Proteomic Analysis of Silk Gland Programmed Cell Death during

Jul 4, 2007 - Among ∼1000 reproducibly detected protein spots on each gel, 43 were down- regulated and 34 were up-regulated in PCD process. Mass spe...
1 downloads 13 Views 420KB Size
Download PDF
Proteomic Analysis of Silk Gland Programmed Cell Death during Metamorphosis of the Silkworm Bombyx mori Shi-hai Jia,† Mu-wang Li,† Bo Zhou,† Wen-bin Liu,† Yong Zhang,† Xue-xia Miao,† Rong Zeng,‡ and Yong-ping Huang*,† Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200032, P. R. China, and Research Center for Proteome Analysis, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031, P. R. China Received January 25, 2007

The silk gland of the silkworm Bombyx mori undergoes programmed cell death (PCD) during pupal metamorphosis. On the basis of their morphological changes and the occurrence of a DNA ladder, the tissue cells were categorized into three groups: intact, committed, and dying. To identify the proteins involved in this process, we conducted a comparative proteomic analysis. Protein expression changes among the three different cell types were examined by two-dimensional gel electrophoresis. Among ∼1000 reproducibly detected protein spots on each gel, 43 were down-regulated and 34 were up-regulated in PCD process. Mass spectrometry identified 17 differentially expressed proteins, including some well-studied proteins as well as some novel PCD related proteins, such as caspases, proteasome subunit, elongation factor, heat shock protein, and hypothetical proteins. Our results suggest that these proteins may participate in the silk gland PCD process of B. mori and, thus, provide new insights for this mechanism. Keywords: Bombyx mori • Programmed cell death • Silk gland • Two-dimensional gel electrophoresis

1. Introduction Programmed cell death (PCD) plays a critical role during development. It is essential for the maintenance of homeostasis in all higher organisms by eliminating unneeded tissues, controlling cell number, and removing abnormal cells.1 It is distinguished from necrosis by a group of morphological and biochemical markers. For example, apoptotic cells exhibit cellular condensation and DNA fragmentation, which are followed by disintegration into apoptotic bodies that are phagocytosed and ultimately eliminated by neighbor cells. This pathway is a conserved gene-directed mechanism that was first defined through genetic analysis in the nematode Caenorhabditis elegans.2 Further studies have shown that this pathway is highly conserved from Drosophila melanogaster to Homo sapiens.1,3 Three different types have been defined through their morphological characteristics. The first type, widely known as apoptosis, is characterized by isolated dying cells that exhibit condensation of the nucleus and cytoplasm, followed by fragmentation and phagocytosis by cells that degrade their contents.4 The second type, known as autophagy, has been observed when groups of associated cells or entire tissues are destroyed. These dying cells contain autophagic vacuoles in their cytoplasms that function in the degeneration of cell * Corresponding author. Tel, 021-54920407; e-mail, [email protected]. † Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. ‡ Research Center for Proteome Analysis, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. 10.1021/pr070043f CCC: $37.00

 2007 American Chemical Society

components. The third type, known as nonlysosomal cell death, is characterized by swelling of cavities with membrane borders followed by degeneration without lysosomal activity. During insect holometabolism, PCD removes intersegmental muscles, motoneurons, prothoracic glands, salivary glands, and silk glands.5-9 Several conserved apoptotic genes, including activators, executors, and inhibitors, have been cloned from the silkworm Bombyx mori.10-13 Some studies on PCD in silkworms have focused on silk gland tissue, which is homologous with the Drosophila salivary gland,14 and the results suggest that this type of cell death is triggered by ecdysteroid hormone.15 The silk gland is important given it generates and stores silk proteins during cocoon construction; however, it degenerates soon after silkworm pupation.16 Morphological studies indicate that this degeneration is in fact an autophagic PCD,17 which has been implicated in the inhibition of tumorigenesis.18-20 Studies on steroid-triggered PCD in Drosophila larval salivary glands revealed that some of the conserved apoptotic genes are involved in this process;8,21,22 however, the molecular mechanism remains mainly unknown. Considering that the silk gland is a highly specialized organ that contains polyploid cells and a huge amount of silk proteins compared with normal cells,23,24 it is conceivable that the silk gland PCD pathway may require several other unique proteins. This speculation is confirmed by a recent in vitro study using subtraction hybridization that identified multiple genes involved in 20-hydroxyecdysone (20-E)-triggered silk gland PCD.12 Journal of Proteome Research 2007, 6, 3003-3010

3003

Published on Web 07/04/2007

research articles

Jia et al.

Figure 1. Genomic DNA fragmentation assay. The genomic DNA was extracted from the silk glands, which were collected once every hour after silkworm pupation. The DNA ladder was detected after about 12 h by 1.5% agarose gel electrophoresis.

