Proteomic and Behavioral Analysis of Response to Isoliquiritigenin in Brains of Acute Cocaine Treated Rats Jae-Pil Jeon,‡ Russell J. Buono,| Bok Ghee Han,‡ Eun Young Jang,§ Sang Chan Kim,† Chae Ha Yang,*,†,§ and Meeyul Hwang*,† The Research Center for Biomedical Resource of Oriental Medicine Daegu Haany University, Daegu, South Korea, Korea BioBank, National Institute of Health, Seoul, Korea, Department of Physiology, Daegu Haany University, Daegu, South Korea, and Research Service, Department of Veteran Affairs Medical Center, Coatesville, Pennsylvania 19320 Received April 1, 2008
Isoliquiritigenin (ISL) is a licorice flavonoid with chalcone structure and is an active component of the root of the plant genus Glycyrrhiza. In addition to anti-inflammatory and antioxidant effects, ISL was previously reported to antagonize increased striatal dopamine release. In the present study, we aimed to investigate whether ISL has an effect on hyperlocomotion in animals subjected to acute cocaine administration and whether ISL modulates acute cocaine-induced molecular changes. To achieve our goals, we analyzed behavior and differential proteomic changes between ISL and vehicle in acute cocaine treated rats. Locomoter activity was reduced in ISL treated animals compared to vehicle in acute cocaine treated rats. Two dimensional electrophoresis (2-DE) revealed that 56 proteins were differentially expressed in response to ISL. Further proteomic analyses using mass spectroscopy, and subsequent validation experiments confirmed that ISL induced changes in proteins related to metabolism, signal transduction, protein folding and transport, oxidative stress, and neural toxicity. Furthermore, cocaineinduced neuronal toxicity was attenuated by ISL treatment, suggesting a neuroprotective role of ISL. Keywords: Isoliquiritigenin (ISL) • cocaine • striatum • locomotor activity • 2-DE • MALDI-TOF-MS
Introduction Isoliquiritigenin (ISL) is a licorice flavonoid with chalcone structure (4, 2′, 4′-trihydroxychalcone), and is an active component present in plants of the genus Glycyrrhiza. Glycyrrhizae radix (G. radix, licorice) is one of the oldest and most popularly used botanicals in Eastern medicine. G. radix roots contain flavonoids and pentacyclic triterpene saponin as major constituents, which include liquiritigenin (LQ), isoliquiritigenin (ISL), liquiritin, liquiritin apioside, glycyrrihizin and glycyrrihizic acid.1 G. radix extract has been reported to produce sedative, antitussive, anticarcinogenic, antihistamic and anti-inflammatory properties.2 In addition, ISL has been shown to have a variety of cellular or physiological function such as vasorelaxant, antioxidant and estrogenic properties. Effects of licorice or its component such as ISL on physiological or behavioral parameters in response to psychostimulants have not been systematically studied. However, one study in rats showed that * To whom correspondence should be addressed. Meeyul Hwang, Ph.D, The Research Center for Biomedical Resource of Oriental Medicine, Daegu Haany University, 162-4, Sang-Dong, Suseong-Gu, Daegu 706-828, South Korea.Phone,82-53-770-2296;fax,82-53-770-2335;e-mail,
[email protected]. Chae-Ha Yang, Ph.D Department of Physiology, College of Oriental Medicine, Daegu Haany University, Daegu 706-828, South Korea. Phone, 82-53-7702239; fax, 82-53-768-6340; e-mail,
[email protected]. ‡ Korea BioBank, National Institute of Health. | Coatesville Veteran’s Affairs Medical Center. § Daegu Haany University. † The Research Center for Biomedical Resource of Oriental Medicine Daegu Haany University.
5094 Journal of Proteome Research 2008, 7, 5094–5102 Published on Web 11/11/2008
glycyrrihizic acid attenuated anxiogenic behavior and increased brain monoamine level induced by fluoxetin, a serotonin reuptake inhibitor.3 We previously reported that ISL showed an inhibitory effect on cocaine-induced dopamine release in the nucleus accumbens of rat brain.4 Dopamine (DA) is one of the best described neurotransmitters within the mammalian nervous system, and is known to be a critical contributor to reward pathways activated by drugs of abuse. ISL also caused alterations of c-Fos expression in cocaine-treated rat brain.4 c-Fos is a protooncogene protein expressed in response to cocaine treatment, and functions as an intermediary in regulation of neuropeptide gene expression.5 On the basis of these results, we hypothesized that ISL would have an effect on cocaine-induced behavioral changes and comprehensive molecular changes. At present, effective pharmacotherapies have yet to be developed for cocaine dependence. A majority of treatments for cocaine abuse are ineffective, and hence, the need for new compounds to be screened and tested for efficacy is a priority for success in treating addiction.6 Cocaine is a psychostimulant and abused drug that influences behavior and brain physiology.7 It elicits the increase of extracellular DA release from dopaminergic neurons. The dopaminergic neurons in nigrostriatal pathway, which originate in the substantia nigra and ascend into dorsal striatum, play an essential role in the control of voluntary motor movement.8 Cocaine acts by increasing extracellular DA levels resulting in hyperlocomotion and other behavioral changes. In rodents, 10.1021/pr800237s CCC: $40.75
2008 American Chemical Society
Response to Isoliquiritigenin in Brains of Cocaine Treated Rats acute administration of cocaine also induces behavioral changes including increased locomotor activity. Elevated DA levels also stimulate D1/D2-like DA receptor signaling, which in turn leads to the up-regulation of several molecular markers.9 These molecular changes alter the properties of individual neurons and the overall function of neural circuits in limbic system. Ultimately, this leads to the complex behaviors that characterize an addicted state.10 Proteomics is increasingly regarded as a valuable tool in elucidating global changes in complex biological systems that involve large numbers and networks of proteins.11 Identifying biologically significant changes in expression of proteins after acute drug administration leads to hypotheses regarding pathogenic mechanisms underlying disease and treatment. To date, there have been few reports using proteome analyses to identify proteins differentially regulated in response to psychostimulants.12 However, there is no report on proteome analysis on brain protein expression after acute cocaine administration compared to coadministration of cocaine and a putative remedy. Specifically, very little is known regarding the comprehensive protein changes caused by ISL treatment in the acute cocaine treated rat brain. In the present study, we aimed to determine whether cocaine-induced behavioral changes and protein expressions would be altered in the striatum by ISL administration. To examine the alteration of protein expression profiles, we used 2-DE proteomics in combination with image analysis software and mass spectrometry. The association of two-dimensional electrophoresis with MALDI-TOF mass spectrometry and database interrogations allowed us to identify 56 proteins differentially expressed in ISL treated rat brain following cocaine treatment. In particular, we identified various proteins implicated in the regulation of metabolic activity and signal transduction.
