Proteomic Analysis of Clinical Isolate of ... - ACS Publications

Jun 15, 2012 - Proteomic Analysis of Clinical Isolate of Stenotrophomonas maltophilia with blaNDM‑1, blaL1 and blaL2 β-Lactamase Genes under. Imipe...
0 downloads 0 Views 3MB Size
Download PDF
Article pubs.acs.org/jpr

Proteomic Analysis of Clinical Isolate of Stenotrophomonas maltophilia with blaNDM‑1, blaL1 and blaL2 β-Lactamase Genes under Imipenem Treatment Wei Liu,†,# Dayang Zou,†,# Xuesong Wang,†,# XueLian Li,†,# Li Zhu,§ Zhitao Yin,† Zhan Yang,† Xiao Wei,† Li Han,† Yufei Wang,† Changlin Shao,† Simiao Wang,† Xiang He,† Dawei Liu,† Feng Liu,‡ Jie Wang,‡ Liuyu Huang,*,† and Jing Yuan*,† †

Institute of Disease Control and Prevention, Academy of Military Medical Sciences, Beijing, China National Center of Biomedical Analysis, Beijing, China § Beijing Institute of Biotechnology, State Key Laboratory of Pathogens and Biosecurity, 100071 Beijing, China ‡

S Supporting Information *

ABSTRACT: The co-occurrence of L1 and AmpR-L2 with blaNDM‑1 gene with an upstream 250-bp promoter was detected in a clinical isolate of Stenotrophomonas maltophilia DCPS-01, which was resistant to all β-lactams and sensitive only to colistin and fluoroquinolones. To investigate expression of resistance genes and the molecular mechanisms of bacteria resistance to carbapenems, proteomic profiles of the isolate was passaged with and without the drug by using 2D-PAGE. The results showed that 33 genes exhibiting a ≥3-fold change were identified as candidates that may help S. maltophilia survive drug selection. Strikingly, L1 was expressed more highly in cells grown with imipenem, and the abundant NDM1 further increased, while very little L2 was detected even following induction. Specific activities for β-lactamase revealed that L2 remained at constitutive low levels (10.6 U/mg), while L1 and NDM-1 showed clear activity (69.8 U/mg). Our data support that imipenem could specifically and reversibly induce L1 and NDM-1, which together played key roles in drug resistance in DCPS-01. Although NDM-1 mediated resistance to carbapenems has been found in very few cases, to our knowledge, this is the first proteomics research of S. maltophilia with NDM-1, giving very broad-spectrum antibiotic resistance profiles. KEYWORDS: Stenotrophomonas maltophilia DCPS-01, β-lactams resistance, co-occurrence, blaNDM‑1, L1 and L2 metallo-β-lactamase

■

INTRODUCTION In the most recent reports of “superbugs” in the professional and lay literature, the occurrence of the New Delhi metallobetaβ-lactamase 1 (blaNDM‑1) gene, which renders bacteria resistant to β-lactam antibiotics, is becoming a cause for public health concern worldwide. Klebsiella pneumoniae containing the NDM-1 gene was first discovered in 2008.1 Subsequently, carbapenem-resistant Enterobacteriaceae, including Klebsiella species, Escherichia coli, Enterobacter species, Acinetobacter baumannii and Morganella morganii, were identified and characterized. The plasmid has spread rapidly among the Enterobacteriaceae strains in the United States, Israel, Turkey, China, India, Australia, France, Japan, Kenya, Singapore, Taiwan and the Nordic countries.2−5 Moreover, clinical isolates have been found to carry mixed carbapenemase genes, giving very broad-spectrum antibiotic resistance profiles. The emergence of these powerful resistance mechanisms resulting © 2012 American Chemical Society

from co-occurrence of genes described as metallo-β-lactamases (MBLs) with blaNDM‑1 will seriously limit future therapeutic options. Stenotrophomonas maltophilia is a nonfermentative, Gramnegative rod, aerobic bacillus that has become an increasing nosocomial threat to human health. Pathogenic strains are associated with a wide spectrum of disease, although infection is typically restricted to hospitalized patients who are immunocompromised, have pneumonia and bacteremia or are otherwise severely debilitated.6−8 S. maltophilia colonization and infection in patients with cancer have significantly increased over the past 2 decades. Patients with prolonged neutropenia, exposure to broad-spectrum antibiotics and those requiring mechanical ventilation have an even higher risk of Received: January 19, 2012 Published: June 15, 2012 4024

dx.doi.org/10.1021/pr300062v | J. Proteome Res. 2012, 11, 4024−4033

Journal of Proteome Research

Article

onto MacConkey medium containing sodium azide (200 μg/ mL) and imipenem (5 μg/mL) and incubated at 37 °C for 24 h. Confirmation that conjugation had taken place in the recipient was carried out by testing for the presence of MBL genes by PCR. Moreover, nine enteric pathogens (Salmonella enteritidis, S. paratyphi A, S. flexneri, S. snnei, S. boydii, and EPEC, ETEC, EIEC, EPEC) were used in the conjugation to detect whether or not resistant genes could transform into enteric pathogens. The conjugates were separated by immunomagnetic beads (IMBS, Estapor Merck, France) separation techniques for nine enteric pathogens, then selected on SS and MacConkey agar mediums (BD DIFCO, USA.) with imipenem. All of the conjugates were identified by PCR for blaL1, blaL2 and blaNDM‑1.

infection. The production of carbapenemases is the most common mechanism responsible for carbapenem resistance in S. maltophilia, which produces two inducible L1 and L2 enzymes.6 L1, an ampR-unlinked molecular class B and functional group 3 β-lactamase, is a Zn2+-β-dependent metalloenzyme with a broad substrate profile including penicillins, cephalosporins and carbapenems.9 L2, an ampR-linked class A β-lactamase (L2), displays hydrolytic ability toward penicillins, cephalosporins and monobactams.10 Because of production of these two chromosomally encoded β-lactamases, S. maltophilia is inherently resistant to a wide range of β-lactams.11 To date, the genetic apparatus responsible for chromosomal class βlactamase induction has not been fully characterized. In the present work, we report on the biochemical and proteomic characterization of a clinical isolate of S. maltophilia in China with L1 and L2 β-lactamase genes co-occurring with blaNDM‑1. The mechanism responsible for the carbapenem resistance was also examined. This report provides new insights into the mechanisms of drug resistance and warning that future therapeutic options may be seriously limited.