To characterize proteome change associated with silk gland cell death in vivo, two-dimensional gel electrophoresis (2-DE) was utilized to identify differentially expressed proteins during PCD of the silk gland, and mass spectrometry (MS) was combined to identify the differentially expressed protein spots. Recently, this approach has been successfully used to profile the proteins expressed in different parts of the silk gland during fibroin synthesis,25 and the proteome change of the hemolymph during the growth and development of the fifth instar larvae.26 In the present study, we analyzed temporal changes in protein expression in the silk gland during PCD. Seventy-seven differentially accumulated protein spots were revealed by 2-DE, and 17 proteins were identified by mass spectrometry, including several apoptosis-related proteins, such as caspases, proteasome subunit, some upstream genes of ecdyson signal pathway, elongation factor, and heat shock protein, indicating that these proteins may play some roles in the PCD process of B. mori. We also found some novel proteins differentially expressed during the PCD process, which were identified as hypothetical proteins. The results in this study may provide new insights into silk gland PCD.

2. Materials and Methods 2.1. Insects and Sample Preparation. The silkworm strain, Dazao, was reared with fresh mulberry leaves at 25 °C. The silk glands were removed hourly after pupation on ice, washed with 0.9% NaCl at 4 °C, then immediately frozen in liquid nitrogen and stored at -80 °C. 2.2. DNA Extraction and Agarose Gel Analysis. Frozen tissues were ground into powder in liquid nitrogen and then transferred to Eppendorf tubes (Hamburg, Germany) containing lysis buffer (10 mM Tris-HCl (pH 8.0), 100 mM EDTA, 0.5% SDS, and 0.1 mg/mL proteinase K). After an overnight incubation at 37 °C, the samples were extracted by 1:1 (v/v) phenolchloroform. The DNA was precipitated with 2.5 vol ethanol and 0.1 vol 5 M NaCl overnight at -20 °C. The DNA pellet was dissolved in TE buffer containing 0.1 mg/mL RNase A. After the concentration was measured, the DNA samples were loaded onto 1.5% agarose gel for electrophoresis, followed by ethidium bromide staining. This experiment was repeated three times for each time point. 3004

Journal of Proteome Research • Vol. 6, No. 8, 2007

Figure 2. The 2-DE maps of silk gland proteins. Total protein was extracted from silk glands and separated by 2-DE. For IEF, 100 µg of total protein was loaded onto pH3-10 IPG strips (13 cm, nonlinear), and then transferred to 12% SDS-polyacrylamide gels for the second-dimensional electrophoresis. The protein spots were visualized by silver staining. (A) 2-DE gel of proteins from intact silk glands; (B) 2-DE gel of proteins from silk glands 8-9 h after pupation (the committed samples); (C) 2-DE gel of silk gland proteins 12-13 h after pupation (the dying samples).

Proteomic Analysis of Silk Gland Programmed Cell Death

Figure 3. Differentially expressed proteins. Four typical areas of Figure 2 have been enlarged to show the spots of differentially expressed proteins.

Figure 4. Distribution of differentially expressed protein spots. There are 77 differentially expressed proteins revealed by 2-DE gel analysis and comparisons between every two of the three samples. Those proteins were distributed into four patterns: I, 8 proteins differentially expressed among all three samples; II, 54 proteins differentially expressed between sample A and B as well as sample A and C, but not sample B and C; III, 8 proteins differentially expressed in A-B and B-C but not A-C; IV, 7 proteins differentially expressed in A-C and B-C but not A-B.

2.3. Protein Extraction and 2-DE Analysis. For each sample group, 20 pairs of frozen silk gland tissues were ground in liquid nitrogen and suspended in lysis buffer (8 M urea, 65 mM DTT, 4% CHAPS, and 40 mM Tris) containing PMSF, NaVO3, and NaF. The samples were sonicated several times for 10 s, followed by centrifugation for 45 min at 12 000g. Protein concentrations were determined using the Bio-Rad (Hercules, CA) protein assay reagent. For 2-DE, 100 and 500 µg of proteins were loaded onto analytical and preparative gels, respectively. The Ettan IPGphor Isoelectric Focusing System (Amersham, Piscataway, NJ) and pH 3-10 immobilized pH gradient (IPG) strips (13 cm, nonlinear; Amersham) were used for isoelectric focusing (IEF). The IPG strips were rehydrated for 12 h in 250 µL of rehydration buffer containing the protein samples. IEF was performed in three steps: 500 V for 1 h, 1000 V for 1 h, and 8000 V for 5 h.