Materials and Methods Animals. Twenty-four male Sprague-Dawly (SD) rats, 6 weeks of age and weighing approximately 200 g were used in this study. The colony room was maintained at proper temperature and humidity and was on a 12 h light/dark cycle. Food and water were freely available. All animal use procedures were approved by the Institutional Animal Care and Use Committee and were accomplished in accordance with the provisions of the NIH “Guide for the Care and Use of Laboratory Animals”. Measurement of Locomotor Activity. After arrival, the rats were allowed to habituate to the environment for more than 1 week. The rats were divided into four groups: Normal (vehicle and saline), Cocaine (vehicle and cocaine), ISL (ISL and saline) and Cocaine plus ISL (ISL and cocaine). ISL was provided by Dr. Kim (Daegu Haany University, South Korea). All animals received ISL (20 mg/kg in 5% Tween 80, po) or vehicle (5% Tween 80, po) 1 h prior to cocaine (20 mg/kg in saline, ip) administration. Dose response curves for ISL activity on dopamine release were previously reported, and the dose used for this study was derived from this prior work.4 After injections, rats were placed in open rectangular chambers (60 × 26 × 36 cm) with black Perspex walls and a black metal floor in which rats can freely move around. Each rat was monitored by an infrared sensitive camera positioned above each chamber. These cameras were connected to a PC running LabView 6.1 software with a Raptor image acquisition card. A custom program written in the LabView programming environment processed the video images to detect movement of the rats
research articles
Figure 1. (A) Chemical structure and molecular weight of isoliquiritingenin (ISL). (B) Schematic representation of brain regions (striatum) for 2-D electrophoresis.
within the cage during testing. Movement was measured as the number of pixels changing from black (the color of the background) to white (the color of the rat) for each second of testing, and counted as locomotor activity.13 Locomotor activity was measured for 1 h after cocaine injections. Sample Preparation. The rats were decapitated 2 h after the cocaine injection. Striatum was obtained from brain using a rat brain matrix (Figure 1B), rapidly frozen using liquid nitrogen, and kept at -80 °C until use. The frozen brain tissue was homogenized with a lysis buffer (5 mM EDTA, 9.5 M Urea, 4% (v/v) CHAPS, 65 mM DTT, and protease inhibitors) and incubated for 1 h at room temperature followed by sonication. The homogenates were centrifuged at 16 000g for 20 min at 15 °C, and stored at -70 °C until use. The protein concentration of the final extract solution was determined using the Bradford method. Two-Dimensional Gel Electrophoresis. Protein samples were mixed with loading buffer for the Isoelectric Pulse Gel (IPG) strips. The mixture was applied to dry 170 mm immobilized pH 3-10 linear gradient strips (ReadyStrip IPG strip, Bio-Rad) in a PROTEAN IEF cell (Bio-Rad). Complete sample uptake into the strips was achieved after 12 h at 20 °C. Focusing was performed at 250 V for 30 min, at 10 000 V for 3 h, and at 10 000 V for 65 000 Vh. Current was limited to 50 µA per strip, and temperature maintained at 20 °C for all IEF steps. For SDSPAGE, the IPG strips were incubated in equilibration buffer containing 37.5 mM Tris-HCl (pH 8.8), 6 M urea, 2% (w/v) SDS, 30% (v/v) glycerol, and 2% (w/v) DTT for 15 min, and then incubated for 15 min in equilibration buffer supplemented with 2.5% (w/v) iodoacetamide. The equilibrated IPG strips were transferred for the second dimension SDS-PAGE onto 12% Duracryl gels (180 × 160 × 1.5 mm). Electrophoresis was carried out using a SE600 system (Amersham Pharmacia) with 25 mM Tris, 192 mM glycine and 0.1% (w/v) SDS as the running buffer at 20 °C at 120 V per gel for 8 h, or until the bromophenol blue Journal of Proteome Research • Vol. 7, No. 12, 2008 5095
research articles
Jeon et al.
Table 1. Primers for Real-Time PCR Amplification gene name
accession no.
Gamm enolase
M11931
Glial fibrillary acidic protein
U03700
Hsp 60
X54793
Na(+)/H(+) exchange regulatory cofactor NHE-RF2
AF294257
Phosphoglycerate mutase 1
M76591
Rap 2b
AF386786
had reached the bottom of the gel. Data shown are means of three independent experiments. For the differential analysis, statistical significance was estimated with Student’s t test. Values of p < 0.05 were considered significant. Staining of 2-DE Gels. Coomassie blue staining was performed according to Neuhoff et al.14 Gels were fixed overnight in 50% (v/v) ethanol containing 2% (w/v) phosphoric acid. Gels were then incubated for 1 h in 34% (v/v) ethanol containing 17% ammonium sulfate, 2% (w/v) phosphoric acid and 1 g of Coomassie blue G-250, and then stained in this solution for 1 day. 2-D Image Analysis. The staining pattern on the 2D gels were digitized at 300 dpi resolution using a UMAX PowerLook 1120 (UMAX Technologies, Inc., Dallas, TX) scanner. A calibration filter using different shades of gray was applied to transform pixel intensities into optical density units. The scans were exported in TIFF format and imported into PDQUEST (BioRad) image software for analysis. Briefly, after automatic spot detection, the background was removed from each gel and the images were edited manually, that is, adding, splitting, and removing spots. One gel was chosen as the master gel and used for the automatic matching of spots in the other 2-DE gels. In-Gel Trypsin Digestion. To identify the proteins, spots from preparative 2-DE gels were excised, cut into 1-2 mm2 pieces and destained at room temperature in 50 mM NH4HCO3 buffer (pH8.8) containing 50% acetonitrile (ACN) for 1 to 2 h. After washing with 50 µL of ACN, the gel pieces were dehydrated and dried thoroughly in a vacuum dryer (Contrator 5301, Eppendorf) for a few minutes. The dried gel pieces were rehydrated with 20 µL of 50 mM NH4HCO3 (pH 8.0), containing 20 µg/mL trypsin (Promega) and protein digestion proceeded at 37 °C overnight. The samples were then dried in a vacuum dryer and resuspended in 3 µL of 0.1% TFA before MALDITOF MS analysis. Mass Spectrometry and Database Search. For acquisition of the mass spectrometric peptide maps of the proteins, 1 µL of the generated cleavage products was mixed with 1 µL of matrix solution (10 mg/mL, R-cyano-4-hydorxycinnamic acid in 50% ACN/ 0.1% TFA) and the mixed solution was spotted onto a 96-spot MALDI target. The mixture was air-dried at room temperature before the acquisition of the mass spectra. MALDITOF-MS analyses were performed on a Voyer DE-STR MALDITOF mass spectrometer (Applied Biosystems). The MALDI-TOF mass spectrometer was operated in positive-ion, delayedextraction (200 ns delay time) reflector mode. Results were analyzed with Data Explorer software (Applied Biosystems) to obtain accurate masses for all the peptides in the tryptic digest. The resulting peptide mass fingerprints, together with the pI 5096
