowledgment. This research was supported by the Basic Science Research Program (grant number R01-2008000-10277-0) and SRC program (Center for Food & Nutritional Genomics: grant number 2009-0063409) of the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology.

Supporting Information Available: Supplementary Figure 1. This material is available free of charge via the Internet at http://pubs.acs.org.

(18) (19)

(20)

(21) (22)

References (1) Aguilera, C. M.; Gil-Campos, M.; Canete, R.; Gil, A. Alterations in plasma and tissue lipids associated with obesity and metabolic syndrome. Clin. Sci. (London) 2008, 114 (3), 183–93. (2) Hotamisligil, G. S. Molecular mechanisms of insulin resistance and the role of the adipocyte. Int. J. Obes. Relat. Metab. Disord. 2000, 24, 23–7. (3) Barcelo-Batllori, S.; Corominola, H.; Claret, M.; Canals, I.; Guinovart, J.; Gomis, R. Target identification of the novel antiobesity agent tungstate in adipose tissue from obese rats. Proteomics 2005, 5 (18), 4927–35. (4) Bastard, J. P.; Maachi, M.; Lagathu, C.; Kim, M. J.; Caron, M.; Vidal, H.; Capeau, J.; Feve, B. Recent advances in the relationship between obesity, inflammation, and insulin resistance. Eur. Cytokine. Network 2006, 17 (1), 4–12. (5) Palomo, I.; Alarcon, M.; Moore-Carrasco, R.; Argiles, J. M. Hemostasis alterations in metabolic syndrome (review). Int. J. Mol. Med. 2006, 18 (5), 969–74. (6) Mercader, J.; Ribot, J.; Murano, I.; Felipe, F.; Cinti, S.; Bonet, M. L.; Palou, A. Remodeling of white adipose tissue after retinoic acid administration in mice. Endocrinology 2006, 147 (11), 5325–32. (7) Maeda, H.; Hosokawa, M.; Sashima, T.; Miyashita, K. Dietary combination of fucoxanthin and fish oil attenuates the weight gain

(23) (24) (25) (26)

(27)

(28)

(29)