research articles The gel strips were equilibrated for 15 min in equilibration buffer (50 mM Tris-HCl (pH 8.8), 6 M urea, 2% SDS, 30% glycerol, and 1% DTT). This step was repeated using the same buffer with 4% iodoacetamide in place of 1% DTT. The strips were then subjected to the second-dimensional electrophoresis after transfer onto 12.5% SDS-polyacrylamide gels. Electrophoresis was performed using the Hofer SE 600 system (Amersham) at 30 mA per gel for 40 min, followed by 60 mA until the bromophenol blue reached the end of the gel. At least three replicates were performed for each sample. 2.4. Gel Staining and Image Analysis. Protein spots in the analytical gels were visualized by silver staining. The preparative gels were stained by a modified colloidal Coomassie Blue G-250. The resulting 2-D gels were scanned using a Bio-Rad GS710 scanner, and image analysis was accomplished using Image Master Software (Amersham). 2.5. In-Gel Tryptic Digestion. Protein spots were excised from the preparative gels and destained with 100 mM NH4HCO3 and 30% acetonitrile (ACN). After removing the destain buffer, the gel pieces were lyophilized and rehydrated in 30 µL of 50 mM NH4HCO3 containing 50 ng of trypsin (sequencing grade; Promega, Madison, WI). After digestion overnight at 37 °C, the peptides were extracted three times with 0.1% trifluoroacetic acid (TFA) in 60% ACN. Extracts were pooled together and lyophilized. The resulting lyophilized tryptic peptides were dissolved in 5 mg/mL R-cyano-4-hydroxycinnamic acid (CHCA) containing 0.1% TFA and 50% ACN. A protein-free gel piece was treated the same as above and used as a control to identify autoproteolytic products derived from trypsin. 2.6. MALDI-TOF/TOF MS Analysis and Database Searching. Mass spectra were acquired on a MALDI-TOF/TOF tandem mass spectrometer, the Bruker-Daltonics AutoFlex TOF-TOF LIFT. The instrument was operated in the delayed extraction and positive-ion linear mode with the following parameters: 20 kV acceleration voltage, 95% grid voltage, 100 ns delay time, and 500 m/z low-mass gate. For acquisition of a mass spectrometric peptide map, a 1-µL aliquot from the peptide extracts was premixed with 1 µL of matrix (10 mg/mL CHCA in 35% ACN and 0.1% TFA) and spotted onto a MALDI target plate. Measurements were externally calibrated with a standard peptide mixture of angiotensin II ([M + H]+ 1046.54) and angiotensin I ([M + H]+ 1296.68), and internally recalibrated with peptide fragments arising from autoproteolysis of trypsin. Both MS and MS/MS data were acquired with a N2 laser at a 25-Hz sampling rate. The signal-to-noise criterion was set to 25 or greater. The monoisotopic masses were processed for identification. For MS/MS spectra, the peaks were calibrated by default and smoothed. All peaks were deisotoped. MS/MS was performed using the MASCOT program. The data were sent to the National Center for Biotechnology nonredundant (NCBInr) protein database (updated on February 16, 2006), which contained 2 464 940 sequences. The search was performed taking Other Metazoa as taxonomy, which contained 154 412 sequences. The other search parameters were enzyme of specificity strict trypsin; one missed cleavage; fixed modifications of Carbamidomethyl (C); oxidation (Met); peptide tolerance of 100 ppm; Fragment Mass Tolerance of (0.5 Da; peptide charge of 1+; and monoisotopic. Only significant hits, defined by MASCOT probability analysis (p < 0.05), were accepted. Peptide mass fingerprinting (PMF) was performed using the search engine of MS-Fit in the ProteinProspector v 4.0.6 Journal of Proteome Research • Vol. 6, No. 8, 2007 3005

research articles

Jia et al.

Table 1. Differentially Expressed Proteins Identified by PMF varietyb spot no.

NCBI GI

protein description

organism

3 4 6 7 10 13 15 16 19 21 27 35 38

20151445 127966 30984490 62287003 6683594 50806440 49022791 26006981 26985165 45185127 1351426 232030 56378319

GH24458p NADPH--cytochrome P450 reductase Protein kinase Optineurin Nuclear hormone receptor E75B Similar to zinc finger protein 235 Broad-complex Z2-isoform Caspase-6 precursor Caspase-1 ABL103Wp Wnt-1 protein precursor Elongation factor 1-beta' Heat shock protein hsp20.1

D. melanogaster Rattus norvegicus Cercopithecine herpesvirus 1 Xenopus laevis B. mori Gallus gallus B. mori H. sapiens B. mori Eremothecium gossypii B. mori B. mori B. mori

protein MW (Da)/pI

MOWSE score

Ma

coverage (%)

A

B

C

79351/5.3 76832/5.3 50300/5.3 61515/4.9 76015/9.0 66081/6.7 47298/6.9 33310/6.5 33341/6.4 35184/8.0 44204/9.6 24418/4.5 20139/5.5

107 1477 410 55.9 118 1222 40.5 47.6 3873 101 57.2 99043 6769

5 8 7 4 4 11 4 4 7 4 5 8 10

23 33 43 30 28 61 11 26 23 66 38 47 90

+ ++ + ++ ++ ++ ++

+++ + + + + + + + ++ + + +

+++ + + + + + + ++ + +

a Number of mass values matched. b Variety denotes the protein expression pattern. +, spot present; ++, high intensity; +++, very high intensity; -, spot absent.

Table 2. Differentially Expressed Proteins of B. mori Identified by MS/MS varietyc spot no.

NCBI GI

protein description

protein MW (Da)/pI

score

Ca

sequenceb

1 24

37543675 95102982

Type IV collagen Proteasome subunit beta 7

89264/6.77 30567/8.05

65 131

1% 21%

25

40923063

Hypothetical protein

25496/6.21

134

14%

35

232030

Elongation factor 1-beta′

24590/4.49

130

14%

38

56378319

Heat shock protein hsp20.1

20183/5.46

56

12%

40

40947030

Hypothetical protein

21263/8.30

148

30%

K.AHNQDLGYAGSCVR.K R.YQGHIGAALVLGGVDR.T R.TGPHIYCIYPHGSVDK.L R.NTGPAQYLR.T R.IIEFYR.H R.LMTNTDDYYPR.L K.TEFYNNYLPLCDVAAK.K K.APAANLPHVLR.W K.SYVSGYTPSQADVQVFEQVGK.A R.DYYRPWK.Q R.YALPENCNPDTVESR.L R.SQFQGDLIPGKLCVK.H K.AVVAGYEGHDGSPLWVIR.S R.DGVIPPNAVMGGNTAAGEPLYIGR.A