Journal of Proteome Research • Vol. 7, No. 12, 2008
primer sequence (5′ to 3′)
Tm
product size (bp)
forward: atgucctcacagtgaccaaccc reverse: agagactcggtcacagagccaa forward: gatgaaccaacctgaggctg reverse: accttcctctccagatccacac forward: gctcgagccttaatgcttcaa reverse: ggacttccccactctgttca forward: gatggcagtgctggaagaga reverse: tattgacccgagtagctcgagc forward:catcccatcgtctatgaactg reverse: ccacagcttccatggctttac forward:ctgtacatcaagaatggccagg reverse: egtttcacgcggatgatct
82
109
83
101
79
107
81
103
81
101
82
107
and MW values (estimated from the 2-DE gels), were used to search the Swiss-Prot or NCBI nonredundant protein databases with a special search tool [MS-FIT from Protein Prospector V 4.0.4 (http://prospector.ucsf.edu)], which compares the experimentally determined tryptic peptide masses with theoretical peptide masses calculated for proteins contained in the SwissProt or NCBI protein databases. Search parameters were (50-200 ppm peptide mass tolerance and one maximum missed cleavage. Western Blotting. Tissues were homogenized in lysis buffer containing 50 mM Tris-HCl, 150 mM NaCl, 1% Triton X-100, 2 mM EDTA, 1 mM EGTA, 1 mM phenylmethylsulfonyl fluoride (PMSF) including protease inhibitor cocktail. Homogenates were kept 20 min on ice and centrifuged 15 min at 12 000 rpm at 4 °C. Total proteins were fractionated by 10-12% gel electrophoresis and electrophorectically transferred to PVDF membrane. Membranes were incubated with primary antibodies; anti-c-Fos (Santa Cruz, 1:1000), anti-GAPDH (Santa Cruz, 1:2000), anti-gamma enolase (Santa Cruz, NSE, 1:2000), antiglial fibrillary acidic protein (Cell signaling, GFAP, 1:2000), anti-heat shock protein 60 kDa (Santa Cruz, Hsp60, 1:2000), anti-ubiquitin carboxyl-terminal hydrolase L1 (Santa Cruz, UCHL1, 1:1000), anti-Na (+)/H (+) exchange regulatory cofactor 2 (Santa Cruz, NHRF2, 1:1000), and anti-ras related protein 2b (Abcam, Rap2b, 1: 1000) followed by HRP-conjugated secondary antibody (Santa Cruz, 1:2000) and developed using enhanced chemiluminescent detection methods (ECL kit, Amersham Pharmacia Biotech, U.K.). Real-Time RT-PCR. Total RNA from rat striatum was extracted using Trizol, according to the manufacturer’s protocol (Invitrogen). Total RNA (0.5 µg) was reverse transcribed using 100 U Superscript II RT (Invitrogen) at 42 °C for 50 min and 5 pmol oligo(dT)16. Real-time quantitative PCR using SYBR/ GREEN I dye (Applied Biosystems) was performed with ABI PRISM 7700 (Applied Biosystems). The comparative Ct method was employed for quantification of transcripts according to the manufacturer’s protocol (User Bulletin #2, Applied Biosystems). Measurement of delta Ct was performed at least in triplicate. Amplification of the single product in RT-PCR was confirmed by monitoring the dissociation curve. All primers were designed with Primer Express 2.0 software (Applied Biosystems) and based on sequences downloaded for individual rat mRNAs. The primers for real-time PCR are listed in Table 1. PCR amplification was performed in triplicate wells using the following cycle conditions: 1 cycle at 50 °C for 2 min and 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s and 60 °C for 1 min. Data were collected at the threshold, where amplification was linear. Rat GAPDH was used as a reference gene for normalization.
Response to Isoliquiritigenin in Brains of Cocaine Treated Rats
research articles
locomotor activity in normal rats (Figure 2). Therefore, ISL might exert the suppressive effect specifically on cocaineinduced hyperlocomotion. This finding was consistent with our previous result that ISL diminished the increase of extracellular DA level in response to cocaine, but had no effect on the normal extracelluar DA level.4 Taken together, ISL antagonized the effect of cocaine on behavioral changes in rats. 2-DE Image of the Striatum of Cocaine-Treated Rats. To investigate the protein expression profiles of cocaine-treated brain, we performed 2-D electrophoresis in conjugation with quantitative image analysis. A 2-DE protein map of cocainetreated brain was constructed as a prerequisite for subsequent comparative proteomic studies of cocaine plus ISL-treated brain. Two gels per sample were processed simultaneously and analyzed with PDQUEST 2-D software. Figure 3 showed a typical 2-DE gel pattern of protein extract from cocaine-treated striatum in the absence or presence of ISL. More than 1000 spots were detected.
Figure 2. The ISL effect on acute cocaine-induced locomotor activity. (A) Time course of locomotor activity and (B) total counts of locomotor activity for duration of 60 min (n ) 8) *p < 0.05, Normal vs Cocaine, #p < 0.05, Cocaine vs Cocaine + ISL by Student’s t test.
Cytotoxicity Assays. The glial-like cells, U373 MG, were purchased from ATCC and cultured at 37 °C in 5% CO2 in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum (FBS), 50 units/mL penicillin, and 50 mg/mL streptomycin. For all experiments, cells were grown to 70-80% confluence. Equal numbers of U373 MG cells (2 × 104 cells/ well of 48 well) were seeded on tissue culture plates and were treated with or without ISL for 30 min prior to cocaine treatment at 50-70% confluence. Cytotoxicity was determined with MTT assay (3-[4, 5-dimethylthiazol-2-yl]-2, 5-diphenyltetrazolium bromide). Statistical Analysis. Statistical analysis of data was carried out using the SPSS 11.0 version Statistic software. Data were statistically analyzed by repeated-measures ANOVA and all post hoc Tukey tests were to compare the experimental and control groups.
