Proteomic and interactome approaches reveal ... - ACS Publications

Subscriber access provided by Nottingham Trent University

Article

Proteomic and interactome approaches reveal PAK4, PHB-2 and 14-3-3# as targets of overactivated Cdc42 in cellular responses to genomic instability Luiz E. Silva, Renan C. Souza, Eduardo S. Kitano, Lucas F. Monteiro, Leo K. Iwai, and Fabio L. Forti J. Proteome Res., Just Accepted Manuscript • DOI: 10.1021/acs.jproteome.9b00260 • Publication Date (Web): 03 Sep 2019 Downloaded from pubs.acs.org on September 4, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 59 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of Proteome Research

Proteomic and interactome approaches reveal PAK4, PHB-2 and

as targets of

overactivated Cdc42 in cellular responses to genomic instability

Luiz E. Silva1, Renan C. Souza1, Eduardo S. Kitano2, Lucas F. Monteiro1, Leo K. Iwai2, and Fabio L. Forti1*

1. Laboratory of Signaling in Biomolecular Systems (LSSB), Department of Biochemistry, Institute of Chemistry, University of Sao Paulo, Sao Paulo-SP, CEP 05508-900, Brazil. 2. Special Laboratory of Applied Toxicology (LETA), Center of Toxins, Immune-Response and Cell Signaling (CeTICS), Butantan Institute, Sao Paulo-SP, 05503-000, Brazil.

*Corresponding author: Fábio Luís Forti, PhD Av. Prof. Lineu Prestes, 748, Bl.09i - Sl. 922, CEP 05508-900 Cidade Universitária, São Paulo-SP, Brazil E-mail: [email protected]

1 ACS Paragon Plus Environment

Journal of Proteome Research 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 59

ABSTRACT Cdc42, a member of the Rho GTPase family, is an intracellular signaling protein known for its roles in cytoskeleton rearrangements and, more recently, in apoptosis/senescence triggered by genotoxic stress. In some tumor cells, the overactivation of Cdc42 through the expression of constitutively active mutants (G12V or Q61L), GEF activation or GAP downregulation functions as an antiproliferative or pro-aging mechanism. In this study, human cell lines with different P53 protein profiles were exposed to UV radiation, and the interactions between Cdc42 and proteins that are putatively involved in the DNA damage response and repair mechanisms were screened. The affinity-purified proteins obtained through pull-down experiments of the cell lysates using the recombinant protein baits GST, GST-Cdc42-WT or GST-Cdc42-G12V were identified by mass spectrometry. The resulting data were filtered and used for the construction of protein-protein interaction networks. Among several promising proteins, three targets, namely, PAK4, PHB-2 and 9-4-4F which are involved in the cell cycle, apoptosis, DNA repair and chromatin remodeling processes, were identified. Biochemical validation experiments showed physical and proximal interactions between Cdc42 and the three targets in the cells, particularly after exposure to UV. The results suggest that the molecular mechanisms coordinated by overactivated Cdc42 (with the G12V mutation) to increase the cellular sensitivity to UV radiation and the susceptibility to cell death are collectively mediated by these three proteins. Therefore, the Cdc42 GTPase can potentially be considered another player involved in maintenance of the genomic stability of human cells during exposure to genotoxic stress.

KEYWORDS: Genomic instability, Cdc42, ultraviolet radiation, affinity purification, mass spectrometry, interactome, protein-protein interaction, PAK4, PHB-2, 9-4-4F


Page 3 of 59 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1. INTRODUCTION In humans, the Ras superfamily of small GTPases comprises 154 members distributed in the five well-characterized Ras, Rho, Rab, Arf and Ran protein families. These GTPases share a high level of homology and contain the highly conserved G-domain but show hypervariability in their C-terminal sequences, particularly the CAAX motif, a site that is usually chemically modified with different lipid moieties that enable attachment of the protein to the plasma membrane1. The Rho family of small GTPases is composed of 25 proteins encoded by 22 genes and includes the Rho, Rac, RhoBTB, Rnd, Cdc42-like and Miro subfamilies, and RhoA, Rac1 and Cdc42, which are known as “typical” Rho GTPases,are the classical members of this family2. These enzymes were all first characterized as regulators of cytoskeleton-related cellular processes and are mostly represented by actin-containing structures that coordinate cell-cell or cell-matrix adhesion, migration, polarization, invasion and cycle division, such as lamellipodia, filopodia, and stress fibers3. The first identified member, Cdc42, was the 25th mutant identified in S. cerevisiae (24 mutants of Cdc24 were previously identified) and plays key roles in bud formation (the letters “Cdc” stand for cell division cycle). These mutantcontaining yeasts failed to form buds because they were unable to polarize their actin cytoskeleton toward specific cell wall components, which indicates that the Cdc24 and Cdc42 enzymes link bud formation to nuclear division4,5. In addition to the dynamic regulation ofactin cytoskeleton remodeling-related events, Cdc42 participates in intracellular trafficking, malignant transformation, tumor progression and metastasis. Notably, mutations in Cdc42 have not been detected in human cancers, whereas its overexpression has been observed in a large variety of tumors and has, in some circumstances, been correlated with poor prognosis6. For example, although the dominant negative Cdc42-T17N mutant (or small interfering RNA for Cdc42) blocks UV-induced p38 3 ACS Paragon Plus Environment


Page 4 of 59

activation and apoptosis in COS-1 and HaCaT cells7, the fast-cycling Cdc42 mutants, which are capable of constitutive GDP-GTP exchange, easily promote cellular transformation. Thus, the Cdc42-F28L and Cdc42-D118N mutants both accelerate the cellular capacity for cycling between the GTP- and GDP-bound states and increase survival in the presence of apoptotic signals8. In contrast, the Cdc42-G12V or Cdc42-Q61L mutants, which are well-known ras gene mutants capable of overactivating Ras protein homologs, have been introduced into other Rho GTPases, such as Cdc42, to induce a GTPase-defective phenotype and evaluate the transforming activity of these proteins9. Therefore, the exogenous expression of Cdc42-G12V results in genomic instability in porcine aortic endothelial (PAE) cells, which exhibit definite detachment from the culture plate10. Another study revealed that a xenograft model of nude mice stably expressing overactive Cdc42 exhibited decreased P53 levels and increased VEGF expression, which resulted in the inhibition of tumor angiogenesis11. Additionally, a recent study conducted in HeLa cells showed that overexpression of the active Cdc42-G12V mutant enhanced the genomic instability promoted by ultraviolet (UV) exposure compared with the wild-type (WT) protein or the dominant negative Cdc42-T17N mutant12. Consistent with these findings, another study found that Cdc42 GTPase-activating protein (GAP) deficiency promotes genomic instability and premature aging-like phenotypes in mouse embryonic fibroblasts and/or related tissues13. Similarly to the majority of monomeric small GTPases, Cdc42 is activated by guanine nucleotide exchange factors (GEFs), which induce the dissociation of GDP and the association of GTP, and is inactivated by GTPase-activating proteins (GAPs), which stimulate their intrinsic GTPase activity14. Because the Cdc42 functions associated with genomic instability appear to be based on the constitutive binding of its activated state to GTP and interactions with downstream effectors to promote various outcomes, we decided to explore 4 ACS Paragon Plus Environment