A

B

C

+ +

++ -

+ -

+++

+

+

++

+

+

++

+

+

-

+

+

a Percentage of sequence coverage of matched peptides. b The sequence of matched peptides. c Variety denotes the protein expression pattern. +, spot present; ++, high intensity; +++, very high intensity; -, spot absent.

package (http://prospector.ucsf.edu/, Protein Prospector, San Francisco, CA). The Swiss-Prot.2007.01.21 and NCBInr.2006.02.16 databases were used for protein identification. The parameters were used as described in ref 25. 2.7. RT-PCR Analysis. Total RNA was extracted from silk glands using Trizol reagent (Invitrogen, Carlsbad, CA), and genomic DNA was removed by adding DNase I (RNase Free, Takara). A total of 1 µg of RNA was used for cDNA synthesis using ReverTra Ace (Toyobo, Osaka, Japan). The gene-specific primers used in the RT-PCR analysis are listed in Table 3. The actin gene was used as an internal control.

3. Results 3.1. Silk Gland Programmed Cell Death. The fifth instar silkworm larva stops spinning about 3 days after gut purge and starts pupation 24 h later. The degradation of the silk gland seems to be particularly accelerated after pupation.15,17 Similarly, the Dazao strain silkworm, reared with fresh mulberry leaves at 25 °C, was observed to make a cocoon 24-36 h after gut purge and stop spinning to enter the prepupal stage. This stage lasted about 20-30 h until ecdysis occurred. The genomic DNA was extracted from the silk glands, which were collected once every hour after silkworm pupation, and ana3006

Journal of Proteome Research • Vol. 6, No. 8, 2007

lyzed by agarose gel electrophoresis. A DNA ladder was detected about 12 h after pupation (Figure 1), a hallmark of the degradation phase, indicating the occurrence of PCD. Thus, the silk glands were collected at 12-13 h after pupation as dying cells for 2-DE analysis, marked as sample C; while the glands collected at 8-9 h as committed cells, marked as sample B. The intact cells were collected at the beginning of pupation, marked as sample A. 3.2. 2-DE Analysis of Silk Gland Proteins during PCD. To investigate temporal changes of the silk gland protein profile during PCD, we carried out 2-DE analysis of the proteins from the three sample groups as described above. Each sample was subjected to triplicate runs, and the results were highly reproducible. Representative gels are shown in Figure 2. Across all the samples, about 1000 protein spots were repeatedly detected on silver-stained gels using Image Master Software. Quantitative image analysis revealed , totally, 77 protein spots exhibiting significant (p < 0.05) changes in intensity (Figure 2). The enlargements of four typical regions with differentially expressed proteins were shown in Figure 3. In total, we found 34 protein spots that were up-regulated during silk gland PCD, whereas 43 were down-regulated. Moreover, stage-specific protein spots were also detected: seven for the intact cells, six

Proteomic Analysis of Silk Gland Programmed Cell Death

research articles

Figure 5. Identification of spot 35 by MS. The protein from spot 35 was excised from gels and digested with trypsin, and the resulting peptides were analyzed using a Bruker-Daltonics AutoFlex TOF-TOF LIFT Mass Spectrometer. (A) MS spectra; the ion 1158.62 marked with an asterisk was analyzed by MS/MS. (B) MS/MS spectra of ion 1158.62. The y and b ions and their corresponding peptide sequences are shown. The protein was identified as Elongation factor 1-beta’ (NCBI GI: 56378319) by a database search.

for the committed cells, and two for the dying cells. Interestingly, we also found that those differentially expressed proteins could be distributed into four patterns (Figure 4): pattern I, 8 proteins differentially expressed among all the sample groups investigated; pattern II, 54 proteins expressed differentially between sample A and B as well as sample A and C, but no difference between sample B and C; pattern III, 8 proteins differentially expressed in A-B and B-C but not A-C; pattern IV, 7 proteins expressed at the same level only between sample A and B. Most of these proteins, 54 in pattern II, showed differential expression between sample A and sample B, but remained the same level between sample B and C. Only few of them, 7 in pattern IV, differentially expressed between sample B and C, but were the same between sample A and B. Which means most of the differentially expressed proteins might be regulated during 0-8 h after pupation. 3.3. Identification of the Differentially Expressed Proteins by MS. To identify the proteins with differential expression patterns during silk gland PCD, we combined 2-DE and MALDI-

TOF MS to identify the differentially expressed proteins. Twenty-two differentially expressed protein spots were randomly excised from the preparative gels. Twelve of them were up-regulated, and 10 were down-regulated. After they were digested in-gel by trypsin, the proteins were identified by MALDI-TOF MS. As summarized in Tables 1 and 2, 17 protein spots were successfully identified by PMF or MS-MS analysis, and the MS spectrum of spot 35 was shown in Figure 5 as a representative and typical spectrum for the peptide mapping of this spot. Sixteen monoisotopic peptide masses were submitted into the MS-Fit program for the PMF analysis of this spot. Furthermore, this spot was identified by MS-MS analysis. Both of them identified spot 35 as an elongation factor. 3.4. Gene Transcription Profile Analysis by RT-PCR. To confirm the MS result, we use RT-PCR to examine the gene transcription. Nine different genes from B. mori, listed in Tables 1 and 2, were selected for the analysis. The gene-specific primers were listed in Table 3, and actin was chosen as an internal control. As shown in Figure 6, five genes showed Journal of Proteome Research • Vol. 6, No. 8, 2007 3007

research articles

Jia et al.