■

DNA Cloning, Sequencing, Expression, Antibody Preparation, and Western Blot

Cloning experiments were performed as described previously.17 The PCR-amplified open reading frame of blaNDM‑1 was digested with BamHI and XhoI and subsequently ligated into the pET32a (six-His fusion vector) and pGEX-4T (GST fusion vector) bacterial expression vectors. The construct was transformed into E. coli DH5α or BL21 (Invitrogen Ltd., Paisley, United Kingdom). Transformants were selected on LB agar plates containing 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (30 μg/mL), imipenem (64 μg/mL) and ampicillin (25 μg/mL). The cloned inserts containing blaNDM‑1, blaL1 and blaL2 β-lactamase genes were fully sequenced. To generate polyclonal antibodies, purified His-tagged L2 protein was injected subcutaneously into BALB/c female mice. Sera from the immunized mice were collected and purified using an Immobilized Protein A kit (Pierce) according to the manufacturer’s instructions. Anti-NDM-1 antibody was kindly provided by Tianjin Kangerke bioscience Co. Ltd., China. Total cell proteins or periplasmic proteins were separated by PAGE and transferred to nitrocellulose membrane (Hybond protein; 0.2-mm pore size) by electroblotting. Immunoblotting analysis was performed using a 1/5000 dilution of a polyclonal serum raised against the anti-L2, or using anti-GST or anti-NDM-1 antibodies, and GST-vector was used as negative control.

MATERIALS AND METHODS

Bacterial Strains

The S. maltophilia DCPS-01 isolate from a clinical patient was kindly provided by the 307th hospital in China. Species identification of S. maltophilia DCPS-01 was carried out using an automated system (Phoenix and BD systems). The strain was subjected to MHT and imipenem-EDTA DDST as well as Etest (AB bioMerieux, Solna, Sweden) for detection of MBL production as previously described by Noyal et al.12 S. maltophilia K279a with the typical antimicrobial resistance properties was used as control. E. coli J53 and nine enteric pathogens (Salmonella enteritidis, S. paratyphi A, S. f lexneri, S. snnei, S. boydii, and EPEC, ETEC, EIEC, EPEC) were used in the conjugation. E. coli DH5α and BL21 (Strategene, Amsterdam, Netherlands) were used in cloning experiments. Phenotypic and Molecular Detection of MBL

The carbapenemase activities of cell sonicates from overnight LB broth cultures were determined by spectrophotometric assays.13 These were undertaken by using 150 μM imipenem as the substrate and 299 nm for the measurement of hydrolysis. The assays were performed with or without EDTA (25 mM) to examine the inhibition of carbapenemase activity. All antibiotics were purchased from Sigma (St. Louis, MO, USA). The MICs of cefepime, imipenem, Meropenem, ticarcillin-clav, ceftazidime, minocycline, levo, trim/Sul, and chloramphenicole were quantified using Etest strips according to the manufacturer’s instructions, while tigecycline MICs were determined using the EUCAST disk diffusion test based on MH-media. The strain was screened for the presence of known MBL genes (blaVIM, blaIMP, blaSPM‑1, blaGIM‑1, blaSIM‑1, blaAIM‑1 and blaNDM‑1) by PCR with primers as reported previously.14 The strain was also screened for the presence of other β-lactamase genes (blaCTX, blaCMY, etc.) as well as class 1, 2, and 3 integron structures.15

PFGE, Genomic DNA Digestion with Endonucleases, and MLST Analysis

Genomic DNA of S. maltophilia DCPS-01 was prepared in agarose blocks and digested with the restriction enzymes XbaI, ApaI, SpeI (Roche Diagnostics, Mannheim, Germany) and S1 nuclease (Invitrogen, Abingdon, United Kingdom). The DNA fragments were separated by use of a CHEF-DR III apparatus (Bio-Rad, Hercules, CA) for 20 h at 6 V/cm and 14 °C with initial and final pulse times of 0.5 and 30 s, respectively. Genomic DNA was extracted from S. maltophilia DCPS-01 by using a Genomic DNA Prep Kit (TIANGEN Biotech Co., Ltd., Beijing, China). PCR was performed using 65 ng of the template DNA (TIANGEN Biotech Co., Ltd., Beijing, China), 2.5 μL of 10 × Taq buffer, 0.5 μL of 10 mM dNTP mix, 20 pmol of each primer, and 0.7 U of Taq DNA Polymerase in a total volume of 25 μL. Internal fragments of 7 house-keeping genes (atpD, gapA, guaA, mutM, nuoD, ppsA, and recA) were amplified by using the following steps: predenaturation of the reaction mixture for 9 min at 95 °C; 30 cycles of 20S at 94 °C, 1 min at appropriate annealing temperature, and 50S at 72 °C; and final elongation for 5 min at 72 °C. The amplicons were purified using a PCR Purification Kit (TIANGEN Biotech Co., Ltd., Beijing, China) and sequenced by Beijing AuGCT DNA-

Conjugation

Conjugal transfer of blaNDM‑1 was screened by filter mating at a 1:10 donor−recipient ratio using E. coli J53 and nine types of enteric pathogens as recipient, and mating was carried out on blood agar medium without selection.16 After 18 h, the mixed cultures were taken from the plates, suspended in saline, plated 4025

dx.doi.org/10.1021/pr300062v | J. Proteome Res. 2012, 11, 4024−4033

Journal of Proteome Research

Article

were compared. The relative volume of each spot was determined from the spot intensities in pixel units and normalized to the sum of the intensities of all the spots on the gel. The best three images obtained from one sample were used for quantitative analysis. Proteins were considered differentially expressed if their relative volume deviated more than 3-fold. Each experiment was performed at least three times.

SYN Biotechnology Co., Ltd. The allele number for each gene was assigned on the basis of the information in the S. maltophilia MLST database (http://pubmlst.org/smaltophilia/ ). A combination of the allelic sequences of the 7 genes yielded the allelic profile. Southern Blot Analysis

Southern blotting was performed on agarose gels by in-gel hybridization with the blaNDM‑1 probe labeled with DIG (Roche) and by a recently described random primer method.14

MALDI-TOF/TOF MS

MALDI-TOF/TOF MS measurements were performed on a Bruker Ultraflex III MALDI-TOF/TOF MS (Bruker Daltonics, Germany) operating in reflectron mode with 20 kV accelerating voltage and 23 kV reflecting voltage. A saturated solution of αcyano-4-hydroxycinnamic acid in 50% acetonitrile and 0.1% trifluoroacetic acid was used as the matrix. One microliter of the matrix solution and sample solution at a ratio of 1:1 was applied onto the Score384 target well. Series of eight samples are spotted around one external calibration mixture. Mass accuracy for peptide mass fingerprints (PMF) analysis was calibrated with a 0.1−0.2 Da external standard, and internal calibration was carried out with enzyme autolysis peaks, resolution at 12 000. The SNAP algorithm (S/N threshold: 5; Quality Factor Threshold: 30) in FlexAnalysis 3.4 was used to pick up the 150 most prominent peaks in the mass range m/z 1000−4000. The subsequent MS/MS analysis was performed in a datadependent manner, and the 5 most abundant ions were subjected to high energy CID analysis. The collision energy was set to 1 keV, and nitrogen was used as the collision gas.