Page 5 of 59 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


these functions during cellular exposure to genotoxic stress. Therefore, we produced recombinant GST-tagged WT and constitutively active mutant (G12V) Cdc42 proteins and used them in affinity chromatography assays to pull down proteins that specifically interact with Cdc42 from lysates of normal and tumor cell lines (normal and abnormal P53 protein status) that had been exposed to UV radiation, which promotes specific DNA lesions. Some of the best protein targets identified by mass spectrometry and reinforced by interactome data (PAK4, PHB-2 and 14-3-3F) play major roles in the constitutively active Cdc42 signaling pathway, which is likely involved in the increase in cellular sensitivity observed in response to DNA damage and the subsequent genomic instability.



Page 6 of 59

2. MATERIALS AND METHODS 2.1. Cell lines The HeLa human adenocarcinoma cell line (cervical cancer epithelial cells, CCL-2) and the MRC5 normal human fibroblast line (normal lung cells, CCL-171) were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA) and were donated to our laboratory by Prof. Hugo A. Armelin (CAT-CEPID, Butantan Institute, Sao Paulo, Brazil) and Prof. Carlos F. M. Menck (ICB, University of Sao Paulo, Sao Paulo, Brazil), respectively. The cells were cultivated in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, Carlsbad, CA, USA) containing 10% fetal bovine serum (FBS, Cultilab, Campinas, SP, Brazil) in a MCO-19AIC Sanyo incubator at 37 °C with 5% CO2. HeLa-Cdc42-G12V clones were generated as previously described12 and maintained in DMEM supplemented with 10% FBS and 100 µg/mL geneticin. For culture maintenance, the cells were washed with PBSA (140 mM NaCl, 2.7 mM KCl, 8 mM Na2HPO4, and 1.5 mM KH2PO4, pH 7.4) and subcultured with a 0.1% trypsin (Gibco-Invitrogen, Carlsbad, CA, USA) solution after reaching 90% confluence. The cell stocks were maintained in culture medium supplemented with 10% DMSO (Sigma, St. Louis, MI, USA) and stored in a freezer at -80 °C (model MDFU33V-PE, Sanyo) or liquid nitrogen tanks. 2.2. Bacterial transformation with plasmids The following protocol was used for heat shock-based bacterial transformation. First, 0.5 Q# of the plasmid of interest was added to 50 Q of competent bacteria &(E/R or BL21). The mixture was incubated at 4 °C for 30 min, and the bacteria were subjected to heat shock by incubation at 42 °C for 2 min and then incubated at 4 °C for 15 min. Four hundred microliters of LB medium (10 mg/mL Bacto-tryptone, 5 mg/mL yeast extract, and 10 mg/ml NaCl, pH 7.5) was added to the cells, and the cells were then incubated at 37 °C for 1 h. The bacteria were subsequently seeded in LB agar medium (10 mg/mL Bacto-tryptone, 5 mg/mL yeast 6 ACS Paragon Plus Environment

Page 7 of 59 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


extract, 10 mg/mL NaCl, and 15 g/L bacterial agar, pH 7) containing ampicillin (100 Q#?% ' or kanamycin (50 Q#?% ' and maintained overnight at 37 °C. 2.3. Polymerase chain reaction (PCR) and agarose gel electrophoresis To amplify the transcripts of interest, PCR was performed using a specific primer pair for each Cdc42 plasmid (at a concentration of 0.2 Q ' and 1 U of Taq polymerase (Go-Taq Green Master Mix; Promega, Madison, WI, USA), according to the manufacturer’s recommended protocol. The primer sequences used for PCR were as follows: EcoR1-Cdc42_F=GAATTCATGCAGACAATTAAGTGTGTTGTTG, EcoR1-nn-Cdc42_F=GAATTCTGATGCAGACAATTAAGTGTGTTGTTG, Not1-Cdc42_R=GCGGCCGCTCATAGCAGCACACACCTGC, BamH1-Cdc42_F=GGATCCATGCAGACAATTAAGTGTGTT, Xho1-nn-Cdc42_F=CTCGAGCTATGCAGACAATTAAGTGTGTT, and BamH1-Cdc42_R=GGATCCTCATAGCAGCACACACCTGC). Five hundred nanograms of cDNA from A172 cells (human glioma, donated by Prof. Daniela S. Basseres, IQ-USP, Sao Paulo, Brazil) or from the plasmid pcefl-GST-Cdc42V12 (donated by Prof. Alessandra Eva, G. Gaslini Institute, Genova, Italy) were used as templates for the PCRs. The reaction products were loaded onto 1% agarose gels containing 0.5 g/mL ethidium bromide in TAE buffer (40 mM Tris-acetate and 1 mM EDTA) and electrophoresed. The amplicon images were acquired using a GelDoc-It2 Imager (UVP) photo documentation system under UV light. The bands corresponding to the PCR products were excised from the gel and purified using GFX-PCR-DNA and Gel-Band Purification kits (GE Healthcare, Chicago, IL, USA) according to the manufacturer’s recommended protocol. 2.4. Plasmid cloning and sequencing The purified PCR products were subcloned into the pGEM-T Easy Vector System (Promega, Madison, WI, USA) according to the manufacturer’s recommended protocol, and the resulting 7 ACS Paragon Plus Environment