Table 3. Primer Sequences Used for RT-PCR

a

spot no.

forward primer

reverse primer

10 15 19 24 25 27 35 38 40 actina

ATGGTGCGAACCATGTCG ATGGTGGACAGTCAGACGCAA ATGGCTGATGAAGAAAAGAAAACC ATGGCATCTGCATTAGTGCCCG CTTTGGTGTAGTGTCCGTTTTC ATGAAGTGTCTGTGGCTGTTAGTGA ATGGCTGTAGGAGACGTTA ATGTCACTGCTGCCATTCA AATTCCAAAATGCTTCGATACTTAG GACCCAGATCATGTTCGAAACATTCAACAC

CGCCTCTAACATCTGCGGCAT AAAAAACCGGATTTGATCCG TTTTTTTCCAAACAAGAGAAGGCGT ACGACTCGTTTGAGGCTCCACATC TGCTCATTTTACCAATCTTCCA TAAACACGTGTGCACCACTTTTT GATTTTGTTAAATGCAGCAA TTGTTTTGTTTCGTTGCTCT ATTTATTTAATACACGTTCGTAAC CCAGGGTACATGGTGGTACCACCGGACA

B. mori cytoplasmic actin gene A3 (accession no. X04507).

Table 4. Potential Functions of the Identified Proteins spot no.

NCBI GI

protein description

gene ID/TrEMBL entry

1

37543675

Type IV collagen

Q53EJ9

3

20151445

GH24458p

37871

4

127966

NADPH-cytochrome P450 reductase

29441

6

30984490

Protein kinase

Q7T5C4

7

62287003

Optineurin

496250

10

6683594

Nuclear hormone receptor E75B

Q9U5G3

13

50806440

Similar to zinc finger protein 235

426821

15

49022791

Broad-complex Z2-isoform

Q6I7P4

16

26006981

Caspase-6 precursor

P55212

19

26985165

Caspase-1

Q8I9V7

21 24

45185127 95102982

ABL103Wp Proteasome subunit beta 7

Q1HPQ9

25

40923063

Hypothetical protein

Q99GT6

27

1351426

Wnt-1 protein precursor

692745

35

232030

Elongation factor 1-beta′

P29522

38 40

56378319 40947030

Heat shock protein hsp20.1 Hypothetical protein

Q5R1P6 -

consistent mRNA and protein expression patterns (10, 15, 25, 35, and 40), whereas the rest showed inconsistent expression patterns, which could be explained by translational or posttranslational regulation during silk gland PCD.

4. Discussion The silk gland of the silkworm is a specified larval tissue. It shrinks when spinning of the cocoon is completed, and dies shortly after pupation. This process includes PCD of the gland, 3008

Journal of Proteome Research • Vol. 6, No. 8, 2007

description of potential function

Function: Extracellular matrix structural constituent Process: Phosphate transport Function: Caspase activity Process: Proteolysis Function: NADPH-hemoprotein reductase activity, oxidoreductase activity Process: Electron transport Function: Nucleotide binding. Protein serine/threonine kinase activity. Transferase activity. Process: Protein amino acid phosphorylation. Function: Probably part of the TNF-alpha signaling pathway thatcan shift the equilibrium toward induction of cell death. May act by regulating membrane trafficking and cellular morphogenesis Molecular function: Sequence-specific DNA binding, steroid hormone receptor activity, transcription factor activity, zinc ion binding Process: Regulation of transcription. Function: Nucleic acid binding Process: Regulation of transcription Molecular function: Metal ion, nucleic acid, protein binding, zinc ion binding Function: Involved in the activation cascade of caspases responsible for apoptosis execution. Cleaves poly(ADP-ribose) polymerasein vitro, as well as lamins. Overexpression promotes programmed cell death. Function: Caspase activity, cysteine-type peptidase activity Process: Proteolysis Hypothetical protein Process: Proteolysis Ecdysteroid UDP-glucosyltransferase family. Function: Transferase activity, transferring hexosyl groups Process: Metabolism Function: Ligand for members of the frizzled family of seven transmembrane receptors Function: EF-1-beta and EF-1-beta′ stimulate the exchange of GDP boundto EF-1-alpha to GTP. Process: Response to unfolded protein, protein folding Conserved Domain: Two DM9 domains

tissue degeneration, and ultimately elimination.15,16 In this study, we first used agarose gel electrophoresis of genomic cDNA to determine the appropriate time when the silk gland cells initiated apopotosis and then selected three time points for analysis corresponding to before, during, and after the initiation of apoptosis. Since the emergence of DNA ladder can be detected as early as 12 h after pupation, it suggested that PCD of the silk gland was accelerated in this period. Some apoptosis-related proteins were up-regulated at this stage, such