Two-Dimensional Polyacrylamide Gel Electrophoresis

Stationary cultures of S. maltophilia DCPS-01 were diluted 1:50 in brain heart infusion (BHI) medium (Difco) with or without imipenem on a rotary shaker (300 rpm) at 37 °C as previously described by Yuan et al.18 The final concentration of imipenem was 64 μg/mL, which is half of the MIC for S. maltophilia DCPS-01. To analyze expression of imipenem-induced resistance genes, S. maltophilia DCPS-01 was grown in 400 mL of BHI containing imipenem for 8 h (early exponential phase), 12 h (midexponential phase) and 16 h (end of exponential phase). In the concentration series experiments, S. maltophilia DCPS01 cells were grown in BHI supplemented with imipenem at 0, 32, 64, or 96 μg/mL, respectively. For specificity and reversibility testing of imipenem-induced resistance genes in S. maltophilia DCPS-01, cultures were diluted 50× and grown in 400 mL of BHI with or without imipenem, as described above, for 6 h. Subsequently, each bacterial culture was washed twice with prewarmed PBS and resuspended in 400 mL of fresh BHI, and the cells were split into two cultures. Imipenem was added to one of the cultures at a final concentration of 64 μg/mL, and both cultures were then incubated further for 6 h. Finally, the cells were centrifuged for 10 min at 8000g in a Sigma 3K12 centrifuge (Sigma, St. Louis, MO, USA) and washed 4 times with 40 mL of ice-cold low-salt wash buffer (3 mM KCl, 1.5 mM KH2PO4, 68 mM NaCl, 9 mM NaH2PO4). Preparation of whole cell protein extracts from S. maltophilia DCPS-01 was performed as described previously18 with modifications. Briefly, cell pellets were resuspended in 5 mL of lysis buffer (7 M urea, 2 M thiourea, 4% (w/v) CHAPS and 50 mM DTT) containing complete protease inhibitors (Roche Diagnostics, Mannheim, Germany). The cells were sonicated for 5 min (cycles of 2 s of sonication with 3 s intervals) on ice with a Sonifier 750 (Branson Ultrasonics Corp., Danbury, CT) set at a 30% duty cycle. After adding 2.5 mg of RNase A (Promega, Madison, WI) and 100 units of RQ1 DNase (Promega), the cell lysates were incubated for 1 h at 15 °C to solubilize proteins and then centrifuged for 40 min at 20000g to pellet the insoluble components. The supernatants were collected, and protein concentrations were measured by the PlusOne 2-D Quant Kit (GE Healthcare Life Sciences, Uppsala, Sweden). The prepared samples were stored at −70 °C in 1 mg aliquots. The experiment was performed at least six times. Isoelectric focusing (IEF) was carried out as described previously using immobilized pH gradient (IPG) strips in three pH ranges (pH 3−10, nonlinear/linear, 18 cm; pH 4−7 and pH 4.5−5.5, linear, 18 cm; GE Healthcare). Image analysis was processed by ImageMaster 2D Platinum software (GE Healthcare). To facilitate the discrimination between real spots and artifacts, the spot detection parameters were adjusted as follows: smooth, 3; minimum area, 50; and saliency, 6. The images of two samples under different cultivation conditions

Data Interpretation and Database Searching

The MS/MS results were searched against the NCBInr database (NCBInr 20101126, 12 346 081 sequences, 4 220 927 007 residues) using the MASCOT search program (www. matrixscience.com). To eliminate redundancy resulting from multiple members of the same protein family, the proteins of strain S. maltophilia K279a (GI:190572091), the plasmid pSH1 (GI:170783404) and pSM76 (GI:170783412) were chosen for the further analyses. The search parameters are as follows: trypsin digestion with two missed cleavage; carbamidomethyl modification of cysteine and oxidation of methionine as variable modifications; peptide tolerance maximum, ± 0.3 Da; MS/MS tolerance maximum, ± 0.5 Da; peptide charge, +1; monoisotopic mass. Scores greater than 83 are significant (p < 0.05) for Peptide Mass Fingerprinting (PMF) search. Ion scores greater than 46 are significant (p < 0.05) for a local MS/MS search. Gene Expression Analysis by Quantitative Real-Time Reverse Transcription RT-PCR

To assess the level of the selected differentially expressed genes mRNA in S. maltophilia cells incubated with or without imipenem, quantitative real-time reverse transcription RT-PCR analysis was performed using the delta−delta Ct method with 16S rDNA as an endogenous control gene as described by Livak and Schmittgen.19,20 Total RNA was extracted using RNAprep pure Cell/Bacteria Kit (TIANGEN Biotech Co., Ltd., Beijing, China) according to the manufacturer’s instructions. Reverse transcription was performed using Quantscript RT Kit (TIANGEN Biotech Co., Ltd., Beijing, China) according to the manufacturer’s instructions. The resulting cDNA was examined quantitatively by an iQ5 Real-Time PCR System (Bio-Rad). The 25 μL reaction mix contained 0.4 μM of forward and reverse primers, 12.5 μL of HotStart-IT SYBR Green qPCR 4026

dx.doi.org/10.1021/pr300062v | J. Proteome Res. 2012, 11, 4024−4033

Journal of Proteome Research

Article

automated system. The susceptibility pattern of S. maltophilia DCPS-01 was detected and clearly showed that the isolate was resistant to all β-lactams (MIC >128 μg/mL for imipenem and Meropenem), aminoglycosides and quinolones, and was only susceptible to tigecycline and colistin, in good agreement with the report by Yong et al.1 The DCPS-01 isolate also tested positive for MBLs in both the imipenem-EDTA double-disk synergy test (DDST) and modified Hodge test (MHT). In the MLST analysis of S. maltophilia DCPS-01, sequence type (ST) was ST4 (Supporting Information Table S1). Furthermore, PCR screening of the DCPS-01 isolate was performed for the known MBL genes including blaNDM‑1, blaVIM, blaIMP, blaSPM‑1, blaGIM‑1, blaSIM‑1, blaAIM‑1, blaL1 and blaL2 .14 Interestingly, PCR yielded products with expected sizes for blaNDM‑1, blaL1 and blaL2, and sequencing of these genes showed 100% identities with previously reported genes. However, no other known MBL genes were detected. At the same time, a 250 bp promoter upstream of blaNDM‑1 was acquired along with the gene as described previously,1 but it contained no class 1, 2, and 3 integron structures. However, the results of PCR using the primer of AmpR-blaL2 showed the blaL2 gene was adjacent to AmpR, which usually (could) regulates the expression of linked resistance genes. These sections of DNA were a chimera of truncated and intact genes, suggesting co-occurrence of L1 and L2 β-lactamase genes with blaNDM‑1 in the clinical isolate of S. maltophilia.