of white adipose tissue and decreases blood glucose in obese/ diabetic KK-Ay mice. J. Agric. Food Chem. 2007, 55 (19), 7701–6. Walker, C. G.; Zariwala, M. G.; Holness, M. J.; Sugden, M. C. Diet, obesity and diabetes: a current update. Clin. Sci. (London) 2007, 112 (2), 93–111. Backonja, M.; Wallace, M. S.; Blonsky, E. R.; Cutler, B. J.; Malan, P., Jr.; Rauck, R.; Tobias, J. NGX-4010, a high-concentration capsaicin patch, for the treatment of postherpetic neuralgia: a randomised, double-blind study. Lancet Neurol. 2008, 7 (12), 1106– 12. Mori, A.; Lehmann, S.; O’Kelly, J.; Kumagai, T.; Desmond, J. C.; Pervan, M.; McBride, W. H.; Kizaki, M.; Koeffler, H. P. Capsaicin, a component of red peppers, inhibits the growth of androgenindependent, p53 mutant prostate cancer cells. Cancer Res. 2006, 66 (6), 3222–9. Chou, C. C.; Wu, Y. C.; Wang, Y. F.; Chou, M. J.; Kuo, S. J.; Chen, D. R. Capsaicin-induced apoptosis in human breast cancer MCF-7 cells through caspase-independent pathway. Oncol. Rep. 2009, 21 (3), 665–71. Baek, Y. M.; Hwang, H. J.; Kim, S. W.; Hwang, H. S.; Lee, S. H.; Kim, J. A.; Yun, J. W. A comparative proteomic analysis for capsaicin-induced apoptosis between human hepatocarcinoma (HepG2) and human neuroblastoma (SK-N-SH) cells. Proteomics 2008, 8 (22), 4748–67. Surh, Y. J. Anti-tumor promoting potential of selected spice ingredients with antioxidative and anti-inflammatory activities: a short review. Food Chem. Toxicol. 2002, 40 (8), 1091–7. Reinbach, H. C.; Smeets, A.; Martinussen, T.; Moller, P.; WesterterpPlantenga, M. S. Effects of capsaicin, green tea and CH-19 sweet pepper on appetite and energy intake in humans in negative and positive energy balance. Clin. Nutr. 2009, 28 (3), 260–5. Kawada, T.; Hagihara, K.; Iwai, K. Effects of capsaicin on lipid metabolism in rats fed a high fat diet. J. Nutr. 1986, 116 (7), 1272–8. Caterina, M. J.; Schumacher, M. A.; Tominaga, M.; Rosen, T. A.; Levine, J. D.; Julius, D. The capsaicin receptor: a heat-activated ion channel in the pain pathway. Nature 1997, 389 (6653), 816– 24. Zhang, L. L.; Yan Liu, D.; Ma, L. Q.; Luo, Z. D.; Cao, T. B.; Zhong, J.; Yan, Z. C.; Wang, L. J.; Zhao, Z. G.; Zhu, S. J.; Schrader, M.; Thilo, F.; Zhu, Z. M.; Tepel, M. Activation of transient receptor potential vanilloid type-1 channel prevents adipogenesis and obesity. Circ. Res. 2007, 100 (7), 1063–70. Kozak, L. P.; Anunciado-Koza, R. UCP1: its involvement and utility in obesity. Int. J. Obes. (Lond). 