Proteomic Analysis of Silk Gland Programmed Cell Death

Figure 6. Gene transcription profile analysis by RT-PCR. Nine genes encoding different proteins from B. mori were selected for gene transcription profile analysis by RT-PCR. The specific primers used are listed in Table 3; the actin gene was selected as a reference gene. (A) Samples from intact silk glands; (B) samples from silk glands 8-9 h after pupation (the committed tissues); (C) samples collected 12-13 h after pupation (the dying tissues).

as spot 16, identified as caspase-6 precursor, and spot 19, identified as Bombyx caspase-1, a homologue of DrICE. Both of them are classified as executioner caspases,27 suggesting that some components of the apoptosis pathway are involved in this type of cell death. The proteins from silk glands of group A, B, and C, which represent the intact, committed, and dying cells during PCD, respectively, were separated by 2-DE. Interestingly, we observed that most of the differentially expressed proteins appeared between samples A and B; in contrast, few of them were detected between samples B and C (Figure 4), indicating that the PCD of silk gland was initiated at early stage, with which most of the associated proteins were regulated at that time. MS analysis of those 22 differentially expressed protein spots followed by a database search revealed that 17 proteins might play some roles in the PCD process. Eleven spots were identified by PMF analysis, while some of them were identified as silkworm homologous protein sequences. This is possibly due to the limitation of protein database of silkworm, for there are no more than 2000 sequences of silkworm available in the database when we performed fingerprint mapping using MS-fit. To estimate false-positive identification, we compared the theoretical pI and molecular weight with the observed position of the excised protein spot on the gels, and the unreliable identifications were discarded. Six protein spots were identified by MS-MS; two of them (spots 25 and 40) were matched expressed sequence tag (EST) sequences. In total, we obtained six identified silkworm protein sequences by MSMS analysis, and 11 protein sequences by PMF (Tables 1 and 2).

research articles Among the newly identified proteins listed in Table 4, the largest group was proteins associated with proteolysis, including caspases (spots 3, 16, and 19), and one proteasome subunit (spot 24). The caspases belong to a conserved protein family that is the executioners of apoptosis.28,29 Our results showed that some caspases were up-regulated during silk gland PCD, suggesting that part of the apoptosis pathway may be involved in this process. To initiate apoptosis, the caspases should be activated by proteolysis,30 and some researches also found the expression of certain caspases was up-regulated during this process,31,32 which suggests that the increased expression of pro-caspase may be correlated with the activation. Our RTPCR results showed that the amount of spot 19 mRNA, identified as caspase-1, was invariable among the three sample groups (Figure 6). We found the mRNA of spot 19 remained the same level between samples A and B; at the same time, the spot 19 protein was accumulated in sample B. When the cells turned from committed (sample B) to dying (sample C), the mRNA transcription of spot 19 still remained as high as before, but the amount of protein spot 19 did not increase in sample C. This observation suggests that the increased part of protein spot 19 may have turned from pro-caspase to active caspase. The spot 24, identified as beta-subunit of the proteasome, was observed to be suppressed during silk gland PCD in our study. This is consistent with previous studies, in which the authors suggest that the major function of the proteasome is the degradation of short-lived proteins, including signaling molecules, cell cycle regulators, transcription factors, and inhibitory molecules.33 Inefficient degradation of these proteins will eventually lead to cell death. Our findings indicate there are some identified differentially expressed proteins involved in signal transduction pathways. For example, spot 7 is a potential part of the TNF-R signaling pathway, may shift the equilibrium toward induction of cell death. In mammals and Drosophila, TNF-R signaling can lead to apoptosis or immune response34 Spot 27, identified as Wnt1, is a key protein in Wnt pathway. The Wnt family proteins participate in multiple developmental events during embryogenesis and adult tissue homeostasis, and perturbations in Wnt signaling promote both human degenerative diseases and cancer.35 Ecdysteroid UDP-glucosyltransferase (EGT) (spot 25), BRC-Z2 (spot 15), and E75B (spot 10) are involved in the ecdysone pathway. Our results suggest that those pathways may have functions during silk gland PCD. There were some differentially expressed protein spots identified as hypothetical protein (spots 21 and 40). The results of BLAST in Swiss-Prot and NCBInr databases showed that there is no protein similar to those two proteins. However, further studies with bio-informatics showed two DM9 conserved domains in spot 40 protein. A number of studies have demonstrated that the cells from the salivary gland of Drosophila or the silk gland of B. mori die in response to changes in the circulating levels of ecdysteroid hormones.8,15,36-38 20-Hydroxyecdysone (20E) regulates the E75A, BHR3, and BR-C genes in the anterior silk gland of silkworms but not the E75B and βFTZ-F1 genes, whereas the later two genes are regulated by 20E during salivary gland cell death in Drosophila.12,39 Using 2-DE, we found that a protein (spots 25) homologous with EGT was suppressed, while BRCZ2 (spot 15) and E75B (spot 10) were up-regulated during PCD in the silk gland. The BR-C encodes a family of zinc finger transcription factors,40 and E75B encodes the nuclear receptor.41 In Drosophila, the BR-C is required for both rpr and hid Journal of Proteome Research • Vol. 6, No. 8, 2007 3009

research articles transcription, while E75B is sufficient to repress diap2.42 Research on EGT suggests that this protein renders ecdysteroid hormones inactive by conjugating sugars from UDP-sugars to ecdysone.43 Our findings indicate that during PCD the silk gland represses the expression of spot 25, EGT homologous proteins, a kind of ecdysteroid hormones suppressor. Then the ecdyson signals are amplified by the early genes, BR-C and E75B, to trigger silk glands into programmed cell death.