Master Mix (TIANGEN Biotech Co., Ltd., Beijing, China), 1 μL of cDNA sample, 0.05 μL of ROX, and the rest with nuclease-free water. The thermocycling conditions were programmed at 95 °C for 2 min, followed by 40 PCR cycles of denaturation at 95 °C for 30 s, annealing at 56 °C for 30s and extension at 72 °C for 20s. The melting curves were performed at the end of a cycle to ascertain the specificity of the primers and the purity of the final PCR product. The primers are listed in Table 1. Table 1. Oligonucleotides Used for Gene Expression Analysis oligonucleotide NDM1-SF NDM1-SR NDM1-LF NDM1-LR L1-F L1-R L2-F L2-R NDM1-F NDM1-R AmpRL2-F AmpRL2-R 16S rDNA-R 16S rDNA-F NDM1-R NDM1-F L1-R L1-F L2-R L2-F

nucleotide sequence (5′ → 3′) CAGCACACTTCCTATCTC CCGCAACCATCCCCTCTT GGCGGAATGGCTCATCACGA CGCAACACAGCCTGACTTTC ATGCGTTCTACCCTGCTCGCCTTCGCC TCAGCGGGCCCCGGCCGTTTCCTTGGCCAG CGATTCCTGCAGTTCAGT CGGTTACCTCATCCGATC CGGGATCCATGGAATTGCCCAATATTATGCA (BamHI) CCGCTCGAGTCAGCGCAGCTTGTCGGCCATGC (XhoI) CGACCAACCACCTTGACC ATGCCGATGATGCCGAAC GCTCGTGTCGTGAGATGTT (for real-time PCR) TGTAGCCCAGGTCATAAGG TGGACCGATGACCAGACCG (for real-time PCR) CGACAACGCATTGGCATAA TGCGGGCCTATACCGTGGAT (for real-time PCR) AGGTGACCGGCCATCTGTGG GTGCAGCACCTTCAAGAGCATG (for real-time PCR) 5′-GATCGTGGCACGGCACAGAT-3′

Molecular Analysis and Back Probing with blaNDM‑1

Conjugation experiments using E. coli J53 and nine enteric pathogens (Salmonella enteritidis, S. paratyphi A, S. f lexneri, S. snnei, S. boydii, and EPEC, ETEC, EIEC, EPEC) as the recipients were unsuccessful because no conjugate could grow in the selected plates. Additionally, blaNDM‑1 was not detected by PCR in the two plasmids extracted from S. maltophilia DCPS-01. To examine the location of the blaNDM‑1 gene, genomic DNA and plasmids DNA from S. maltophilia DCPS-01 were isolated, digested with Xal I, Apa I, Spe I, and S1 nuclease for genomic DNA and with Xal I for plasmids, examined by pulsed-field gel electrophoresis (PFGE), and PCR products of blaNDM‑1, blaL1 or blaL2 as positive control. Then the DNA transferred from the gel was probed with DIG-labeled blaNDM‑1, blaL1 or blaL2. The data clearly showed that blaNDM‑1, blaL1 and blaL2 were located on three different regions, and blaNDM‑1 is on a 10-kb chromosome band in S. maltophilia DCPS-01 digested by Xba I (Figure 1). Thus, we have isolated a novel pathogenic strain (S. maltophilia DCPS-01) carrying two MBLs including blaNDM‑1, blaL1 and one of blaL2 on different chromosomal regions.

Determination of β-Lactamase Activity

The differential L1 and L2 β-lactamase activities were determined by the modified nitrocefin-EDTA method.21 The specific activity (U/mg) was expressed as nanomoles of nitrocefin hydrolyzed per minute per milligram of protein, using an extinction coefficient of 20 500 M−1 cm−1 for nitrocefin at 486 nm, as suggested by the manufacturer (Oxoid, United Kingdom). The protein concentration was determined using the Bio-Rad protein assay reagent, with bovine serum albumin as a standard.22 Native PAGE and In-Gel Activity Staining

Two-Dimensional Gel Analysis of S. maltophilia DCPS-01 Proteins Differentially Expressed in Response to Imipenem

Native PAGE was performed according to protocols reported by Hu et al.23 The gel was immersed in a 100 μM nitrocefin solution to visualize the β-lactamase active band. E. coli/pGEXNDM-1, E. coli/pGEX-L1, and E. coli/pGEX-L2 were used as positive control.

■

S. maltophilia has emerged as a prominent nosocomial pathogen that causes a variety of clinical infections. To investigate the proteomic responses and identify possible genes expressed under drug-induced stress conditions, we first compared the proteomic profiles of S. maltophilia DCPS01 under imipenem treatment (Figure 2). The protein expression patterns of the cultures grown with imipenem were very similar to those grown without it, and many landmark spots had counterparts, implying S. maltophilia DCPS-01 was well adapted for survival and persistence in semilethal doses of imipenem. These proteins included (1) proteins with known imipenem resistance function including

RESULTS AND DISCUSSION

Typing and Phenotypic Characterization of the S. maltophilia DCPS-01 Isolate

The clinical isolate S. maltophilia DCPS-01 with ESBL-positive was derived from a sputum culture of a 74-year-old male patient with severe pulmonary infection after renal transplantation pulmonary in the intensive care unit of a tertiary hospital in China. Species identification was carried out using an 4027

dx.doi.org/10.1021/pr300062v | J. Proteome Res. 2012, 11, 4024−4033

Journal of Proteome Research

Article

Figure 2. Two-dimensional gel electrophoresis patterns of the whole cell protein lysate of S. maltophilia DCPS-01 cultured with (IMP+: A) and without imipenem (IMP−: B). The identified spots are labeled on the integrated 2-DE map of pH 4−10 and identified by MALDI-TOF/ TOF MS/MS analysis.