Results and Discussion Effect of ISL on Cocaine-Induced Locomotor Activity. First, we examined the behavioral effect of ISL on cocaine-treated rats. Behavior was assessed by locomotor activity measurements. Since ISL at a dose of 20 mg/kg has shown physiological effects on cocaine-treated rats,4 we used 20 mg/kg of ISL to examine the behavioral effect. Rats were divided into four groups; normal, ISL, cocaine, and cocaine plus ISL groups. Compared to the normal group, cocaine-treated animals showed hyperlocomotion that included rearing (Figure 2). The locomotor activity of the cocaine group peaked at 20 min after cocaine injection, and declined gradually (Figure 2A). As shown in Figure 2A, the cocaine plus ISL group showed less locomotor activity than the cocaine group at each time point. Furthermore, total counts of locomotor activity were significantly lower in the cocaine plus ISL group compared to the cocaine group (Figure 2B). In addition, ISL alone has no effect on the
Identification of Differentially Expressed Proteins by MS. We selected at least 100 spots which were differentially expressed from the 2-D gel. Those spots were subjected to trypsin digestion and MALDI-TOF analysis. Among them, 56 spots were identified by database search. These spots exhibited more than 1.5-fold up- or down-regulation in response to ISL treatment. A summary of the identified proteins is shown in Table 2. Protein identification was validated by agreement between the apparent Mr and pI determined from 2-D gels. Among 56 spots, 42 spots were increased, and 14 spots decreased in the cocaine plus ISL group compared to the cocaine group. Identified proteins had functions related to metabolism, signaling transduction, oxidative stress, protein folding and transport, and others. Metabolic Proteins. Of the proteins identified, 12 proteins (21.4%) are involved in the regulation of several metabolic pathways. Most of them were up-regulated (e.g., phosphoglycerate mutase 1) and some were down-regulated (e.g., gamma enolase) in the cocaine plus ISL group compared to the cocaine group. Enolase is a glycolytic enzyme catalyzing the reaction pathway between 2-phospho glycerate and phosphoenol pyruvate. In mammals, enolase molecules are dimers composed of three distinct subunits (alpha, beta and gamma). The alpha subunit is expressed in most tissues and the beta subunit only in muscle. The gamma subunit is expressed primarily in neurons and in normal and neoplastic neuroendocrine cells.15 Gamma enolase has neurotrophic and neuroprotective properties on a broad spectrum of central nervous system (CNS) neurons.16 Moreover, gamma enolase has been used as a maker of neuron and glial cell injury due to chronic or overdose cocaine administration.17 Signal Transduction Pathway. Twelve proteins (21.4%) related to signal transduction pathways were identified including ras-related protein (Rap)-2b and neurofibromin. Most of them are related to regulation of G-protein or Ras signaling. Ras signaling plays important roles in cellular response to psychostimulants. Ras/mitogen-activated protein kinases are upregulated in response to psychostimulants, resulting in biochemical and molecular changes in dopaminergic neurons and development of behavioral sensitization to psychostimulants.18 Ras-related proteins have functions that include signal transduction, vesicle transport, exocytosis, control of cytoskeletal organization and neurotransmitter release.19,20 Rap2b is rapidly induced by dexamethasone which suppresses the effects Journal of Proteome Research • Vol. 7, No. 12, 2008 5097
research articles
Jeon et al.
Figure 3. Protein expression maps of cocaine-treated rat striatum. Protein from cocaine treated rat striatum was separated on a pH 3-10 IPG strip in the first dimension and on an SDS-PAGE (12%) gel in the second dimension. A section (left at the bottom) shows a representative Coomassie-stained gel of proteins derived from cocaine alone treated rat brain. Three different areas in the gel from the control group are enlarged to compare gel images of the corresponding areas in each gel between the cocaine group and cocaine plus ISL group.
of cocaine treatment by attenuation of corticosteroid release in rats.21,22 In this study, ISL treatment induced the increase of Rap2b expression. Protein Folding and Transport. Ten of the differentially regulated proteins were associated with functions related to protein folding and transport including heat shock protein 71 kDa (Hsp70) and 60 kDa (Hsp60). Heat shock proteins of the 60 and 70 kDa classes play a role in the recognition of nascent peptides, and ensure proper folding, transport and targeting of proteins. Heat shock or stress proteins act as molecular chaperones and play a central role in protecting cellular homeostatic processes from environmental and physiologic insult by preserving the structure of normal proteins and repairing or removing damaged ones.23 There are few reports regarding the role of heat shock proteins and their relevance to cocaine addiction. One study demonstrated that heat shock proteins are induced in the cerebellum of cocaine-treated rats, suggesting a role for these proteins related to the correct folding of proteins.24 Psychostimulants also induced stressor-like effects on the levels of brain Hsps.25 In addition, heat shock protein expression has been used as an important index of stress effects in the ischemic brain.26 Among heat shock proteins, Hsp60 is reported to contribute to cocaine induced hepatotoxicity.27 However, their function has not been determined in response to acute or chronic administration of cocaine in brain. In our results, Hsp60 was down-regulated in response to ISL. Oxidative Stress. Six proteins associated with oxidative stress were identified including peroxiredoxin 1 and 2, protein DJ-1, 5098
Journal of Proteome Research • Vol. 7, No. 12, 2008
and thioredoxin domain-containing protein 12. Cells of the nervous system show high sensitivity to oxidative stress. Reactive oxygen species (ROS) generation is proposed to be involved in aging and a number of neurodegenerative diseases including Alzheimer’s disease,28 and ischemia/reperfusion models.29 In addition, ROS is associated with psychostimulantinduced neurotoxicity. Psychostimulants increase release of dopamine and its metabolites which generate nitric oxide and ROS in brain, causing neuronal cell death.30 This hypothesis is supported by studies of antioxidants, such as ascorbic acid or vitamin E, which provide neuroprotection against psychostimulant-induced cell death.31 Interestingly, isoliquiritigene was reported to have an effect on reactive oxygen species (ROS) production in several cell types by regulation of NF-kB signaling.32 Peroxiredoxin participates in the signaling cascades of growth factors and tumor necrosis factor-alpha by regulating the intracellular concentrations of peroxide.33 It plays an important role in eliminating peroxides generated during metabolism. However, its function has not been determined in ISL treatment. In our study, peroxiredoin 1 and 2 were up-regulated by ISL. Others. Of the remaining proteins identified, five were related to cell growth and death, three were structural proteins (e.g., glial fibrillary acidic protein), three were proteins related to synthesis and degradation (e.g., ubiquitin carboxyl-terminal hydrolase L1), two transcription factors (e.g., homeobox protein Lhx1), and others that fit no specific category. Glial fibrillary acidic protein (GFAP) is an intermediate filament (IF) protein that is found in glial cells such as
research articles
Response to Isoliquiritigenin in Brains of Cocaine Treated Rats a
Table 2. Differentially Expressed Proteins in Response to ISL in Cocaine Treated Rat Striatum spot no.