Page 8 of 59

products were transformed into competent E. coli strain (E/R cells by heat shock. Colonies of the transformed cells were collected, inoculated in 5 mL of liquid LB medium containing ampicillin (100 Q#?% ' and incubated overnight at 37 °C under constant shaking at 250 rpm. Plasmid DNA containing the insert was extracted using the plasmid Prep Mini Spin Kit (GE Healthcare, Chicago, IL, USA) according to the manufacturer’s protocol. The insert was quantified by measuring its O.D. at 260 nm, and its purity was determined by the ratio of the O.D. at 260 to that at 280 nm. The plasmids were sequenced at the Center for Human Genome Studies (IB-USP, Sao Paulo, Brazil) with a 3730 DNA Analyzer (ThermoFisher, Waltham, MA, USA) using the Big-Dye Terminator Cycle Sequencing Kit (ThermoFisher, Waltham, MA, USA) according to the manufacturer’s recommended protocol. The plasmid sequences were analyzed using Bio-Edit software (Ibis Biosciences, Carlsbad, CA, USA). After the sequences were confirmed, the subcloned plasmids and the final cloning plasmid, pGEX-4T-2 (GE Healthcare, Chicago, IL, USA) containing an N-terminal GST sequence, were digested with pairs of the endonucleases EcoR1, Not1, BamH1 and Xho1 (New England Biolabs, Ipswich, MA, USA), according to the manufacturer’s recommended protocol. The digested products were separated by 1% agarose gel electrophoresis, and the bands of interest were excised and purified as described above. The Cdc42 sequences were cloned into their respective plasmids using the ligase and buffers supplied with the pGEM-T Easy Vector System kit (Promega Madison, WI, USA) according to the manufacturer’s recommended protocol, and the final cloned plasmids were resequenced to confirm the sequences. 2.5. Expression of fusion proteins (Cdc42 baits) in bacteria and purification The pGEX-4T-2, pGEX-Cdc42-WT and pGEX-Cdc42-G12V plasmids were transformed into competent E. coli BL-21 (DE3) bacteria cells through heat shock-based transformation, and the transformed cells were plated on LB agar medium containing ampicillin for the selection of appropriate clones. A bacterial colony transformed with each plasmid (pGEX-4T-2, pGEX8 ACS Paragon Plus Environment

Page 9 of 59 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


4T-Cdc42-WT or pGEX-4T-Cdc42-G12V) was inoculated in 200 mL of LB medium, incubated for 12 h at 37 °C under constant shaking at 200 rpm and then reinoculated in 2 L of LB medium. The cell suspension was maintained at 37 C under constant shaking at 250 rpm until reaching an O.D. of0.6, as measured using a Power-Wave XS spectrophotometer (BioTek, Winooski, VT, USA). Isopropyl V-( thiogalactoside (IPTG) was added to the cell culture at a final concentration of 0.5 mM, and the mixture was incubated at 37 °C with shaking at 250 rpm. After 3 h of induction, the cells were recovered by centrifugation at 8000 rpm and 4 °C for 10 min. The bacterial pellet was resuspended in 20 mL of lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% Triton X-100, 5 mM MgCl2, 1 mM PMSF, and 10 Q#?% leupeptin and aprotinin). The bacteria were lysed on ice through eight 2-min cycles of sonication performed at 1-min intervals using a Vibra-Cell VC 505 sonicator (SONICS, Newtown, CT, USA). After lysis, the material was centrifuged at 14,000 rpm and 4 °C for 30 min, and the soluble fraction containing the GST protein (GST-labeled), GST-Cdc42-WT (designated WT) or GST-Cdc42-G12V (sometimes designated V12) was collected for subsequent affinity purification (AP) chromatography. Twelve microliters of this soluble fraction was incubated with 0.5 mL of glutathione-Sepharose 4B resin (GE Healthcare, Chicago, IL, USA) previously washed with PBS (140 mM NaCl, 2.7 mM KCl, 8 mM Na2HPO4, 1.5 mM KH2PO4, 1 mM CaCl2, and 0.5 mM MgCl2, pH 7.4) for 1 h at 4 °C under constant orbital shaking. The resin-bound protein baits were washed six times with wash buffer (20 mM HEPES, pH 7.5, 150 mM NaCl, 5 mM MgCl2, 1% CHAPS, 0.1 mM PMSF, and 1 Q#?%

leupeptin and aprotinin), resuspended in 5 mL of buffer containing 10%

glycerol, aliquoted and stored at -80 °C. 2.6. Bait-containing bead quantification by SDS-PAGE The produced recombinant proteins were electrophoretically analyzed under denaturing conditions using the method reported by Laemmli (1970)15. SDS-PAGE using1.5-mm-thick 9 ACS Paragon Plus Environment


Page 10 of 59

gels (stacking gel: 5% polyacrylamide, 0.125 M Tris, pH 6.8, 1% SDS, 0.01% ammonium persulfate, and 0.001% TEMED; resolving gel: 12% polyacrylamide, 0.375 M Tris, pH 8.8, 1% SDS, 0.01% ammonium persulfate, and 0.001% TEMED) was performed at a constant voltage of 120 V and variable amperage in running buffer (192 mM glycine, 0.1% SDS, and 25 mM Tris) at room temperature. For bait quantification, 2.5 Q and 5 Q of each sample of the prepared beads (GST, WT and G12V) were electrophoresed in parallel with 2.5, 5, 7.5, 10.0 and 20 Q# of BSA. The proteins were stained with Coomassie Brilliant Blue R-250 (BioRad, Hercules, CA, USA) and scanned with an Odyssey Imager (LI-COR, Lincoln, NE, USA) operated with dedicated Odyssey V 3.0 software (LI-COR, Lincoln, NE, USA), which was used for band quantification. 2.7. Treatment of cells with UV radiation and preparation of cellular lysates HeLa and MRC5 cells under control conditions (hereafter designated “K treatment”) were subjected to two UV irradiation treatments: 100 J/m2UVC followed by incubation at 37 °C for 5min to identify the proteins involved in the rapid response to “high genotoxic stress” (hereafter designated “5-min treatment”) or 10 J/m2 UV followed by incubation at 37 °C for 48h to identify the proteins involved in the late response to “moderate genotoxic stress” (hereafter designated “48-h treatment”). Twenty-four hours prior to these treatments, the cells were usually plated in p100 plates to enable them to reach approximately either 80% (for the K and 5-min treatments) or 40% confluence (for the 48-h treatment), washed twice with PBS (140 mM NaCl, 2.7 mM KCl, 8 mM Na2HPO4, 1 mM KH2PO4, 1 mM CaCl2, and 0.5 mM MgCl2, pH 7.4) and irradiated with the appropriate dose of UV light (260 nm, UVC range) in PBS. The PBS was then exchanged for fresh culture media, and the cells were returned to the incubator and cultured for 5 min or 48 h. Under controlled K conditions, the cells were subjected to the same process but without UV irradiation. After the treatments, the cell plates were placed on ice for 10 min, washed three times with HBS buffer (20 mM HEPES, pH 7.5, 10 ACS Paragon Plus Environment