Figure 1. PFGE findings and Southern blot hybridization with the blaNDM‑1, blaL1, or blaL2 probe, respectively. (A) The genomic DNA of S. maltophilia DCPS-01was digested with XbaI (lane 1(A1)), ApaI (lane 2(A2)), SpeI (lane 3(A3)) and S1 nuclease (lane 4(A4)) in PFGE. The plasmid DNA of the index strain was digested with XbaI (lane A5). (B) The blaNDM‑1, blaL1, and blaL2 PCR amplicons (the blaNDM‑1 PCR amplicon running in a different gel) (lane A6) were used as positive controls. (C) The gels were transferred to membrane for Southern blot (Southern blot together with PFGE). The lanes corresponded to (A). Upper membrane was probed with the NDM-1 probe, and the lower membranes were detected by using L1 or L2 probe, respectively.

establishing and maintaining interactions between the microbe and its environment. Information on all identified proteins is listed in Table 2 and Supporting Information Table S2. The most striking observation was the differential expression of the L1 MBL precursor with known imipenem resistance functions. In comparison with untreated cells, the L1 MBL precursor increased more than 20-fold in cells exposed to imipenem. Although we did not identify the expressions of L2 and NDM-1 at the protein level in this work, further analysis of L2 and NDM-1 was performed by Western blot and semiquantitative RT-PCR at the transcript level. The results showed that L1 was expressed at a higher level in the cells grown with imipenem than in those without the drug, and the abundant blaNDM‑1 also increased;. However, very little L2 was detected even after induction (Figure 3). By using real-time quantitative RT-PCR, the expression of L1, L2 and NDM-1 genes with the pressure of imipenem were 3.51, 0.71, and 0.83 times than their expression without imipenem, respectively. These results suggested that L1 and NDM-1 may play a role in protecting cells against imipenem toxicity in S. maltophilia DCPS-01. In clinical treatment, imipenem is a powerful, last resort and alternative drug of choice, and expression of the resistant gene

L1 MBL; (2) key stress proteins such as molecular chaperone DnaK (Smlt1992), putative heat shock chaperone ClpB (Smlt3732), cochaperonin GroES (Smlt4215) and putative curved DNA-binding protein (Smlt3599); (3) proteins related to translation, such as elongation factor Tu (Smlt0890), seryltRNA synthetase (Smlt3092), cysteinyl-tRNA synthetase (Smlt3305) and methionine aminopeptidase (Smlt1513); (4) metabolism-related proteins that are necessary for sustenance in growth, especially those related to amino acid transport and metabolism, indicating that imipenem may influence the physical catabolism of this bacterium; (5) cell wall/membrane biogenesis; and (6) some hypothetical proteins, which could be positive modulators for adaptation to imipenem-induced stress. These proteins that were expressed at higher or lower levels in cells during drug-induced growth may play critical roles in 4028

dx.doi.org/10.1021/pr300062v | J. Proteome Res. 2012, 11, 4024−4033

4029

NCBI GI identifier

COGb protein description 460 536 319 429 285 220 439 102 107 386 482 469 122 495 147 125 594 399 579 163 141 324 523 517 314 348 535 117 104 221 513 340 390 191 263 107 252

53557 48615 25689 95238 95238 92025 36746 42934 47129 40731 49963 42934 55686 41992 48647 42934 47639 26580 23328 39467 68427 42934 34817 22661 26748 25141 28120

score

30843 10000 51486 29596 31757 29745 28371 27782 64990 28494

theor. mass

22/50 16/64 30/103 20/79 5/29 10/38 19/69 23/86 23/90 16/61 10/49 20/73 9/102 15/78

33/94 26/71 15/57 46/99 25/88 18/37 21/65 24/86 38/110 20/76 12/35 25/61 31/98

13/60 12/24 29/59 18/59 16/65 16/48 23/83 9/49 14/49 20/91

peptides matched/ searched

5 5 3 5 2 1 2 5 3 4 2 2 1 3

4 5 1 5 4 1 5 4 5 1 1 3 4

4 4 3 5 3 4 5 1 1 5

ions of TOF/ TOF

45 42 76 62 26 42 49 53 61 55 80 75 55 78

58 55 51 52 38 24 67 67 80 52 26 63 50

46 98 60 64 47 41 67 39 28 50

sequence coverage%

5.71 5.61 5.35 5.96 6.3 6.31 4.8 5 5.35 5.37 5.58 6.19 6.16 5.91

5.88 5.55 4.65 5.34 5.34 6.15 5.12 5.35 5.33 5.21 5.55 5.35 5.57

6.24 5.78 6.29 6.38 6.17 5.99 6.06 6.34 6 6.92

theor. pI

C C C C C C OM C C U C C C C

C C C C C C C C C C C C C

C C C C C C E C CM OM

locationc

sucB pepQ tufB − − pyrE − dnaK tufB mdh sodA etfB dapB −

− − − clpB clpB − asd tufB serS dnaN cysS tufB purH

− groES guaB sucD cbpA kdsA map minC sdhA −

gene

The scores greater than 83 are considered significant (p < 0.05). bAbbreviation of cellular role categories. Categories were taken from the TIGR-CMR (www.tigr.org), and the abbreviation was used to mark the categories. J: Translation; A: RNA processing and modification; K: Transcription; L: Replication, recombination and repair; D: Cell cycle control, mitosis and meiosis; V: Defense mechanisms; T:

a

locus

Proteins up-regulated during growth with imipenem: B1 Smlt2667 gi|190574592 R L-1 metallo-beta-lactamase precursor B2 Smlt4215 gi|190576043 O cochaperonin GroES B3 Smlt2071 gi|190574032 F inosine 5′-monophosphate dehydrogenase B4 Smlt3752 gi|190575605 C succinyl-CoA synthetase subunit alpha B5 Smlt3599 gi|190575460 O putative curved DNA-binding protein B6 Smlt1712 gi|190573695 M 2-dehydro-3-deoxyphosphooctonate aldolase B7 Smlt1513 gi|190573510 J methionine aminopeptidase B8 Smlt1252 gi|190573273 D septum formation inhibitor B9 Smlt1798 gi|190573778 C succinate dehydrogenase flavoprotein subunit B10 Smlt4128 gi|190575959 M hypothetical protein Smlt4128 Proteins down-regulated during growth with imipenem: A1 Smlt2007 gi|190573976 E aminotransferase class-III A2 Smlt0373 gi|190572443 E putative leucine aminopeptidase A3 Smlt3713 gi|190575571 S hypothetical protein Smlt3713 A4 Smlt3732 gi|190575587 O putative heat shock chaperone ClpB A5 Smlt3732 gi|190575587 O putative heat shock chaperone ClpB A6 Smlt2569 gi|190574495 G putative glucan 1,4-beta-glucosidase A7 Smlt3427 gi|190575297 E aspartate-semialdehyde dehydrogenase A8 Smlt0890 gi|190572930 J elongation factor Tu A9 Smlt3092 gi|190574986 J seryl-tRNA synthetase A10 Smlt0002 gi|190572093 L DNA polymerase III subunit beta A11 Smlt3305 gi|190575186 J cysteinyl-tRNA synthetase A12 Smlt0890 gi|190572930 J elongation factor Tu A13 Smlt4253 gi|190576080 F bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase A14 Smlt3198 gi|190575085 C dihydrolipoamide succinyltransferase A15 Smlt3861 gi|190575708 E proline dipeptidase A16 Smlt0890 gi|190572930 J elongation factor Tu A17 Smlt4341 gi|190576163 C branched-chain alpha-keto acid dehydrogenase subunit E2 A18 Smlt0396 gi|190572465 R putative oxidoreductase A19 Smlt0411 gi|190572479 F orotate phosphoribosyltransferase A20 Smlt0955 gi|190572988 M putative outer membrane protein A21 Smlt1992 gi|190573963 O molecular chaperone DnaK A22 Smlt0890 gi|190572930 J elongation factor Tu A23 Smlt0944 gi|190572978 C malate dehydrogenase A24 Smlt3238 gi|190575124 P putative superoxide dismutase A25 Smlt0646 gi|190572698 C putative electron transfer flavoprotein subunit beta A26 Smlt2217 gi|190574171 E dihydrodipicolinate reductase A27 Smlt0266 gi|190572340 I enoyl-CoA hydratase