Acknowledgment. We thank Prof. Kan Liao and Prof. Xiangxiong Zhu for the suggestions on experiment design. We also thank Shanghai Applied Protein Technology Co. Ltd. for the technology support. This work was supported by a National High-Tech R&D Program (2006AA10A119), a National Basic Research Program of China (2005CB121000), and a grant (06JC14079) from the Shanghai Commission of Science as well as support from the SIBS reproductive development project. References (1) Jacobson, M. D.; Weil, M.; Raff, M. C. Programmed cell death in animal development. Cell 1997, 88 (3), 347-54. (2) Ellis, H. M.; Horvitz, H. R. Genetic control of programmed cell death in the nematode C. elegans. Cell 1986, 44 (6), 817-29. (3) Steller, H. Mechanisms and genes of cellular suicide. Science 1995, 267 (5203), 1445-9. (4) Kerr, J. F.; Wyllie, A. H.; Currie, A. R. Apoptosis: a basic biological phenomenon with wide-ranging implications in tissue kinetics. Br. J. Cancer 1972, 26 (4), 239-57. (5) Lockshin, R. A.; Williams, C. M. Programmed cell death-I. Cytology of degeneration in the intersegmental muscles of the pernyi silkmoth. J. Insect Physiol. 1965, 11 123-33. (6) Schwartz, L. M.; Truman, J. W. Peptide and steroid regulation of muscle degeneration in an insect. Science 1982, 215 (4538), 1420-1. (7) Dai, J. D.; Gilbert, L. I. Programmed cell death of the prothoracic glands of Manduca sexta during pupal-adult metamorphosis. Insect Biochem. Mol. Biol. 1997, 27 (1), 69-78. (8) Jiang, C.; Baehrecke, E. H.; Thummel, C. S. Steroid regulated programmed cell death during Drosophila metamorphosis. Development 1997, 124 (22), 4673-83. (9) Chinzei, Y. Biochemical evidence of DNA transport from the silk gland to the fat body of the silkworm, Bombyx mori. J. Insect Physiol. 1975, 21 (1), 163-71. (10) Tambunan, J.; Kan Chang, P.; Li, H.; Natori, M. Molecular cloning of a cDNA encoding a silkworm protein that contains the conserved BH regions of Bcl-2 family proteins. Gene 1998, 212 (2), 287-93. (11) Uhlirova, M.; Foy, B. D.; Beaty, B. J.; Olson, K. E.; Riddiford, L. M.; Jindra, M. Use of Sindbis virus-mediated RNA interference to demonstrate a conserved role of Broad-Complex in insect metamorphosis. Proc. Natl. Acad. Sci. U.S.A. 2003, 100 (26), 15607-12. (12) Tsuzuki, S.; Iwami, M.; Sakurai, S. Ecdysteroid-inducible genes in the programmed cell death during insect metamorphosis. Insect Biochem. Mol. Biol. 2001, 31 (4-5), 321-31. (13) Kim, E. J.; Park, H. J.; Park, T. H. Inhibition of apoptosis by recombinant 30K protein originating from silkworm hemolymph. Biochem. Biophys. Res. Commun. 2003, 308 (3), 523-8. (14) Matsunami, K.; Kokubo, H.; Ohno, K.; Xu, P.; Ueno, K.; Suzuki, Y. Embryonic silk gland development in Bombyx: molecular cloning and expression of the Bombyx trachealess gene. Dev. Genes Evol. 1999, 209 (9), 507-14. (15) Terashima, J.; Yasuhara, N.; Iwami, M.; Sakurai, S. Programmed cell death triggered by insect steroid hormone, 20-hydroxyecdysone, in the anterior silk gland of the silkworm, Bombyx mori. Dev. Genes Evol. 2000, 210 (11), 545-58. (16) Tashiro, Y.; Morimoto, T.; Matsuura, S.; Nagata, S. Studies on the posterior silk gland of the silkworm, Bombyx mori. I. Growth of posterior silk gland cells and biosynthesis of fibroin during the fifth larval instar. J. Cell Biol. 1968, 38 (3), 574-88. (17) Matsuura, S.; Morimoto, T.; Nagata, S.; Tashiro, Y. Studies on the posterior silk gland of the silkworm, Bombyx mori. II. Cytolytic processes in posterior silk gland cells during metamorphosis from larva to pupa. J. Cell Biol. 1968, 38 (3), 589603.