protein name
pI MW (kDa) accession number Mowse score sequence coverage (%) fold change
Metabolism 47 28 64 47 39 54 35 57 35 33 26 13
4.38 × 6.43 × 190 2.03 × 9742 6.88 × 15.7 541 75.5 4704 2123 16049
47 56 18 46 27 31 14 15 14 17 35 40
-2.8 ( 0.3 1.8 ( 0.1 1.9 ( 0.1 1.5 ( 0.2 2.7 ( 0.4 1.8 ( 0.2 2.2 ( 0.3 -1.6 ( 0.2 3.1 ( 0.3 4.2 ( 0.4 7.8 ( 0.6 -3.6 ( 0.2
1354 1627 10129 95 7.29 517 474 174 49 2168 330 1694
15 39 6 24 11 13 15 13 9 16 20 16
2.1 ( 0.2 2.5 ( 0.2 2.8 ( 0.3 -1.4 ( 0.1 -1.7 ( 0.1 -1.9 ( 0.3 3.7 ( 0.3 4.0 ( 0.4 3.8 ( 0.4 3.0 ( 0.4 3.0 ( 0.2 3.0 ( 0.4
2.30 × 107 611 177 3.12 × 107 1813 1265 2677 85.6 230 4751
22 15 13 52 22 15 12 22 21 40
1.5 ( 0.2 -4.9 ( 0.5 4.4 ( 0.6 -2.5 ( 0.3 1.4 ( 0.3 1.7 ( 0.2 7.3 ( 0.5 6.7 ( 0.4 -2.1 ( 0.3 8.0 ( 1.0
1545 3424 101 15453 126 137
24 37 25 30 18 26
1.6 ( 0.2 1.5 ( 0.2 1.6 ( 0.1 -1.6 ( 0.2 7.5 ( 0.4 2.0 ( 0.3
306 11553 136 8.1 71703
19 52 16 5 31
4.4 ( 0.2 7.1 ( 0.5 1.9 ( 0.2 1.6 ( 0.1 -9.0 ( 1.0
7.10 × 107 440454 19.5
53 9 14
-2.9 ( 0.4 -1.5 ( 0.2 2.2 ( 0.2
Protein Synthesis and Degradation 5.1 25 Q00981 7.8 38 P09367 6.2 54 P07152
1.05 × 107 356 281
51 22 7
-1.8 ( 0.3 3.6 ( 0.3 6.8 ( 0.6
Others 69 42 35 45 21
2.48 × 106 906149 1041 380 509
25 22 30 5 25
-4.1 ( 0.3 2.9 ( 0.3 2.8 ( 0.2 2.0 ( 0.3 1.5 ( 0.2
2 15 27 28 29 30 37 41 43 44 47 52
Gamma enolase Phosphoglycerate mutase 1 5′-nucleotidase precursor Alpha enolase Fructose bisphosphate aldolase C Dihydrolipoyl dehydrogenase Sulfotransferase 1C2 Cytochrome P450 Sulfotransferase 1C2A Alcohol sulfotransferase A Trosephosphate isomerase V-ATPase F subunit
5.0 6.8 6.5 6.2 6.8 8.0 8.2 7.0 7.0 7.6 6.5 5.5
3 5 14 18 23 24 31 32 39 40 45 53
14-3-3 epsilon Ras-related protein Rap-2b Neurofibromin ADP-ribosylation factor-like protein 5A Beta ARK 2 Aconitate hydratase Casein kinase II CaMK II subunit gamma Phospholipase D3 Vitamin D3 receptor Mitogen activated protein kinase 4 Diphosphoinositol polyphosphate phosphohydrolase
1 4 6 10 13 22 36 48 51 54
Heat shock cognate 71 kDa Autophagy protein 5 Ras-related protein Rab-27 Heat shock protein 60 kDa Secretogranin-5 Dynamin 1 -like protein Na(+)/H(+) exchange regulatory cofactor Sigma adaptin 3b GTP-binding protein Rheb Peptidyl prolyl cis-trans isomerase like 3
8 12 16 42 49 55
Peroxiredoxin-2 Protein DJ-1 Peroxiredoxin-1 Dimethylaminohydorlase 1 Thioredoxin domain containing protein 12 Dimethylargininase 1
17 20 25 26 50
IGF-binding protein Phosphatidylethanolamine-binding protein 1 Thyrotropin receptor precursor Whirlin Glia maturation factor beta
9 11 56
Glial fibrilary acidic protein Spectrin beta chain Tropomysin beta chain
7 19 38
Ubiquitin carboxyl-terminal hydrolase LI Dehydratase/Deaminase MMP-10
21 33 34 35 46
Serum albumin precursor Glutamine synthetase Sialytransferase 3 LIM/homeobox protein Lhx1 ELL-associated protein of 20 kDa
P07323 P25113 P21588 P04764 P09117 Q6P6R2 Q9WUW8 P10634 Q9WUW9 P22789 P48500 P50408
Signal Transduction 4.6 29 P62260 4.7 20 P61227 6.9 32 P97526 6.3 21 P51646 7.5 80 P26819 7.9 85 Q9ER34 7.3 45 P19139 7.3 64 Q672K1 6.1 54 Q5FVH2 5.9 48 P13053 7.8 31 Q63454 6.0 19 Q566C7
Protein Folding and Transport 5.4 70 P63018 5.6 32 Q3MQ06 5.1 25 P23640 5.9 61 P63039 5.5 24 P27682 6.6 84 035303 7.2 37 Q920G2 5.8 17 P62744 5.7 20 Q62639 6.3 18 Q812D3 Oxidative Stress 5.3 22 6.3 20 8.3 22 5.8 31 5.3 19 5.8 31
P35704 088767 Q63716 008557 Q498E0 008557
Cell Death and Growth 8.5 30 P24594 5.5 20 P31044 7.2 86 P21463 7.5 98 Q810W9 5.3 16 Q63228 Structure Plasticity 5.4 50 P47819 5.6 27 Q9QWN8 4.7 33 P58775
6.1 6.7 8.8 7.9 6.0
P02770 P09606 Q64686 P63007 P0C0A1
1010 107 106 106
a The MS spectra of protein digests were compared with Swiss-Prot and NCB Inr database using the MS-FIT database-searching program. Protein names and functions have been assigned according to Swiss-Prot/TrEMBL and PubMed. The table shows the differentially expressed proteins (ratio g 1.5) that were up- or down-regulated (-) in response to isoliquiritigenin (ISL). The fold change column corresponds to the expression level of each protein in cocaine plus ISL treated striatum in relative to cocaine alone treatment. Results are means of three independent expressions performed for each condition. The spot numbers are identical to those given in Figure 3.