spot no.

Table 2. Differentially Regulated S. maltophilia DCPS-01 Proteins (>3-Fold) Identified by MALDI-TOF/TOF MS/MSa

Journal of Proteome Research Article

dx.doi.org/10.1021/pr300062v | J. Proteome Res. 2012, 11, 4024−4033

Article

cluster is rapidly induced by antibiotics. At present, no studies have reported on specificity and reversibility of imipenem resistance genes induced in S. maltophilia, yet such information would be very important to directing clinical drug use. To further investigate if the expression of imipenem resistant genes in DCPS-01 were induced specifically and reversibly, we first compared the proteomes and then analyzed the transcription of blaL1, blaNDM‑1 and blaL2 genes in cells grown with or without imipenem after 8 h (early exponential phase), 12 h (midexponential phase), and 16 h (end of exponential phase) according to the bacterial growth curves (the data not shown). As depicted in Figure 3A and B, the effect of growth time on expression of imipenem resistance genes was very clear. We observed a consistent up-regulation of intensity for L1 in the 2D maps and for blaNDM‑1 in Western Blot over time, in according with the transcription of blaL1 and blaNDM‑1 genes, but L2 had no changes in expression. These experiments demonstrate significantly higher levels of imipenem resistance genes were transcribed and expressed in cells grown with imipenem than in those without the drug. We then tested the reversibility of imipenem-induced resistance genes. DCPS-01 cells cultured with or without imipenem for 6 h were each split in two in new medium, and imipenem was added to only one of each of the two split cultures. Then the two cultures were further incubated for 6 h. We observed an obvious up-regulation of L1 in the 2-D maps after the cells were induced by imipenem, but they downregulated to the basal expression level in cells without imipenem after about 6 h when imipenem was removed (Figure 3C). These data strongly demonstrate that imipenem can induce specifically and reversibly these genes including blaL1 and blaNDM‑1. Thus, they play a key role in cells against imipenem in S. maltophilia. Interestingly, the expression of succinate dehydrogenase flavoprotein subunit (SDHA, Smlt1798), which is the key FADcontaining enzyme in succinate respiration induced by aerobic growth of bacteria, was up-regulated under culture with imipenem in DCPS-01. The oxidation of succinate to fumarate is a key step in the oxidative TCA cycle. SdhA is required for full colonization of chickens by Campylobacter jejuni, and it could potentially be used both as a novel drug target as an inhibitor of the Ips-1-dependent IFN response to Legionella pneumophila as well as in the development of vaccines for L. pneumophila prevention and eradication.24,25 The potential role of this protein related to the citric acid cycle and respiratory chain is unclear in imipenem tolerance in S. maltophilia isolated from a sputum of a patient with severe pulmonary infection. In addition, also of interest was that five proteins including Smlt0373 (putative leucine aminopeptidase), Smlt3713 (hypothetical protein Smlt3713), Smlt3732 (putative heat shock chaperone ClpB), Smlt0955 (putative outer membrane protein), Smlt3238 (putative superoxide dismutase), and Smlt0646 (putative electron transfer flavoprotein subunit beta) annotated as “hypothetical protein” with unknown functions were identified and should be investigated as potentially functional proteins. The hypothetical proteins were notably down-regulated (more than 10-fold) in S. maltophilia DCPS-01 cells with imipenem. Furthermore, we suggest that Smlt3599 (putative curved DNA-binding protein) is among the drug resistant group of genes, particularly for imipenem resistance of S. maltophilia. Thus, identification of these differentially regulated proteins may facilitate the

Signal transduction mechanisms; M: Cell wall/membrane biogenesis; N: Cell motility; U: Intracellular trafficking and secretion; O: Posttranslational modification, protein turnover, chaperones; C: Energy production and conversion; G: Carbohydrate transport and metabolism; E: Amino acid transport and metabolism; F: Nucleotide transport and metabolism; H: Coenzyme transport and metabolism; I: Lipid transport and metabolism; P: Inorganic ion transport and metabolism; Q: Secondary metabolites biosynthesis, transport and catabolism; R: General function prediction only; S: Function unknown; −: not in COGs. cAbbreviation of cellular locations. Protein cellular location was annotated by psort v.2.0 (www.psort.org). C: cytoplasmic; CM: cytoplasmic membrane; E: extracellular.

Table 2. continued

Journal of Proteome Research

4030

dx.doi.org/10.1021/pr300062v | J. Proteome Res. 2012, 11, 4024−4033

Journal of Proteome Research

Article

Figure 3. Specificity and reversibility of induction of NDM-1, L1 and L2 by imipenem in S. maltophilia DCPS-01. L1 expression in 2-DE maps and NDM-1 and L2 in WB analysis under treatment with or without imipenem are shown. E. coli/pGEX-L2 was used as positive control. (A) Spots corresponding to L1 (Abundance: 2537/IMP−; 50 396/IMP+8 h; 55 588/IMP+16 h; 56 426/IMP+24 h) in two-dimensional proteome maps (upper), NDM-1 and L2 (L2 in DCPS-01 and in E. coli) in WB analysis of cells grown for 8, 12, 16, and 24 h under treatment with or without imipenem. (B) Two-dimensional proteome maps zoomed in on the L1 spots (Abundance: 2521/IMP−; 53 148/IMP+32 μg/mL; 56 037/IMP+64 μg/mL; 60 304/IMP+96 μg/mL) and NDM-1 and L2 (L2 in DCPS-01 and in E. coli) in WB analysis of cells grown to midexponential growth phase with 0, 32, 64, or 96 μg/mL of imipenem, respectively. (C) L1 spots on two-dimensional proteome maps (Abundance: 2021/IMP−12 h; 54 327/ IMP−6 h + IMP+6 h; 55 183/IMP+6 h + IMP−6 h; 60 219/IMP+12 h) and NDM-1 and L2 (L2 in DCPS-01 and in E. coli) in WB analysis of cells cultured with (IMP+/6 h) or without imipenem (IMP−/6 h) for 6 h were each split in two in new media, and imipenem was added to only one of each of the two split cultures. The cultures were further incubated for 6 h (IMP−/12 h, IMP−/6 h + IMP+/6 h, IMP+/6 h + IMP−/6 h, and IMP +/12 h).