3010

Journal of Proteome Research • Vol. 6, No. 8, 2007

Jia et al. (18) Bursch, W.; Ellinger, A.; Kienzl, H.; Torok, L.; Pandey, S.; Sikorska, M.; Walker, R.; Hermann, R. S. Active cell death induced by the anti-estrogens tamoxifen and ICI 164 384 in human mammary carcinoma cells (MCF-7) in culture: the role of autophagy. Carcinogenesis 1996, 17 (8), 1595-607. (19) Schulte-Hermann, R.; Bursch, W.; Grasl-Kraupp, B.; Marian, B.; Torok, L.; Kahl-Rainer, P.; Ellinger, A. Concepts of cell death and application to carcinogenesis. Toxicol. Pathol. 1997, 25 (1), 8993. (20) Liang, X. H.; Jackson, S.; Seaman, M.; Brown, K.; Kempkes, B.; Hibshoosh, H.; Levine, B. Induction of autophagy and inhibition of tumorigenesis by beclin 1. Nature 1999, 402 (6762), 672-6. (21) Lee, C. Y.; Wendel, D. P.; Reid, P.; Lam, G.; Thummel, C. S.; Baehrecke, E. H. E93 directs steroid-triggered programmed cell death in Drosophila. Mol. Cell 2000, 6 (2), 433-43. (22) Martin, D. N.; Baehrecke, E. H. Caspases function in autophagic programmed cell death in Drosophila. Development 2004, 131 (2), 275-84. (23) Nakanishi, Y. H.; Kato, H.; Utsumi, S. Polytene chromosomes in silk gland cells of the silkworm, Bombyx mori. Experientia 1969, 25 (4), 384-5. (24) Gage, L. P. Polyploidization of the silk gland of Bombyx mori. J. Mol. Biol. 1974, 86 (1), 97-108. (25) Zhang, P.; Aso, Y.; Yamamoto, K.; Banno, Y.; Wang, Y.; Tsuchida, K.; Kawaguchi, Y.; Fujii, H. Proteome analysis of silk gland proteins from the silkworm, Bombyx mori. Proteomics 2006, 6 (8), 2586-99. (26) Li, X. H.; Wu, X. F.; Yue, W. F.; Liu, J. M.; Li, G. L.; Miao, Y. G. Proteomic analysis of the silkworm (Bombyx mori L.) hemolymph during developmental stage. J. Proteome Res. 2006, 5 (10), 280914. (27) Lamkanfi, M.; Declercq, W.; Kalai, M.; Saelens, X.; Vandenabeele, P. Alice in caspase land. A phylogenetic analysis of caspases from worm to man. Cell. Death Differ. 2002, 9 (4), 358-61. (28) Nicholson, D. W.; Thornberry, N. A. Caspases: killer proteases. Trends Biochem. Sci. 1997, 22 (8), 299-306. (29) Cohen, G. M. Caspases: the executioners of apoptosis. Biochem. J. 1997, 326 ( Pt 1), 1-16. (30) Salvesen, G. S.; Dixit, V. M., Caspases: intracellular signaling by proteolysis. Cell 1997, 91 (4), 443-6. (31) Tews, D. S. Characterization of initiator and effector caspase expressions in dystrophinopathies. Neuropathology 2006, 26 (1), 24-31. (32) Maurer, C. W.; Chiorazzi, M.; Shaham, S. Timing of the onset of a developmental cell death is controlled by transcriptional induction of the C. elegans ced-3 caspase-encoding gene. Development 2007, 134 (7), 1357-68. (33) Adams, J. The proteasome: structure, function, and role in the cell. Cancer Treat. Rev. 2003, 29 (Suppl. 1), 3-9. (34) Hoffmann, J. A.; Reichhart, J. M. Drosophila innate immunity: an evolutionary perspective. Nat. Immunol. 2002, 3 (2), 121-6. (35) Logan, C. Y.; Nusse, R. The Wnt signaling pathway in development and disease. Annu. Rev. Cell Dev. Biol. 2004, 20, 781-810. (36) Evans-Storms, R. B.; Cidlowski, J. A. Regulation of apoptosis by steroid hormones. J. Steroid Biochem. Mol. Biol. 1995, 53 (1-6), 1-8. (37) Thummel, C. S. Files on steroids-Drosophila metamorphosis and the mechanisms of steroid hormone action. Trends Genet. 1996, 12 (8), 306-10. (38) Lee, C. Y.; Baehrecke, E. H. Steroid regulation of autophagic programmed cell death during development. Development 2001, 128 (8), 1443-55. (39) Sekimoto, T.; Iwami, M.; Sakurai, S. Coordinate responses of transcription factors to ecdysone during programmed cell death in the anterior silk gland of the silkworm, Bombyx mori. Insect Mol. Biol. 2006, 15 (3), 281-92. (40) DiBello, P. R.; Withers, D. A.; Bayer, C. A.; Fristrom, J. W.; Guild, G. M. The Drosophila Broad-Complex encodes a family of related proteins containing zinc fingers. Genetics 1991, 129 (2), 385-97. (41) Segraves, W. A.; Hogness, D. S. The E75 ecdysone-inducible gene responsible for the 75B early puff in Drosophila encodes two new members of the steroid receptor superfamily. Genes Dev. 1990, 4 (2), 204-19. (42) Jiang, C.; Lamblin, A. F.; Steller, H.; Thummel, C. S. A steroidtriggered transcriptional hierarchy controls salivary gland cell death during Drosophila metamorphosis. Mol. Cell 2000, 5 (3), 445-55. (43) O’Reilly, D. R.; Miller, L. K. A baculovirus blocks insect molting by producing ecdysteroid UDP-glucosyl transferase. Science 1989, 245 (4922), 1110-2.

PR070043F