Page 11 of 59 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


and 150 mM NaCl at 4 °C) and mixed with lysis buffer (20 mM HEPES, pH 7.5, 150 mM NaCl, 5 mM MgCl2, 1% CHAPS, 1 mM PMSF, 2 Q#?% aprotinin, 2 Q#?% leupeptin, 2 Q#?% pepstatin, 1 mM NaF, and 1 mM Na3VO4) at 4 °C. The cells were removed using a cell scraper. The homogenate was centrifuged at 16,000 g and 4 °C for 10 min, and the supernatant fraction was collected and stored in a freezer at -80 °C. The proteins were quantified using the Bradford protein assay reagent (Bio-Rad, Hercules, CA, USA) according to the manufacturer’s recommended protocol. 2.8. Affinity purification chromatography of Cdc42-interacting proteins For the pull down and separation of Cdc42-interacting proteins, 4 mg of total lysate from each cell type (HeLa or MRC5) obtained under each condition were incubated separately with 400 Q# of the three beads previously produced (GST, WT and G12V), and thus, a total of nine conditions were tested for each lineage (Table I). Proteins and beads from all treatment combinations were incubated for 45 min under constant rotation at 4 °C and then centrifuged at 600 g and 4 °C for 3 min, and the beads + proteins were subsequently washed three times with lysis buffer (20 mM HEPES, pH 7.5, 150 mM NaCl, 5 mM MgCl2, 1% CHAPS, 1 mM PMSF, 2 µg/mL aprotinin, 2 µg/mL leupeptin, 2 Q#?%

pepstatin, 1 mM NaF, and 1 mM

Na3VO4 at 4 °C) under the same centrifugation and temperature conditions16,17. After the last centrifugation of the beads, the interacting proteins were released by two washes with 50 Q of a 1 M NaCl solution and collected. The protein concentrations were quantified using the Bradford method.



Page 12 of 59

Table I – Samples used for subsequent MS analyses(the designations are based on the cell treatments and baits used in the Cdc42 pull-down experiments). GST Cdc42-WT Cdc42-G12 V Baits Cell treatments K (Negative Control) 5 min, 100

J/m2

UV

HeLa/MRC5 K GST

HeLa/MRC5 K WT

HeLa/MRC5 K V12

HeLa/MRC5 5 min GST

HeLa/MRC5 5 min WT

HeLa/MRC5 5 min V12

HeLa/MRC5 48 h GST

HeLa/MRC5 48 h WT

HeLa/MRC5 48 h V12

(high stress) 48 h, 10 J/m2 UV (moderate stress)

2.9. Tryptic digestion of the proteins eluted from resin-bait and desalting of peptides Guanidine hydrochloride (GuHCl, final concentration of 4 M) and DTT (final concentration of 5 mM) were added to the samples in solution for trypsin digestion. The samples (at a final concentration of 15 mM) were incubated at 65 °C for 1 h and then incubated at 25 °C in the dark for 1 h. DTT was added to a final concentration of 10 mM, and the samples were incubated at 25 °C for 15 min. Acetone (8 volumes) and methanol (1 volume) were added to the samples at -20 °C and incubated at -80 °C for 3 h. After centrifugation at 14.000 rpm and 4 °C for 10 min, the supernatant was removed, and the pellet was washed twice with methanol (1 volume) at -20 °C and centrifuged again at 14,000 rpm and 4 °C for 10 min. After removing the supernatant, the pellet was dried at 25 °C for 5 min and resuspended in 10 Q of 100 mM NaOH plus 390 Q of HEPES buffer (50 mM HEPES, pH 7.5), and the pH was adjusted to 7.5(18). The proteins were digested using the Sequencing-Grade Modified Trypsin kit (Promega, Madison, WI, USA) at a protease:protein ratio of 1:100, according to the manufacturer’s recommended protocol. Sep-Pak C18 Plus Light Cartridge (Waters, Milford, MA, USA) columns were used to desalt the samples. The columns were preconditioned by successive washes with 10 mL of 0.1% formic acid, 7 mL of 90% acetonitrile + 0.1% formic acid, and 10 mL of 0.1% formic acid. The samples were loaded, washed with 10 mL of 0.1% formic acid and eluted with 4 mL of 50% acetonitrile + 0.1% formic acid. 2.10. Mass spectrometry analysis and peptide identification 12 ACS Paragon Plus Environment

Page 13 of 59 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The peptide samples were dissolved in 20 µL of 0.1% formic acid and analyzed by LCMS/MS (liquid chromatography-tandem mass spectrometry) using an LTQ-OrbitrapVelos mass spectrometer (Thermo Scientific, Bremen, GA, USA) coupled to an Easy-nLCII liquid chromatography system (Thermo Scientific, Bremen, GA, USA). Fifteen microliters of each sample was automatically injected into the pre-C-18 column (100 µL ID x 50 mm; Jupiter 10 Q% Phenomenex, Inc., Torrance, CA, USA) coupled to a C-18 analytical column (75 µL ID x 100 mm, ACQUA 5 Q%S Phenomenex, Inc., Torrance, CA, USA). The peptides were eluted usinga linear gradient from 5% to 40% of solvent B (0.1% formic acid in acetonitrile) for 90 min at a flow rate of 200 nL/min. The electrospray ionization source (ESI source) was operated in the positive mode, and the voltage and temperature were set to 2.0 kV and 200 K, respectively. The mass scan interval considered for the full scan (MS1) was 200-2000 m/z (resolution of 60,000 at 400 m/z) operating in the data-dependent acquisition (DDA) mode, and the ten most intense ions scanned were selected for the collision-induced dissociation (CID) fragmentation event. The minimum signal required to trigger fragmentation events (MS2) of a given ion was set to 5,000 cps, and the dynamic exclusion time was 30 s. The mass spectra resulting from the LC-MS/MS runs were processed using MaxQuant v.1.5.3.12 software tools19,20 and compared with the Swiss-Prot human protein database (Homo sapiens) containing 26,139 proteins (curated on 16 October 2015). The search parameters used in this study were as follows: enzyme, trypsin; tolerance of two cleavages lost by the enzyme; mass error tolerance for the 6-ppm precursor peptide; mass error tolerance for 0.5-Da MS/MS fragments; carbamidomethylation of cysteines as a fixed modification; and variable modifications of the oxidation of methionine and phosphorylation of serine, threonine and tyrosine residues. The false positive rate (FDR) at both the peptide and protein levels was prestipulated to equal 1%. The obtained results are representative of two biological replicates of each condition. The raw data obtained from HeLa or MRC5 cells using MaxQuant were 13 ACS Paragon Plus Environment