development of therapeutic approaches to combat this important nosocomial pathogen. Analysis of β-Lactamase Activity

To investigate the biological activity of these resistant genes against imipenem in S. maltophilia DCPS-01, an analysis of NDM-1 and L1, L2 β-lactamase inducibility and expression was performed as described previously.26 Nitrocefin was used as a substrate for β-lactamase quantification and EDTA to inhibit L1 β-lactamase and NDM-1 in order to assess the level L2 specific β-lactamase activity present in the cell extract. The total βlactamase (L1 + L2 + NDM-1) activity in extracts of S. maltophilia DCPS-01 was 69.8 U/mg of protein, and L2 activity was 10.6 U/mg of protein. AmpR is necessary for L1 and L2 βlactamase induction in response to β-lactam challenge, and activation of AmpR is sufficient to induce L1 and L2 production. L1 induction requires more activation of AmpR than does L2 induction.11,13,26 Thus, we suggested that the inducibility and percent L2 activity of β-lactamase in S. maltophilia DCPS-01 revealed that noninducible L2 remained at constitutive low levels and that it was not activated by AmpR. To further investigate the expressions of the blaL1 and blaNDM‑1 genes in the S. maltophilia DCPS-01 isolate, the βlactamase extracts were prepared in 50 mM sodium phosphate buffer at pH 7.0 and separated by 10% native PAGE followed by in-gel activity staining with nitrocefin. As depicted in Figure 4, L1 and NDM-1 showed clear activity, with that of L1 being higher than NDM-1. Thus, we suggest that L1 and NDM-1 but not L2 may play a role in protecting cells against imipenem toxicity in S. maltophilia DCPS-01.

Figure 4. Native PAGE and in-gel activity staining by nitrocefin of βlactamase extracts from the S. maltophilia DCPS-01 isolate. Lanes: M, Marker(1, Marker); 1(2), DCPS-01 with L1 and NDM-1; 2(3), E. coli BL21/pGEX-NDM-1; 3(4), E. coli BL21/pET32a -L1; 4(5), E. coli BL21/pET32a -L2; 5. E. coli BL21/pET32a.

■

CONCLUSION As expression of the resistant genes is rapidly induced by antibiotics in clinical treatments, carbapenems are often used as a last resort and as an alternative drug of choice for infections due to multidrug-resistant Gram-negative bacilli. However, there is an alarming increase in reports of carbapenem resistance in Acinetobacter species, P. aeruginosa and S. maltophilia. The first MBLs were identified originally as chromosomal enzymes in S. maltophilia. Over many years, these MBL producing isolates have disseminated worldwide. There are presently no studies on the specificity of the imipenem resistance gene blaNDM‑1 induced in S. maltophilia, yet such information would be important for directing clinical drug use. 4031

dx.doi.org/10.1021/pr300062v | J. Proteome Res. 2012, 11, 4024−4033

Journal of Proteome Research

Article

India, Pakistan, and the UK: a molecular, biological, and epidemiological study. Lancet Infect. Dis. 2010, 10 (9), 597−602. (5) Poirel, L.; Lagrutta, E.; Taylor, P.; Pham, J.; Nordmann, P. Emergence of metallo-β-lactamase NDM-1-producing multi drug resistant Escherichia coli in Australia. Antimicrob. Agents Chemother. 2010, 54 (11), 4914−4916. (6) Denton, M.; Kerr, K. G. Microbiological and clinical aspects of infection associated with Stenotrophomonas maltophilia. Clin. Microbiol. Rev. 1998, 11 (1), 57−80. (7) Senol, E. Stenotrophomonas maltophilia: the significance and roleas a nosocomial pathogen. J. Hosp. Infect. 2004, 57 (1), 1−7. (8) Sader, H. S.; Jones, R. N. Antimicrobial susceptibility of uncommonly isolated non-enteric Gram-negative bacilli. Int. J. Antimicrob. Agents 2005, 25 (2), 95−109. (9) Saino, Y.; Kobayashi, F.; Inoue, M.; Mitsuhashi, S. Purification and properties of inducible penicillin β-lactamase isolated from Pseudomonas maltophilia. Antimicrob. Agents Chemother. 1982, 22 (4), 564−570. (10) Saino, Y.; Inoue, M.; Mitsuhashi, S. Purification and properties of an inducible cephalosporinase from Pseudomonas maltophilia GN12873. Antimicrob. Agents Chemother. 1984, 25 (3), 362−365. (11) Okazaki, A.; Avison, M. B. Induction of L1 and L2 betalactamase production in Stenotrophomonas maltophilia is dependent on an AmpR-type regulator. Antimicrob. Agents Chemother. 2008, 52 (4), 1525−1528. (12) Noyal, M. J.; Menezes, G. A.; Harish, B. N.; Sujatha, S.; Parija, S. C. Simple screening tests for detection of carbapenemases in clinical isolates of nonfermentative Gram-negative bacteria. Indian J. Med. Res. 2009, 129 (6), 707−712. (13) Lin, C. W.; Huang, Y. W.; Hu, R. M.; Chiang, K. H.; Yang, T. C. The role of AmpR in regulation of L1 and L2 beta-lactamases in Stenotrophomonas maltophilia. Res. Microbiol. 2009, 160 (2), 152−158. (14) Patzer, J. A.; Walsh, T. R.; Weeks, J.; Dzierzanowska, D.; Toleman, M. A. Emergence and persistence of integron structures harbouring VIM genes in the Children’s Memorial Health Institute, Warsaw, Poland, 1998−2006. J. Antimicrob. Chemother. 2009, 63 (2), 269−273. (15) Poirel, L.; Pitout, J. D.; Nordmann, P. Carbapenemases: molecular diversity and clinical consequences. Future Microbiol. 2007, 2 (5), 501−512. (16) Poirel, L.; Yakupogullari, Y.; Kizirgil, A.; Dogukan, M.; Nordmann, P. VIM-5 metallo-β-lactamase-producing Pseudomonas putida from Turkey. Int. J. Antimicrob. Agents 2009, 33 (3), 287. (17) Toleman, M. A.; Rolston, K.; Jones, R. N.; Walsh, T. R. blaVIM7, an evolutionarily distinct metallo-β-lactamase gene in a Pseudomonas aeruginosa isolate from the United States. Antimicrob. Agents Chemother. 2004, 48 (1), 329−332. (18) Yuan, J.; Zhu, L.; Liu, X.; Li, T.; Zhang, Y.; Ying, T.; Wang, B.; Wang, J.; Dong, H.; Feng, E.; Li, Q.; Wang, J.; Wang, H.; Wei, K.; Zhang, X.; Huang, C.; Huang, P.; Huang, L.; Zeng, M.; Wang, H. A proteome reference map and proteomics analysis of Bifidobacterium longum NCC2705. Mol. Cell. Proteomics 2006, 5 (6), 1105−1118. (19) Livak, K. J.; Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2[-Delta Delta C(t)] method. Methods 2001, 25, 402−408. (20) De Carolis, E.; Posteraro, B.; Florio, A. R.; Colonna, B.; Prosseda, G.; Bugli, F.; Lorenzetti, S. R.; Fiscarelli, E.; Inzitari, R.; Iavarone, F.; Castagnola, M.; Fadda, G.; Sanguinetti, M. Analysis of heat-induced changes in protein expression of Stenotrophomonas maltophilia K279a reveals a role for GroEL in the host-temperature adaptation. Int. J. Med. Microbiol. 2011, 301 (4), 273−281. (21) Hu, R. M.; Chiang, K. H.; Lin, C. W.; Yang, T. C. Modified nitrocefin-EDTA method to differentially quantify the induced L1 and L2 β-lactamases in Stenotrophomonas maltophilia. Lett. Appl. Microbiol. 2008, 47 (5), 457−461. (22) Yang, T. C.; Huang, Y. W.; Hu, R. M.; Huang, S. C.; Lin, Y. T. AmpDI is involved in expression of the chromosomal L1 and L2 betalactamases of Stenotrophomonas maltophilia. Antimicrob. Agents Chemother. 2009, 53 (7), 2902−2907.