astrocytes.34 Astrocytes actively shape synaptic plasticity and respond to metabotropic glutamate receptor activation due to psychostimulants. Following cocaine withdrawal period, GFAP expression is increased in the prefrontal cortex (PFC) and in the nucleus accumbens.35 In addition, GFAP levels increase in astrocytes during acute and chronic amphetamine or cocaine
exposure.36 But its function has not yet been determined. Our results showed that GFAP was down-regulated by ISL in the cocaine-treated brain. Confirmation of Differentially Expressed Proteins by Western Blot. To confirm the 2-D gel data, we performed Western blot analysis on six selected proteins (Figure 4). Since Journal of Proteome Research • Vol. 7, No. 12, 2008 5099
research articles
Figure 4. Validation of the 2-D gel electrophoresis data by Western blot in rat striatum. Total cell lysates were separated on an SDS-PAGE gel and immunoblotting was performed with anti-c-Fos, anti-gamma enolase (NSE), anti-ras related protein 2b (Rap2b), anti-heat shock protein 60 kDa (Hsp60), anti-glial fibrillary acid protein (GFAP), anti-Na (+)/H (+) exchange regulatory cofactor (NHRF2) and anti-ubiquitin carboxyl-terminal hydrolase isozyme L1 (UCHLl).
c-Fos has been used as a maker to assess the pharmaceutical activity of acute cocaine at molecular level, we first examined the ISL effect on the cocaine-induced c-Fos expression. As shown in Figure 4, c-Fos protein expression was decreased by ISL. We previously observed the suppressive effect of ISL on the cocaine-induced c-Fos expression by immunohistochemistry in the nucleus accumbens (NAc) of rat brain.4 Therefore, this finding was consistent with our previous report. The protein expression of selected genes is shown in Figure 4. Among six selected genes, GFAP expression was decreased more than 50% in the presence of ISL. And gamma enolase 5100
Journal of Proteome Research • Vol. 7, No. 12, 2008
Jeon et al. (NSE), heat shock protein 60 kDa (Hsp 60) and ubiquitin carboxyl-terminal hydrolase isozyme L1 (UCHL1) expression were also down-regulated by ISL. In contrast, Na (+)/H (+) exchange regulatory cofactor (NHERF2) and ras-related protein 2b (Rap2b) were up-regulated by ISL treatment. Thus, in all cases, the Western blot results confirmed the changes observed by proteomic analysis. Validation of Selected Proteins by Real-Time RT-PCR. Next, we performed quantitative real-time RT-PCR analysis of six ISL-responsive protein genes to validate the proteomic data. The expression pattern of these genes was examined in four experimental groups: normal, ISL, cocaine, and cocaine plus ISL. The mRNA expression of NSE, GFAP, and Hsp60 were decreased in the cocaine plus ISL group compared to the cocaine group. In contrast, gene expression levels of Rap2b, NHERF2 and phosphoglycerate mutase 1 (PGAM1) were increased by ISL. These findings were consistent with the results from the 2-D electrophoresis and Western blot analysis. Thus, mRNA expression of selected genes was closely correlated to their protein expression. On the other hand, there was no substantial alteration in the expression of selected genes between normal and ISL groups (Figure 5). This result was consistent with that of locomotor activity test that ISL alone did not affect behavior of normal rats (Figure 2). Taken together, these results indicated that the ISL-responsive genes were modulated by ISL specifically in the cocaine-treated rats. Anticytotoxic Effect of ISL in Cocaine-Treated Glial Cells. GFAP protein is associated with glial cell damage induced by cocaine and an increase of GFAP expression has been demonstrated as a maker of cell damage.36 Here, ISL attenuated cocaine-induced increases in GFAP protein as well as mRNA expression. Thus, we hypothesized that ISL might be protective against the cytotoxic effect of cocaine on glial cells. To test this hypothesis, we examined cocaine-induced cytotoxicity in glial cells with or without ISL treatment using MTT assays. As predicted, an acute high dose of cocaine treatment exhibited cytotoxic effects on glial cells in culture (Figure 6A). In contrast, ISL significantly reduced the cocaine-induced cytotoxicity of glial cells (Figure 6B), suggesting the anticytotoxic effect of ISL. Licorice has been reported to protect hepatocytes and brain from arsenite treatment and ischemia by blockage of the apoptotic signaling pathway.37,38 In addition, ISL is known to have antioxidant properties and inhibit reactive oxygen species (ROS) production in human endothelial cells by regulation of NF-kB signaling.32 Thus, our result suggests that ISL may play a protective role against cellular damage by cocaine-treatment.