Page 14 of 59

preprocessed (log2 transformation of the LFQ values), processed (application of filters to validate the log2 values) and then subjected to a statistical analysis (two-sample T test and the Benjamini-Hochberg FDR test) using Perseus software v.1.5.1521. Within the Perseus package, the negative control proteins (GST-bait) were completely subtracted from the samples of each cell line under the three other conditions (K, WT and G12V) for each cell line, which yielded proteins grouped according to the bait, cell line, treatment condition and individual replicates. Ultimately, these conditions were analyzed using group intersection tools with the numeric Venn diagram function. The proteins obtained after applying these settings were appropriately tabulated for the CRAPome platform (http://crapome.org/) into four columns containing the name of the bait, the name of the sample, the name of the protein and the quantitative MS identification data (in our case, “intensity”). The tables were sent to the CRAPome platform with the default settings. For the primary score, the user controls were used, the background estimate was the default setting, and the combination of replicas was calculated based on the arithmetic mean. For the secondary score, the user and database controls (in our case, iRefIndex), stringent background estimates, and the combination of replicates were calculated based on geometric means, and the results were saved in matrix format. The Saint algorithm in this platform was subsequently used to eliminate nonspecific protein interactions with the baits, and proteins that exceeded the cut-off of the Saint-score of 0.90 were considered the best targets22. 2.11. Gene ontology (GO) analyses For the GO analyses, the protein lists (gene products) were submitted to the Molecular Signatures Database (MSigDB) (http://software.broadinstitute.org/gsea/msigdb), which is a collection of annotated gene sets designed for use with Gene Set Enrichment Analysis (GSEA) software23,24 and the “Investigate Gene Sets” tool. We computed overlaps using the “BP: GO Biological Process” tool and identified the top 100 gene sets with an FDR p-value 14 ACS Paragon Plus Environment

Page 15 of 59 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


less than 0.05. We then ranked the resulting gene sets according to the k/K parameter, which reflects the percentage of proteins in the gene set that was represented in our list. Gene sets with a high k/K value tend to be narrower and less generic and thus represent a good starting point for filtering out redundant and overly broad gene sets. After filtering, we plotted the gene set names against the negative logarithm of their respective FDR q-values. 2.12. Physical protein-protein interaction (PPPI) network analysis The protein data obtained by mass spectrometry were used to identify partners that potentially interact with Cdc42 in PPPI networks25. We used the proteins exclusively identified in the treated cells (5 min and 48 h) as the input or “seed list”, which included the Cdc42 protein used as bait, in Cytoscape software version 3.4.0 (http://www.cytoscape.org) to generate the Cdc42 interaction networks under these specific conditions26. For this experiment, the H. sapiens PPPI data available in many protein databases were used with the APID2NET Plugin27 (http://bioinfow.dep.usal.es/apid/apid2net.html). Proteins with one level of connection between the seed list proteins and validated by at least one experimental method in the literature were considered. A few proteins were discarded from the network construction due to

lack

of

available

data

in

the

accessed

banks.

The

cytoHubba

plug-in

(http://apps.cytoscape.org/apps/cytohubba) was used to identify the most important proteins or hubs in the networks; specifically, the bottleneck ranking method was used to determine the 20 highest ranked proteins from the total nodes28. 2.13. Biochemical validations of the putative new Cdc42 interactions 2.13.1. Affinity purification followed by immunoblotting Affinity purification validation (pull-down) was performed by incubating 30 µg of Cdc42 baits with 600 µg of total protein extracts, which had been quantified and treated (or not) as previously described. For this assay, the cells were lysed in nondenaturing buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, and 1% NP-40) containing protease (2 µg/mL leupeptin, 2 15 ACS Paragon Plus Environment


Page 16 of 59

µg/mL aprotinin A, 2 µg/mL pepstatin A, or 1 mM PMSF) and phosphatase inhibitors (1 mM Na3VO4 and 1 mM NaF). The reaction mixtures were rotated for 1 h at 4 °C, and the samples were centrifuged at 600 g and 4 °C for 3 min. All the supernatants were removed, and the pellets were washed twice with the same lysis buffer supplemented with 0.5% NP-40. After a final centrifugation at 600 g and 4 °C for 3 min, the supernatants were removed, and the pellets suspended in 5x Laemmli buffer for SDS-PAGE followed by immunoblotting analysis with the following primary antibodies: rabbit anti-Cdc42 (1:500, Santa Cruz Biotechnology®, CA, USA), rabbit anti-PHB-2 (1:1000, Cell Signaling®, MA, USA), rabbit

- 9-4-4F

(1:1000, Cell Signaling®, MA, USA) and rabbit anti-PAK4 (1:1000, Cell Signaling®, MA, USA). One hundred micrograms of total protein lysate was used as the input for each condition. 2.13.2. Confocal microscopy For immunofluorescence colocalization analysis, HeLa cells and HeLa-Cdc42-G12V clones were plated 24 h prior to each experiment in six-well plates with coverslips (Knittel Glass®, Germany) at a density of 3.2 x 105 cells/well. After treatment with UVC radiation at the indicated doses, the cells were collected at specific time points and washed twice with PBS (80 mM Na2HPO4, 20 mM NaH2PO4 2.H2O, and 100 mM NaCl, pH 7.2). The cells were subsequently fixed in 100% ice-cold methanol for 10 min at -20 °C, washed twice with PBS and blocked in 3% BSA/PBS (+10% FBS) for 30 min at room temperature. After three washes with PBS, the cells were incubated for 3 h at room temperature with the following primary antibodies: mouse anti-Cdc42 (1:100, Santa Cruz Biotechnology®, CA, USA), rabbit anti-PHB-2 (1:250, Cell Signaling®, MA, USA), rabbit

- 9-4-4F (1:200, Cell Signaling®,

MA, USA) and rabbit anti-PAK4 (1:100, Cell Signaling®, MA, USA). The cells were then washed three times with PBS and incubated with the following secondary antibodies in a dark chamber for 1 h at room temperature: chicken anti-mouse Alexa-Fluor 647 (1:500, 16 ACS Paragon Plus Environment