Overall, the data in the present work strongly support that imipenem can specifically induce L1 and NDM-1, both of which play key roles in drug resistance. The finding that S. maltophilia DCPS-01 harbors both inducible L1 β-lactamase and NDM-1 adds further evidence to the hypothesis that mechanisms used to regulate L1, L2 and NDM-1 β-lactamase expression are independent. Importantly, the emergence of these powerful co-occurring resistance mechanisms described here provides warning that future therapeutic options may be seriously limited.

■

ASSOCIATED CONTENT

S Supporting Information *

Supplemental tables including Primers, Tm used for amplification, and positions in the amplicons used for assigning allelic types; Characteristics of differentially regulated S. maltophilia JKYJ-01 proteins and the amino acid sequences of protein identified. Supplemental files including Peaklists of MALDI/TOFTOF and Results of MALDI/TOFTOF. This material is available free of charge via the Internet at http:// pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author

*Tel.: +86-10-66948301. Fax: +86-10-66948301. E-mail: [email protected]; [email protected]. Author Contributions #

These authors contributed equally to this work.

Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS We are grateful to Christian U. Riedel and Peter R. Jungblut for advice on the preparation of the manuscript for technical assistance and helpful discussions. This work was supported by grants from the National Natural Science Foundation of China (No. 81071321 and 81071399) and a grant from the Megaprojects of Science and Technology Research of China (Grant No. 2011ZX10004-001) to JingYuan.

■

REFERENCES

(1) Yong, D.; Toleman, M. A.; Giske, C. G.; Cho, H. S.; Sundman, K.; Lee, K.; Walsh, T. R. Characterization of a new metallo-betalactamase gene, bla(NDM-1), and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. Antimicrob. Agents Chemother. 2009, 53 (12), 5046−5054. (2) Vatopoulos, A. High rates of metallo-beta-lactamaseproducing Klebsiella pneumoniae in Greece: a review of the current evidence. Eurosurveillance 2008, 13 (4), 8023. (3) European Antimicrobial Resistance Surveillance Network (EARSNet) database; European Centre for Disease Prevention and Control: Stockholm. CRE in Europe − Current European situation and future plans for control. http://ecdc.europa.eu/en/activities/surveillance/ EARS-Net/Pages/Database.aspx. (4) Kumarasamy, K. K.; Toleman, M. A.; Walsh, T. R.; Bagaria, J.; Butt, F.; Balakrishnan, R.; Chaudhary, U.; Doumith, M.; Giske, C. G.; Irfan, S.; Krishnan, P.; Kumar, A. V.; Maharjan, S.; Mushtaq, S.; Noorie, T.; Paterson, D. L.; Pearson, A.; Perry, C.; Pike, R.; Rao, B.; Ray, U.; Sarma, J. B.; Sharma, M.; Sheridan, E.; Thirunarayan, M. A.; Turton, J.; Upadhyay, S.; Warner, M.; Welfare, W.; Livermore, D. M.; Woodford, N. Emergence of a new antibiotic resistance mechanism in 4032

dx.doi.org/10.1021/pr300062v | J. Proteome Res. 2012, 11, 4024−4033

Journal of Proteome Research

Article

(23) Hu, R. M.; Chiang, K. H.; Chang, Y. C.; Yang, T. C. Characterization of the charge variants of L2 beta-lactamase in Stenotrophomonas maltophilia. J. Med. Microbiol. 2009, 58 (Pt:3), 318− 321. (24) Weingarten, R. A.; Taveirne, M. E.; Olson, J. W. The dualfunctioning fumarate reductase is the sole succinate:quinone reductase in Campylobacter jejuni and is required for full host colonization. J. Bacteriol. 2009, 191 (16), 5293−5300. (25) Monroe, K. M.; McWhirter, S. M.; Vance, R. E. Identification of host cytosolic sensors and bacterial factors regulating the type I interferon response to Legionella pneumophila. PLoS Pathog. 2009, 5 (11), e1000665. (26) Okazaki, A.; Avison, M. B. Induction of L1 and L2 betalactamase production in Stenotrophomonas maltophilia is dependent on an AmpR-type regulator. Antimicrob. Agents Chemother. 2008, 52 (4), 1525−1528.

4033

dx.doi.org/10.1021/pr300062v | J. Proteome Res. 2012, 11, 4024−4033