2008, 32, S32–8. Kontani, Y.; Wang, Y.; Kimura, K.; Inokuma, K. I.; Saito, M.; SuzukiMiura, T.; Wang, Z.; Sato, Y.; Mori, N.; Yamashita, H. UCP1 deficiency increases susceptibility to diet-induced obesity with age. Aging Cell 2005, 4 (3), 147–55. Enerback, S.; Jacobsson, A.; Simpson, E. M.; Guerra, C.; Yamashita, H.; Harper, M. E.; Kozak, L. P. Mice lacking mitochondrial uncoupling protein are cold-sensitive but not obese. Nature 1997, 387 (6628), 90–4. Liu, X.; Rossmeisl, M.; McClaine, J.; Riachi, M.; Harper, M. E.; Kozak, L. P. Paradoxical resistance to diet-induced obesity in UCP1-deficient mice. J. Clin. Invest. 2003, 111 (3), 399–407. Echtay, K. S.; Roussel, D.; St-Pierre, J.; Jekabsons, M. B.; Cadenas, S.; Stuart, J. A.; Harper, J. A.; Roebuck, S. J.; Morrison, A.; Pickering, S.; Clapham, J. C.; Brand, M. D. Superoxide activates mitochondrial uncoupling proteins. Nature 2002, 415 (6867), 96–9. Krauss, S.; Zhang, C. Y.; Lowell, B. B. The mitochondrial uncouplingprotein homologues. Nat. Rev. Mol. Cell Biol. 2005, 6 (3), 248–61. Argyropoulos, G.; Harper, M. E. Uncoupling proteins and thermoregulation. J. Appl. Physiol. 2002, 92 (5), 2187–98. Cinti, S. Adipocyte differentiation and transdifferentiation: plasticity of the adipose organ. J. Endocrinol. Invest. 2002, 25 (10), 823– 35. Oberkofler, H.; Dallinger, G.; Liu, Y. M.; Hell, E.; Krempler, F.; Patsch, W. Uncoupling protein gene: quantification of expression levels in adipose tissues of obese and non-obese humans. J. Lipid Res. 1997, 38 (10), 2125–33. Cabrero, A.; Alegret, M.; Sanchez, R. M.; Adzet, T.; Laguna, J. C.; Vazquez, M. Bezafibrate reduces mRNA levels of adipocyte markers and increases fatty acid oxidation in primary culture of adipocytes. Diabetes 2001, 50 (8), 1883–90. Orci, L.; Cook, W. S.; Ravazzola, M.; Wang, M. Y.; Park, B. H.; Montesano, R.; Unger, R. H. Rapid transformation of white adipocytes into fat-oxidizing machines. Proc. Natl. Acad. Sci. U.S.A. 2004, 101 (7), 2058–63. Flachs, P.; Horakova, O.; Brauner, P.; Rossmeisl, M.; Pecina, P.; Franssen-van Hal, N.; Ruzickova, J.; Sponarova, J.; Drahota, Z.;

Journal of Proteome Research • Vol. 9, No. 6, 2010 2985

research articles

(30)

(31)

(32)

(33)

(34) (35)

(36) (37)

(38)

(39)

(40)

(41) (42) (43) (44) (45)

(46)

(47)

(48) (49)

(50)