Page 17 of 59 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Invitrogen™, MA, USA) and chicken anti-rabbit Alexa-Fluor 488 (1:500, Invitrogen™, MA, USA). The cells were subsequently washed with PBS and mounted onto microscope slides containing VectaShield (Vector Laboratories®, CA, USA). Data acquisition was performed using an LSM 780 Zeiss® confocal microscope. 2.13.3. Proximity ligation assay (PLA) The HeLa-Cdc42-G12V clones were plated, treated and fixed as described in 2.13.2. A proximity ligation assay was then conducted using the Duolink® In Situ PLA® kit (SigmaAldrich, St. Louis, MI, USA). The cells were blocked with blocking solution for 1 h at 37 °C and incubated with primary antibodies against Cdc42, PAK-4 and PHB-2 in a humidified chamber for 3 h at room temperature. The secondary PLA probes (anti-rabbit PLUS and antimouse MINUS) were then added, and the slides were incubated in a preheated humidity chamber for 1 h at 37 °C. The ligation reaction was then conducted for 30 min at 37 °C and was followed by an amplification reaction in a preheated humidity chamber for 100 min at 37 °C. The cells were then incubated with green detection reagent for 30 min and mounted onto microscope slides containing VectaShield (Vector Laboratories®, CA, USA). Data acquisition was performed using a fluorescence microscope (Leica widefield DMi8® microscope), and the images were analyzed using LAS-X software.



Page 18 of 59

3. RESULTS AND DISCUSSION 3.1. Cdc42-G12V bait interacts with different protein partners dependent on genotoxic stress and cell types, as determined through affinity chromatography and mass spectrometry identification Cdc42 overactivation has been observed in different cellular circumstances and models, ranging from yeast to humans, and is considered responsible for the typical phenotypic features of polarity and tumorigenesis, among other cellular features29,30. High and prolonged Cdc42 activity is achieved by the overexpression of WT Cdc42, the overactivation of GEFs or the downregulation of GAPs13,31,32 (Fig. 1A). These perturbations of the Cdc42 cycle (Cdc42GDP

Cdc42-GTP) function as antiproliferative and/or pro-aging mechanisms. However, as

previously reported by our research group12 and others9-11,33, Cdc42 overactivation is also related to different aspects of genomic instability through unknown mechanisms13. Cdc42 mutations have not been naturally and frequently detected in human cancers6, but G12V or Q61L mutations lead to constitutive activation of Cdc429 through a different mechanism than that induced by “fast cycling” mutants (F28L or D118N), which exchange GDP for GTP much more rapidly than the WT enzyme8. Some of these activating mutations have been detected in some tumor types and sometimes correlate with poor prognosis in cancer patients9,34,35, as recorded in the Catalogue of Somatic Mutations in Cancer (COSMIC). A search for the cdc42 gene in this database revealed that 65 of the more than 42,325 unique human samples curated and analyzed presented Cdc42 mutations (Fig. 1B). The identified mutations in the amino acid sequence of the cdc42 gene are shown in the bar graph, and the Cdc42-G12V mutation representing the natural overactivated form of Cdc42 in human biopsiesis highlighted (in the red balloon). The pizza charts display the distribution of the different types of mutations in the cdc42 gene at the nucleotide level and the types of mutations registered in the COSMIC (Fig. 1B). Cdc42 is frequently overactivated in many 18 ACS Paragon Plus Environment

Page 19 of 59 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


cancers for different reasons, but the frequency and type of mutations do not make Cdc42 a druggable target for studies from a clinical perspective; however, the meaning of these mutations remains intriguing. The G12V mutation has been extensively used in biochemical studies with small GTPases since it was originally discovered in oncogenic Ras proteins. Therefore, Cdc42-G12V, which represents a similar constitutively active state, was used as the bait in the present study of proteins in genomic instability-induced cells and in our previous cellular studies12.



ACS Paragon Plus Environment

Page 20 of 59

Page 21 of 59 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig. 1. Overview of the most common modes of Cdc42 GTPase overactivation in vitro or in vivo and the most common mutations in the cdc42 gene detailed in the Catalogue of Somatic Mutations in Cancer (COSMIC). A) Schematic representation of the major biological processes involving Cdc42 overexpression. B) The search for the cdc42 gene on the COSMIC website (http://cancer.sanger.ac.uk/cosmic) identified 22 entries, and the CDC42 option was selected to open the Gene View, which displays a graphical histogram of the amino acid mutations across the Cdc42 protein. The pizza charts displaying mutations in the cdc42 gene at the nucleotide-sequence level were obtained with the Mutation Distribution, which is a section displaying an overview of the types of mutations observed, the affected nucleotide and the observed frequency in all the samples in which the gene was analyzed.

To obtain Cdc42 baits, we amplified cDNAs encoding the WT human Cdc42 (Cdc42WT) from a cDNA library of human A172 glioma cells or from the Cdc42-G12V constitutively active mutant from the pcefl-GST-Cdc42-G12V template9 and separately cloned them into the pGEX-4T-2 plasmid, and the sequences were subsequently validated by enzymatic restriction digestion and sequencing (Supplementary Fig. S1). Both constructs were used to produce the recombinant protein baits Cdc42-WT and Cdc42-G12V, which were often normalized by the negative control GST bait only (Supplementary Figs. S2A and S2B). The

recombinant

protein

baits

purified

through

glutathione-Sepharose

4B

resin

(Supplementary Fig. S2C) were subjected to affinity purification chromatography36,37 to identify proteins that interact with Cdc42 in accordance to the experimental workflow designed for this work (Supplementary Fig. S3). HeLa or MRC5 cell lysates were collected 5 min after exposure to 100 J/m2 UV or 48 h after exposure to 10 J/m2 UV (hereafter designated high or moderate genotoxic stress treatments, respectively, Supplementary Fig. S3). The high genotoxic stress condition was used to promote the formation of high levels of DNA lesions and to recruit proteins that function to repair these sites in a translation-independent manner22. Under this condition (5 min after exposure to 100 J/m2), cells will certainly die by apoptosis within a few hours after damage, independently of the triggering of DNA repair pathways, and we intended to identify Cdc42 (WT or constitutively activated) partners or pathways that mediate these rapid cellular responses. In contrast, moderate genotoxic stress (48 h after exposure to 10 J/m2) generates low levels of DNA lesions; these lesions are usually repaired 21 ACS Paragon Plus Environment