Conclusion In the present study, ISL was shown to suppress the hyperlocomotion induced by cocaine in rat whereas it had no effect on normal locomotion. Because ISL reduced the extracellular DA level in brain of cocaine-treated rat,4 its inhibitory effect on hyperlocomotion might be due to the reduction of extracelluar DA level in brain of cocaine-treated rat. In addition, ISL treatment modulated the cocaine-induced protein and gene changes. We used 2-DE based proteome analyses to identify proteins that were differentially regulated in response to ISL in cocaine-treated rat brain. To our knowledge, this is the first proteomic analysis of cocaine-treated rat striatum with ISL treatment. From 2-DE analysis, we identified 56 proteins whose expression showed consistent differences in their gene expression pattern with ISL treatment. 2-DE analysis was verified by
Response to Isoliquiritigenin in Brains of Cocaine Treated Rats
research articles
Figure 5. Real-time RT-PCR analysis of gene expression in rat striatum. The expression levels of selected genes in cocaine-treated rat striatum were determined by real-time RT-PCR. Total RNA was isolated from rat striatum, reverse transcribed, and amplified with the specific primers indicated in Table 1. GAPDH was used as an internal control, and all data presented here are the averages of three experiments. The Y-axis represents relative gene expression levels to GAPDH expression, 2-∆∆ct of selected genes. Values are means ( SEM *p < 0.05, Normal vs Cocaine, #p < 0.05, Cocaine vs Cocaine + ISL. Eno2, gamma enolase; Gfap, Glial fibrillary acidic protein; Hsp60, heat shock protein 60; Nherf2, Na (+)/H (+) exchange regulatory cofactor; Pgam1, phosphoglycerate mutase 1; Rap2b, ras related protein 2b.
ubiquitin carboxyl-terminal hydrolase isozyme L1. On the basis of the results of MTT assays, cocaine showed cytotoxic effects on cultured glial cells, which was relieved by ISL. Taken together, we suggest that ISL might be a potential protective agent on neuronal cell damage or death caused by exposure to cocaine.
Figure 6. ISL effect on cocaine-induced cytotoxicity in glial cells. (A) Cytotoxic effect of cocaine. Gial cells were dose- and timedependently treated with cocaine. (B) Anticytotoxic effect of ISL on glial cells 2 h after cocaine treatment. Gial cells were treated with ISL (5 or 20 µM) 30 min before cocaine treatment. Cytotoxicity was measured by MTT assay. Values are means ( SEM *p < 0.05, Normal vs Cocaine, **p < 0.05, Cocaine vs Cocaine + ISL.
Western blot and real-time RT-PCR which demonstrated that differentially expressed genes might represent interaction between ISL and cocaine. Most of the proteins differentially expressed are associated with neuronal cell death or injury, such as gamma enolase, glial fibrillary acidic protein and
On the other hand, it is unclear how ISL- responsive genes contribute to the behavioral changes in cocaine-treated animals. Cocaine exposure elicits molecular alterations in individual neurons and alters functioning of the neural system. This leads eventually to the complex behaviors that characterize an addicted state.3,9 Thus, we hypothesize that ISL responsive proteins might play an essential role in protection of neurons, from cocaine action. In addition, we hypothesize that ISL responsive proteins might be involved in cellular pathway to regulate the extracellular dopamine release that acts to attenuate the cocaine-induced behavioral abnormalities. However, more in-depth studies will be required to increase understanding of the contribution of ISL responsive genes to behavior in cocaine-treated brain. In conclusion, we demonstrate that ISL might modulate the cocaine-induced behavioral and molecular abnormality, and show its potential as a drug abuse remedy.
Acknowledgment. This work was supported by the Regional Innovation Center Program (Research Center for Biomedical Resources of Oriental Medicine at Daegu Haany University) of the Ministry of Knowledge Economy. We thank Dr. Chan and Kang for critical advices of 2-D electrophoresis and MS analysis. Disclaimer: The contents of Journal of Proteome Research • Vol. 7, No. 12, 2008 5101
research articles the manuscript do not represent the views of the Department of Veteran Affairs or the United States Government.
References (1) Kamei, J.; Nakamura, R.; Ichiki, H.; Kubo, M. Antitussive principles of Glycyrrhizae radix, a main component of the Kampo preparations Bakumondo-to (Mai-men-dong-tang). Eur. J. Pharmacol. 2003, 469, 159–163. (2) Gruenwald, J. PDR for Herbal Medicines, third ed.; Thomson: Florence, KY, 2004. (3) Shishkina, G. T.; Dygalo, N. N.; Yudina, A. M.; Kalinina, T. S.; Tolstikova, T. G.; Sorokina, I. V.; Kovalenko, I. L.; Anikina, L. V. The effects of fluoxetine and its complexes with glycerrhizic acid on behavior in rats and brain monoamine levels. Neurosci. Behav. Physiol. 2006, 36, 329–333. (4) Jang, E. Y.; Choi, E. S.; Kim, S. C.; Lee, J. R.; Kim, S. G.; Hwang, M.; Yang, C. H. Isoliquiritigenin suppresses cocaine-induced extracellular dopamine release in rat brain through GABA B receptor. Eur. J. Pharmacol. 2008, 587, 124–128. (5) White, J. D.; Gall, C. M. Differential regulation of neuropeptide and proto-oncogene mRNA content in the hippocampus following recurrent seizures. Brain Res. 1987, 427, 21–29. (6) Preti, A. New developments in the pharmacotherapy of cocaine abuse. Addict. Biol. 2007, 12, 133–151. (7) Pierce, R. C.; Kumaresan, V. The mesolimbic dopamine system: The final common pathway for the reinforcing effects of drugs of abuse. Neurosci. Biobehav. Rev. 2006, 30, 215–238. (8) Chinta, S. J.; ersen, J. K. Dopaminergic neurons. Int. J. Biochem. Cell Biol. 2005, 37, 942–946. (9) Anderson, S. M.; Pierce, R. C. Cocine-induced alterations in dopamine receptor signaling: implications for reinforcement and reinstatement. Parmacol. Ther. 2005, 106, 389–403. (10) Nestler, E. J. Molecular basis of long-term plasiticity underlying addiction. Nat. Rev. Neurosci. 2001, 2, 119–128. (11) Seth, G.; Grant1, N.; Walter, P. Blackstock2 proteomics in neuroscience: from protein to network. J. Neurosci. 2001, 21, 8315–8318. (12) Moron, J. A.; Devi, L. A. Use of proteomics for the identification of novel drug targets in brain diseases. J. Neurochem. 2007, 102, 306–315. (13) Shinba, T.; Yamamoto, K.; Cao, G. M.; Mugishima, G.; ow, Y.; Hoshino, T. Effects of acute methamphetamine administration on spacing in paired rats: investigation with an automated videoanalysis method. Prog. Neuro-Psychopharmacol. Biol. Psychiatry 1996, 20, 1037–1049. (14) Neuhoff, V.; Arold, N; Taube, D.; Ehrhardt, W. Improved staining of proteins in polyacrylamide gels including isoelectric focusing gels with clear background at nanogram sensitivity using Coomassie Brilliant Blue G-250 and R-250. Electrophoresis 1988, 9 (6), 255–262. (15) Ueta, H.; Nagasawa, H.; Oyabu-Manabe, Y.; Toida, K.; Ishimura, K.; Hori, H. Localization of enolase in synaptic plasma membrane as an alpha/gamma heterodimer in rat brain. Neurosci. Res. 2004, 48, 379–386. (16) Hattori, T.; Takei, N.; Mizuno, Y.; Kato, K.; Kohsaka, S. Neurotrophic and neuroprotective effects of neuron-specific enolase on cultured neurons from embryonic rat brain. Neurosci. Res. 1995, 21, 191–198. (17) Kessler, F. H.; Woody, G.; Portela, L. V.; Tort, A. B.; De Boni, R.; Peuker, A. C.; Genro, V.; von Diemen, L.; de Souza, D. O.; Pechansky, F. Brain injury markers (S100B and NSE) in chronic cocaine dependents. Rev. Bras. Psiquiatry 2007, 29 (2), 134–9. (18) Licata, S. C.; Pierce, R. C. The roles of calcium/calmodulindependent and Ras/mitogen-activated protein kinases in the development of psychostimulant-induced behavioral sensitization. J. Neurochem. 2003, 85 (1), 14–22. (19) Hall, A. The cellular functions of small GTP-binding proteins. Science 1990, 249, 635–640.