2986

Vlcek, C.; Keijer, J.; Houstek, J.; Kopecky, J. Polyunsaturated fatty acids of marine origin upregulate mitochondrial biogenesis and induce beta-oxidation in white fat. Diabetologia 2005, 48 (11), 2365–75. Kawada, T.; Watanabe, T.; Takaishi, T.; Tanaka, T.; Iwai, K. Capsaicin-induced beta-adrenergic action on energy metabolism in rats: influence of capsaicin on oxygen consumption, the respiratory quotient, and substrate utilization. Proc. Soc. Exp. Biol. Med. 1986, 183 (2), 250–6. Watanabe, T.; Kawada, T.; Yamamoto, M.; Iwai, K. Capsaicin, a pungent principle of hot red pepper, evokes catecholamine secretion from the adrenal medulla of anesthetized rats. Biochem. Biophys. Res. Commun. 1987, 142 (1), 259–64. Jimenez, M.; Leger, B.; Canola, K.; Lehr, L.; Arboit, P.; Seydoux, J.; Russell, A. P.; Giacobino, J. P.; Muzzin, P.; Preitner, F. β1/β2/β3adrenoceptor knockout mice are obese and cold-sensitive but have normal lipolytic responses to fasting. FEBS Lett. 2002, 530 (1-3), 37–40. Diepvens, K.; Westerterp, K. R.; Westerterp-Plantenga, M. S. Obesity and thermogenesis related to the consumption of caffeine, ephedrine, capsaicin, and green tea. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2007, 292 (1), R77–85. Bottcher, H.; Furst, P. Decreased white fat cell thermogenesis in obese individuals. Int. J. Obes. Relat. Metab. Disord. 1997, 21 (6), 439–44. Semple, R. K.; Crowley, V. C.; Sewter, C. P.; Laudes, M.; Christodoulides, C.; Considine, R. V.; Vidal-Puig, A.; O’Rahilly, S. Expression of the thermogenic nuclear hormone receptor coactivator PGC-1alpha is reduced in the adipose tissue of morbidly obese subjects. Int. J. Obes. Relat. Metab. Disord. 2004, 28 (1), 176–9. Yang, X.; Enerback, S.; Smith, U. Reduced expression of FOXC2 and brown adipogenic genes in human subjects with insulin resistance. Obes. Res. 2003, 11 (10), 1182–91. Kumar, S. G.; Rahman, M. A.; Lee, S. H.; Hwang, H. S.; Kim, H. A.; Yun, J. W. Plasma proteome analysis for anti-obesity and antidiabetic potentials of chitosan oligosaccharides in ob/ob mice. Proteomics 2009, 9 (8), 2149–62. Byun, H. O.; Han, N. K.; Lee, H. J.; Kim, K. B.; Ko, Y. G.; Yoon, G.; Lee, Y. S.; Hong, S. I.; Lee, J. S. Cathepsin D and eukaryotic translation elongation factor 1 as promising markers of cellular senescence. Cancer Res. 2009, 69 (11), 4638–47. Schaub, N. P.; Jones, K. J.; Nyalwidhe, J. O.; Cazares, L. H.; Karbassi, I. D.; Semmes, O. J.; Feliberti, E. C.; Perry, R. R.; Drake, R. R. Serum proteomic biomarker discovery reflective of stage and obesity in breast cancer patients. J. Am. Coll. Surg. 2009, 208 (5), 970–8. Sharma, A.; Chavali, S.; Mahajan, A.; Tabassum, R.; Banerjee, V.; Tandon, N.; Bharadwaj, D. Genetic association, post-translational modification, and protein-protein interactions in Type 2 diabetes mellitus. Mol. Cell. Proteomics 2005, 4 (8), 1029–37. Park, J. Y.; Seong, J. K.; Paik, Y. K. Proteomic analysis of dietinduced hypercholesterolemic mice. Proteomics 2004, 4 (2), 514– 23. Veenstra, T. D.; Conrads, T. P.; Hood, B. L.; Avellino, A. M.; Ellenbogen, R. G.; Morrison, R. S. Biomarkers: mining the biofluid proteome. Mol. Cell. Proteomics 2005, 4 (4), 409–18. Hanash, S. Disease proteomics. Nature 2003, 422 (6928), 226–32. Shevchenko, A.; Tomas, H.; Havlis, J.; Olsen, J. V.; Mann, M. Ingel digestion for mass spectrometric characterization of proteins and proteomes. Nat. Protoc. 2006, 1 (6), 2856–60. Kim, S. W.; Hwang, H. J.; Cho, E. J.; Oh, J. Y.; Baek, Y. M.; Choi, J. W.; Yun, J. W. Time-dependent plasma protein changes in streptozotocin-induced diabetic rats before and after fungal polysaccharide treatments. J. Proteome Res. 2006, 5 (11), 2966–76. Yang, Y.; Shang, W.; Zhou, L.; Jiang, B.; Jin, H.; Chen, M. Emodin with PPARgamma ligand-binding activity promotes adipocyte differentiation and increases glucose uptake in 3T3-Ll cells. Biochem. Biophys. Res. Commun. 2007, 353 (2), 225–30. DeLany, J. P.; Floyd, Z. E.; Zvonic, S.; Smith, A.; Gravois, A.; Reiners, E.; Wu, X.; Kilroy, G.; Lefevre, M.; Gimble, J. M. Proteomic analysis of primary cultures of human adipose-derived stem cells: modulation by Adipogenesis. Mol. Cell. Proteomics 2005, 4 (6), 731–40. Kaplan, M. L.; Leveille, G. A. Development of lipogenesis and insulin sensitivity in tissues of the ob/ob mouse. Am. J. Physiol. 1981, 240 (2), 101–7. Gaikwad, A.; Long, D. J., 2nd; Stringer, J. L.; Jaiswal, A. K. In vivo role of NAD(P)H:quinone oxidoreductase 1 (NQO1) in the regulation of intracellular redox state and accumulation of abdominal adipose tissue. J. Biol. Chem. 2001, 276 (25), 22559–64. Martin, L. F.; Patrick, S. D.; Wallin, R. DT-diaphorase in morbidly obese patients. Cancer Lett. 1987, 36 (3), 341–7.