Page 22 of 59

by a specific mechanism (the nucleotide excision repair pathway, NER), which allows the cell population to recover and continue to proliferate because only a portion of the cells will undergo apoptosis38,39. This condition enables the expression of the Cdc42 gene and protein, whereas the activities of Cdc42 and its protein partners undergo changes, and this enzyme can also eventually translocate from the plasma membrane to other cellular compartments. These assumptions constitute the basis for the rational choice of genotoxic treatments used in the present study for both the HeLa and MRC5 cell lines, which were selected for the following reasons: 1) the overexpression of Cdc42-G12V sensitizes HeLa cells to UV treatment, and (2) this human cervical cancer cell line40 is an established model of cervical carcinoma that expresses low levels of WT P53 protein and presents deficiencies in fundamental DNA repair pathways49,50. In contrast, the MRC5 cell line is a fibroblast cell that expresses normal levels of P53 protein and DNA repair functions and is thus considered an acceptable “normal” control for epithelial tissues41. The proteins eluted from the chromatographic columns prepared with 18 different samples, which represent all combinations of experimental conditions used for the treatment of HeLa and MRC5 cells (Table I), were subjected to trypsin digestion followed by MS analysis, and the spectra were processed using MaxQuant software to compare the outcomes with the Swiss-Prot database of human proteins19,20. The proteins detected in the samples incubated only with the GST bait, which was used to control for nonspecific interactions in side-by-side reactions, were subtracted from those in the other samples and excluded from the analyses. One hundred forty-nine different proteins were identified in the HeLa cell samples, and 107 proteins were identified in the MRC5 cell samples (Supplementary Tables S1 and 2, respectively). Many proteins previously described in the literature as Cdc42-interacting partners were systematically identified in HeLa cells (e.g., PAK4, IQGAP2, Cdc42EP4 and Cdc42EP3) and in MRC5 cells (e.g., Cdc42EP2, Cdc42EP3, Cdc42EP4, Cdc42BPB, and 22 ACS Paragon Plus Environment

Page 23 of 59 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ARHGEF7). These results demonstrated that the recombinant Cdc42-GST-tagged proteins produced in bacteria were functionally active because they comprised classical regulators (GEFs and GAPs) of this GTPase6 and members of the Borg family of Cdc42 effector proteins (Cdc42EPs)42. Interestingly, the latter have been shown to be responsible for septin cytoskeleton regulation43 and exhibit crosstalk with the DNA Damage Response (DDR) through nuclear accumulation of adaptor protein NCK upon UV radiation in the same HeLa cell model44. These members also establish a potential link to explain the increased sensibility and altered DDR of HeLa cells that stably express overactivated Cdc42 (HeLa-Cdc42-G12V clone) in response to UV radiation shown in our previous work12. In HeLa cells, we detected proteins involved in cell cycle regulation, such as CDKN2A, 14-3-3 , MCM6 and ANAPC13, but no proteins with direct involvement in DNA repair or apoptosis. In MRC5 cells, we detected proteins directly involved in DNA repair, such as APEX1 and MSH2, apoptosis, such as TNFRSF10B, PHB-2, and P53, and cell cycle regulation, such as MCM7, CUL4A/4B and 14-3-3 (Supplementary Tables S1 and 2, respectively).

3.2. Cdc42 has more protein partners in MRC5 than in HeLa cells under genotoxic stress conditions: gene ontology also points to genomic instability biological processes We subsequently analyzed the intersections of the 12 protein sets (six for each cell line) to identify the proteins exclusively present in each sample and in all possible combinations of conditions to subsequently construct and analyze PPPI networks (Table II and Supplementary Table S3). These analyses were performed using Perseus software21 after we excluded probable nonspecific targets of the GST bait based on the Saint-score obtained using the CRAPome platform. The samples incubated with the recombinant Cdc42-G12V bait yielded a larger number of identified proteins, independent of whether the high or moderate genotoxic stress treatment was employed, and this finding can be reasonably explained by the 23 ACS Paragon Plus Environment


Page 24 of 59

fact that the G12V mutation allows higher-affinity interactions between Cdc42 and different effectors, GEFs and GAPs as described above16. The only exception was the HeLa K WT condition, which systematically yielded a greater number of proteins than all the other conditions, and we hypothesized that this finding was an intrinsic experimental error associated with our sample preparations and/or the use of label-free proteomics. Moreover, the samples from the moderate stress treatments (10 J/m2 UV for 48 h) usually yielded a smaller amount of total proteins compared with those found for the other treatments, with the exception of the HeLa cells subjected to the 5-min WT condition (Supplementary Table S3). This result was likely due to the long incubation period after exposure to UV rather than the UV dose itself because this long period allowed the dissociation of many protein-protein interactions to reach the equilibrium state. Protein complexes associated with the DNA repair machinery are rapidly recruited to lesion sites but rapidly dissociate after the repair takes place45,46.

Table II. Number of proteins identified in HeLa (A) and MRC5 (B) cells under the various specific conditions. The proteins were obtained from an analysis of the intersection of six conditions and combinations. The proteins exclusively identified in the UV-treated cells and those obtained using either the Cdc42-WT or Cdc42-G12V bait are shown in red.


Page 25 of 59 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


A)

Cell conditions

HeLa K WT +

HeLa K V12 HeLa 5min WT + +

+ + + +

+

+ + +

+

+ + + + + + + + +

+ +

+ + + +

+ + + + + + + + +

+ + +

+ + +

+ + +

+ + +

+ + + + + + +

HeLa 5min V12 HeLa 48h WT HeLa 48h V12 No of Proteins 37 3 1 + 7 + 4 + 11 1 + 36 + 1 + 4 1 + 1 + 2 + 2 + + 2 1 + 1 + 2 + 1 + 1 + + 4 + + 5 + + 1 + 1 + + 1 + + 1 + 1 + + 2 + + 1 + + 1 + + 2 + + 1 + + + 1 + + + 1 + + 1 + + 2 + + + 4

Twenty-nine out of 149 total proteins were exclusively identified in UV-treated HeLa cells. B)

Cell conditions

MRC5 K WT MRC5 K V12 MRC5 5min WT MRC5 5min V12 MRC5 48h WT MRC5 48h V12 No of Proteins + 2 + 13 + 3 + 24 + 5 + 12 + + 1 + + 2 + + 2 + + 3 + + 5 + + 1 + + 1 + + 1 + + 2 + + + 1 + + 4 + + + + 1 + + + 2 + + + 10 + + + + 1 + + + + 2 + + + + 2 + + + + 1 + + + + 1 + + + + + 3 + + + + + + 2

Forty-nine out of 107 total proteins were exclusively identified in UV-treated MRC5 cells.