5102
Journal of Proteome Research • Vol. 7, No. 12, 2008
Jeon et al. (20) Sahyoun, N.; McDonald, O. B.; Farrell, F.; Lapetina, E. G. Phosphorylation of a Ras-related GTP-binding protein, Rap-lb, by a neuronal Ca2 /calmodulin-dependent protein kinase, CaM kinase Gr. Proc. Natl. Acad. Sci. U.S.A. 1991, 88, 2643–2647. (21) Kemppainen, R. J.; Behrend, E. N. Dexamethasone rapidly induces a novel ras superfamily member-related gene in AtT-20 cells. J. Biol. Chem. 1998, 273, 3129–3131. (22) Simer, M. R.; Saphier, D.; Goeders, N. E. Dexamethasone suppression of the effects of cocaine on adrenocortical secretion in Lewis and Fischer rats. Psychoneuroendocrinology 1997, 22, 141–153. (23) Hartl, F. U. Molecular chaperones in cellular protein folding. Nature 1996, 381, 571–580. (24) Dietrich, J. B.; Arpin-Bott, M. P.; Kao, D.; Dirrig-Grosch, S.; Aunis, D.; Zwiller, J. Cocaine induces the expression of homer 1b/c, homer 3a/b, and hsp 27 proteins in rat cerebellum. Synapse 2007, 61, 587–594. (25) Hebert, M. A.; O’Callaghan, J. P. Protein phosphorylation cascades associated with methamphetamine-induced glial activation. Ann. N.Y. Acad. Sci. 2000, 914, 238–262. (26) Abe, K.; Kawagoe, J.; Aoki, M.; Kogure, K.; Itoyama, Y. Stress protein inductions after brain ischemia. Cell. Mol. Neurobiol. 1998, 18, 709– 719. (27) Ndikum-Moffor, F. M.; Roberts, S. M. Cocaine-protein targets in mouse liver. Biochem. Pharmacol. 2003, 66, 105–113. (28) Multhaup, G.; Ruppert, T.; Schlicksupp, A.; Hesse, L.; Beher, D.; Masters, C. L.; Beyreuther, K. Reactive oxygen species and Alzheimer’s disease. Biochem. Pharmacol. 1997, 54, 533–539. (29) Hossmann, K. A. Reperfusion of the brain after global ischemia: hemodynamic disturbances. Shock 1997, 2, 95–101. (30) De Vito, M. J.; Wagner, G. C. Methamphetamine-induced neuronal damage: a possible role for free radicals. Neuropharmacology 1989, 28, 1145–1150. (31) Imam, S. Z.; el-Yazal, J.; Newport, G. D.; Itzhak, Y.; Cadet, J. L., Jr.; Ali, S. F. Methamphetamine-induced dopaminergic neurotoxicity: role of peroxynitrite and neuroprotective role of antioxidants and peroxynitrite decomposition catalysts. Ann. N.Y. Acad. Sci. 2001, 939, 366–380. (32) Kumar, S.; Sharma, A.; Madan, B.; Singhal, V.; Ghosh, B. Isoliquiritigenin inhibits IkappaB kinase activity and ROS generation to block TNF-alpha induced expression of cell adhesion molecules on human endothelial cells. Biochem. Pharmacol. 2007, 73, 1602– 1612. (33) Kang, S. W.; Chang, T. S.; Lee, T. H.; Kim, E. S.; Yu, D. Y.; Rhee, S. G. Cytosolic peroxiredoxin attenuates the activation of Jnk and p38 but potentiates that of Erk in Hela cells stimulated with tumor necrosis factor-alpha. J. Biol. Chem. 2004, 279, 2535–2543. (34) Fuchs, E.; Weber, K. Intermediate Filaments: Structure, Dynamics, Function and Disease. Annu. Rev. Biochem. 1994, 63, 345–382. (35) Bowers, M. S.; Kalivas, P. W. Forebrain astroglial plasticity is induced following withdrawal from repeated cocaine administration. Eur. J. Neurosci. 2003, 17, 1273–1278. (36) Malaplate-Armand, C.; Becuwe, P.; Ferrari, L.; Masson, C.; Dauc¸a, M.; Visvikis, S.; Lambert, H.; Batt, A. M. Effect of acute and chronic psychostimulant drugs on redox status, AP-1 activation and proenkephalin mRNA in the human astrocyte-like U373 MG cells. Neuropharmacology 2005, 48, 673–684. (37) Kim, S. C.; Park, J. R.; Lee, J. R.; Seo, J. C.; Yang, C. H.; Byun, S. H. Cytoprotective activity of Glycyrrhizae radix extract against arsenite-induced cytotoxicity. Evidence-based Complemetary Altern. Med. 2008, 5, 165–171. (38) Yu, X. Q.; Xue, C. C.; Zhou, Z. W.; Li, C. G.; Du, Y. M.; Liang, L.; Zhou, S. F. In vitro and in vivo neuroprotective effect and mechanisms of glabridin, a major active isoflavan from Glycyrrhiza glabra (licorice). Life Sci. 2008, 82, 68–78. (39) Koob, G. F.; Le Moal, M. Drug abuse: hedonic homeostatic dysregulation. Science 1997, 278, 52–58.
PR800237S