Joo et al. (51) Siegel, D.; Franklin, W. A.; Ross, D. Immunohistochemical detection of NAD(P)H:quinone oxidoreductase in human lung and lung tumors. Clin. Cancer Res. 1998, 4 (9), 2065–70. (52) Lieber, J. G.; Evans, R. M. Disruption of the vimentin intermediate filament system during adipose conversion of 3T3-L1 cells inhibits lipid droplet accumulation. J. Cell Sci. 1996, 109 (13), 3047–58. (53) Franke, W. W.; Hergt, M.; Grund, C. Rearrangement of the vimentin cytoskeleton during adipose conversion: formation of an intermediate filament cage around lipid globules. Cell 1987, 49 (1), 131– 41. (54) Young, J. C.; Agashe, V. R.; Siegers, K.; Hartl, F. U. Pathways of chaperone-mediated protein folding in the cytosol. Nat. Rev. Mol. Cell Biol. 2004, 5 (10), 781–91. (55) Cherian, M.; Abraham, E. C. Diabetes affects alpha-Crystallin chaperone function. Biochem. Biophys. Res. Commun. 1995, 212 (1), 184–9. (56) Kumar, M. S.; Reddy, P. Y.; Kumar, P A.; Surolia, I.; Reddy, G. B. Effect of dicarbonyl-induced browning on alpha-Crystallin chaperone-like activity: physiological significance and caveats of in vitro aggregation assays. Biochem. J. 2004, 379 (2), 273–82. (57) Kurucz, I.; Morva, A.; Vaag, A.; Eriksson, K. F.; Huang, X.; Groop, L.; Koranyi, L. Decreased expression of heat shock protein 72 in skeletal muscle of patients with type 2 diabetes correlates with insulin resistance. Diabetes 2002, 51 (4), 1102–9. (58) Yeh, W. C.; Li, T. K.; Bierer, B. E.; McKnight, S. L. Identification and characterization of an immunophilin expressed during the clonal expansion phase of adipocyte differentiation. Proc. Natl. Acad. Sci. U.S.A. 1995, 92 (24), 11081–5. (59) Bohren, K. M.; Bullock, B.; Wermuth, B.; Gabbay, K. H. The aldoketo reductase superfamily. cDNAs and deduced amino acid sequences of human aldehyde and aldose reductases. J. Biol. Chem. 1989, 264 (16), 9547–51. (60) Donaghue, K. C.; Margan, S. H.; Chan, A. K.; Holloway, B.; Silink, M.; Rangel, T.; Bennetts, B. The association of aldose reductase gene (AKR1B1) polymorphisms with diabetic neuropathy in adolescents. Diabet. Med. 2005, 22 (10), 1315–20. (61) Tirard, J.; Gout, J.; Lefrancois-Martinez, A. M.; Martinez, A.; Begeot, M.; Naville, D. A novel inhibitory protein in adipose tissue, the aldo-keto reductase AKR1B7: its role in adipogenesis. Endocrinology 2007, 148 (5), 1996–2005. (62) Kang, S. W.; Chae, H. Z.; Seo, M. S.; Kim, K.; Baines, I. C.; Rhee, S. G. Mammalian peroxiredoxin isoforms can reduce hydrogen peroxide generated in response to growth factors and tumor necrosis factor-alpha. J. Biol. Chem. 1998, 273 (11), 6297–302. (63) Cha, M. K.; Suh, K. H.; Kim, I. H. Overexpression of peroxiredoxin I and thioredoxin1 in human breast carcinoma. J. Exp. Clin. Cancer Res. 2009, 28, 93. (64) Chae, H. Z.; Robison, K.; Poole, L. B.; Church, G.; Storz, G.; Rhee, S. G. Cloning and sequencing of thiol-specific antioxidant from mammalian brain: alkyl hydroperoxide reductase and thiol-specific antioxidant define a large family of antioxidant enzymes. Proc. Natl. Acad. Sci. U.S.A. 1994, 91 (15), 7017–21. (65) Matejkova, O.; Mustard, K. J.; Sponarova, J.; Flachs, P.; Rossmeisl, M.; Miksik, I.; Thomason-Hughes, M.; Grahame Hardie, D.; Kopecky, J. Possible involvement of AMP-activated protein kinase in obesity resistance induced by respiratory uncoupling in white fat. FEBS Lett. 2004, 569 (1-3), 245–8. (66) Daval, M.; Foufelle, F.; Ferre, P. Functions of AMP-activated protein kinase in adipose tissue. J. Physiol. 2006, 574 (1), 55–62. (67) Rossmeisl, M.; Barbatelli, G.; Flachs, P.; Brauner, P.; Zingaretti, M. C.; Marelli, M.; Janovska, P.; Horakova, M.; Syrovy, I.; Cinti, S.; Kopecky, J. Expression of the uncoupling protein 1 from the aP2 gene promoter stimulates mitochondrial biogenesis in unilocular adipocytes in vivo. Eur. J. Biochem. 2002, 269 (1), 19–28. (68) Prpic, V.; Watson, P. M.; Frampton, I. C.; Sabol, M. A.; Jezek, G. E.; Gettys, T. W. Adaptive changes in adipocyte gene expression differ in AKR/J and SWR/J mice during diet-induced obesity. J. Nutr. 2002, 132 (11), 3325–32. (69) Surwit, R. S.; Wang, S.; Petro, A. E.; Sanchis, D.; Raimbault, S.; Ricquier, D.; Collins, S. Diet-induced changes in uncoupling proteins in obesity-prone and obesity-resistant strains of mice. Proc. Natl. Acad. Sci. U.S.A. 1998, 95 (7), 4061–5. (70) Watson, P. M.; Commins, S. P.; Beiler, R. J.; Hatcher, H. C.; Gettys, T. W. Differential regulation of leptin expression and function in A/J vs. Am. J. Physiol. Endocrinol. Metab. 2000, 279 (2), E356–65. (71) Tiraby, C.; Tavernier, G.; Lefort, C.; Larrouy, D.; Bouillaud, F.; Ricquier, D.; Langin, D. Acquirement of brown fat cell features by human white adipocytes. J. Biol. Chem. 2003, 278 (35), 33370–6. (72) Spiegelman, B. M.; Puigserver, P.; Wu, Z. Regulation of adipogenesis and energy balance by PPARgamma and PGC-1. Int. J. Obes. Relat. Metab. Disord. 2000, 24, S8–10.

research articles

Antiobesity Potential of Capsaicin on White Adipose Tissue (73) Puigserver, P.; Pico´, C.; Stock, M. J.; Palou, A. Effect of selective beta-adrenoceptor stimulation on UCP synthesis in primary cultures of brown adipocytes. Mol. Cell. Endocrinol. 1996, 117 (1), 7–16. (74) Kobayashi, A.; Osaka, T.; Namba, Y.; Inoue, S.; Lee, T. H.; Kimura, S. Capsaicin activates heat loss and heat production simultaneously and independently in rats. Am. J. Physiol. 1998, 275 (12), 92–8. (75) Masuda, Y.; Haramizu, S.; Oki, K.; Ohnuki, K.; Watanabe, T.; Yazawa, S.; Kawada, T.; Hashizume, S.; Fushiki, T. Upregulation of uncoupling proteins by oral administration of capsiate, a nonpungent capsaicin analog. J. Appl. Physiol. 2003, 95 (6), 2408– 15. (76) Osaka, T.; Kobayashi, A.; Namba, Y.; Ezaki, O.; Inoue, S.; Kimura, S.; Lee, T. H. Temperature- and capsaicin-sensitive nerve fibers in brown adipose tissue attenuate thermogenesis in the rat. Pflugers Arch. 1998, 437 (1), 36–42. (77) Giordano, A.; Morroni, M.; Carle, F.; Gesuita, R.; Marchesi, G. F.; Cinti, S. Sensory nerves affect the recruitment and differentiation of rat periovarian brown adipocytes during cold acclimation. J. Cell Sci. 1998, 111 (17), 2587–94. (78) Fleury, C.; Neverova, M.; Collins, S.; Raimbault, S.; Champigny, O.; Levi-Meyrueis, C.; Bouillaud, F.; Seldin, M. F.; Surwit, R. S.; Ricquier, D.; Warden, C. H. Uncoupling protein-2: a novel gene linked to obesity and hyperinsulinemia. Nat. Genet. 1997, 15 (3), 269–72. (79) Arsenijevic, D.; Onuma, H.; Pecqueur, C.; Raimbault, S.; Manning, B. S.; Miroux, B.; Couplan, E.; Alves-Guerra, M. C.; Goubern, M.; Surwit, R.; Bouillaud, F.; Richard, D.; Collins, S.; Ricquier, D. Disruption of the uncoupling protein-2 gene in mice reveals a role in immunity and reactive oxygen species production. Nat. Genet. 2000, 26 (4), 435–9. (80) Negre-Salvayre, A.; Hirtz, C.; Carrera, G.; Cazenave, R.; Troly, M.; Salvayre, R.; Penicaud, L.; Casteilla, L. A role for uncoupling protein-2 as a regulator of mitochondrial hydrogen peroxide generation. FASEB J. 1997, 11 (10), 809–15.

(81) Blanc, J.; Alves-Guerra, M. C.; Esposito, B.; Rousset, S.; Gourdy, P.; Ricquier, D.; Tedgui, A.; Miroux, B.; Mallat, Z. Protective role of uncoupling protein 2 in atherosclerosis. Circulation 2003, 107 (3), 388–90. (82) Duval, C.; Negre-Salvayre, A.; Dogilo, A.; Salvayre, R.; Penicaud, L.; Casteilla, L. Increased reactive oxygen species production with antisense oligonucleotides directed against uncoupling protein 2 in murine endothelial cells. Biochem. Cell Biol. 2002, 80 (6), 757– 64. (83) Mattiasson, G.; Shamloo, M.; Gido, G.; Mathi, K.; Tomasevic, G.; Yi, S.; Warden, C. H.; Castilho, R. F.; Melcher, T.; Gonzalez-Zulueta, M.; Nikolich, K.; Wieloch, T. Uncoupling protein-2 prevents neuronal death and diminishes brain dysfunction after stroke and brain trauma. Nat. Med. 2003, 9 (8), 1062–8. (84) Farmer, S. R. Transcriptional control of adipocyte formation. Cell Metab. 2006, 4 (4), 263–73. (85) Zhang, Y.; Proenca, R.; Maffei, M.; Barone, M.; Leopold, L.; Friedman, J. M. Positional cloning of the mouse obese gene and its human homologue. Nature 1994, 372 (6505), 425–32. (86) Margetic, S.; Gazzola, C.; Pegg, G. G.; Hill, R. A. Leptin: a review of its peripheral actions and interactions. Int. J. Obes. Relat. Metab. Disord. 2002, 26 (11), 1407–33. (87) Seufert, J. Leptin effects on pancreatic beta-cell gene expression and function. Diabetes 2004, 53, 152–8. (88) Cawthorn, W. P.; Sethi, J. K. TNF-alpha and adipocyte biology. FEBS. Lett. 2008, 582 (1), 117–31. (89) Hotamisligil, G. S.; Shargill, N. S.; Spiegelman, B. M. Adipose expression of tumor necrosis factor-alpha: direct role in obesitylinked insulin resistance. Science 1993, 259 (5091), 87–91. (90) Hotamisligil, G. S.; Arner, P.; Caro, J. F.; Atkinson, R. L.; Spiegelman, B. M. Increased adipose tissue expression of tumor necrosis factoralpha in human obesity and insulin resistance. J. Clin. Invest. 1995, 95 (5), 2409–15.

PR901175W

Journal of Proteome Research • Vol. 9, No. 6, 2010 2987

Proteomic Analysis for Antiobesity Potential of ... - ACS Publications

Recommend Documents