Table II shows the number of proteins identified from both cell lines subjected to the control (K), high stress (100 J/m2 UV and incubation for 5 min) and moderate stress (10 J/m2 UV and incubation for 48 h) conditions using each Cdc42 bait (WT or G12V) and all possible 25 ACS Paragon Plus Environment


Page 26 of 59

combinations. The proteins highlighted in red were only identified in the cells under the genotoxic conditions (UV-treated) and not in the cells under the control (K) conditions: a greater number of UV-exclusive proteins was identified in the normal MRC5 cells (part B, 49 proteins) compared with the HeLa tumor cells (part A, 29 proteins). Each UV-exclusive protein was localized, grouped and visualized using Venn diagrams (Fig. 2). For both cell lines, the ellipse named 48 h (shown in green on the left) refers to the proteins identified using both Cdc42-WT and Cdc42-G12V baits under this experimental condition, and the sum is shown in the respective parenthesis and does not exclude proteins also identified in the cells under control (K) conditions. The ellipse named 5 min (shown in red on the right) represents the proteins identified using the two baits under this experimental condition. The ellipse named UV (shown in light blue on the center) refers to all proteins identified exclusively in the cells under the UV-treated conditions (5 min or 48 h), independent of the Cdc42 bait used, and excludes the proteins that were also identified in the untreated cells (named UVexclusive). Thus, for HeLa cells, 29 proteins were identified as UV-exclusive proteins, and 17, eight and four of these proteins were identified 48 h after the UV treatment, 5 min after the UV treatment, and after both (5 min and 48 h) treatments, respectively. Similarly,4 9 proteins were identified in the UV-treated MRC5 cells, and 17, 28 and four proteins were identified 48 h after the UV treatment, 5 min after the UV treatment, and after both (5 min and 48 h) treatments, respectively. The lists of the UV-exclusive proteins identified in HeLa and MRC5 cells subjected to the 5-min or 48-h treatments displayed in Fig. 2 also include potential targets for future validation using cell-based experiments (highlighted in red). For example, some Cdc42-dependent effects controlling the actin cytoskeleton and cell movement are regulated by P53 and might thus contribute to the antitumor activity and pathophysiology of p5311,47,48. However, Cdc42 has not been reported to directly participate in DNA repair or genomic stability events mediated by p53, and because the two cell lines used in this study 26 ACS Paragon Plus Environment

Page 27 of 59 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


present a different P53 protein status, these results reveal a new field of research if the protein-protein interactions identified in this study are confirmed by cellular and biochemical validation studies.

Fig. 2. Venn diagrams showing the total number of proteins in UV-treated HeLa and MRC5 cells (5 min or 48 h) rescued by both Cdc42-WT and Cdc42-G12V baits. For both cell lines, the ellipse named 48 h (on the left) refers to the proteins identified using the sum of the Cdc42-WT and Cdc42-G12V baits under this experimental condition (in parentheses), including proteins identified under the control (K) conditions. The ellipse denoted 5 min (on the right) refers to the proteins identified using the same baits from cells under this experimental condition. The ellipse named UV (on the center) refers to all the proteins identified exclusively in UV-treated cells (5 min or 48 h), independent of the Cdc42 bait used, and excludes the proteins that were also identified under control (K) conditions. The UV-exclusive proteins identified in both cell lines exposed to UV treatments are displayed in black, and suggested targets for experimental validation are highlighted in red.

The identified targets obtained by AP/MS were used to search for related biological processes through GO or gene enrichment analysis performed using the MSigDB. Both the total proteins and the UV-exclusive proteins identified in either HeLa or MRC5 cells, after applying all filtering steps and considering the best p-values obtained, were used to construct bar graphs of –log P versus GO: Biological Processes (Fig. 3). The total proteins identified in HeLa (Fig. 3A) and MRC5 cells (Fig. 3B) belonged to GO terms related to the classical Cdc42 GTPase functions in different tissues, such as the regulation of gene expression, cell cycle, organ morphogenesis and polarity, cell death, intracellular transport, small GTPasedependent signal transduction, and regulation of the length of the actin cytoskeleton3,6,30,33. 27 ACS Paragon Plus Environment


Page 28 of 59

Interestingly, the GO terms (highlighted with asterisks in Figs. 3C and 3D) obtained for the proteins exclusively identified in cells subjected to UV-induced genotoxic stress (moderate + high) are narrowly linked to genomic instability repair events. For example, the proteins identified in HeLa cells and the related GO terms are involved in cell cycle regulation, G2/M and mitotic checkpoints, chromatid cohesion, microtubules and actin cytoskeleton regulation during mitosis. In contrast, the proteins identified in the MRC5 cells and the identified GO terms are involved in the cellular responses to DNA damage and oxidative stress, the cell cycle, cell death, and chromatin remodeling12,13,31,35,49. Overall, the proteins identified as new targets of Cdc42 under conditions of UV-induced DNA damage might certainly indicate new functions for this GTPase and/or its signaling pathway correlated with nuclear events that directly or indirectly regulate genomic instability.


Page 29 of 59 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig. 3. Gene ontology (GO) classification of biological processes involving multiple gene products or proteins identified as Cdc42 interactors under genotoxic stress. GO terms obtained for the proteins identified in HeLa (A) and MRC5 (B) cell lines or for proteins exclusively identified in the two cell lines (C and D) under UV-treatment conditions (5-min and 48-h treatments).



Page 30 of 59

3.3. New protein-protein interaction networks of Cdc42 targets under UV exposure We explored the freely available PPPI databases and constructed interaction networks or interactomes between Cdc42 and the proteins identified using the AP/MS approach in an attempt to discover biological correlations25. In this analysis, we only used the UV-exclusive proteins identified in UV-treated cells and included the Cdc42 protein used as bait. We strategically combined the proteins identified with the Cdc42-WT and Cdc42-G12V baits in a single set due to the low individual representativeness and excluded all proteins identified in the corresponding control conditions (K) (Fig. 2) because Cdc42-WT activation requires GEFs, which are not endogenously expressed in bacteria, for the GDP

GTP exchange.

Therefore, we assumed that the WT protein bait was in the active (GTP-bound) state when incubated with the cell lysates, and effector proteins that preferentially bind to Cdc42-G12V bait, which harbors a mutation that makes the enzyme constitutively active (Cdc42GTPbound), were successfully isolated and identified. Representative networks for each condition were constructed using the established protein sets and shown in Table III: i) HeLa 5 min (K), ii) HeLa 48 h (-K), iii) MRC5 5 min (-K), and iv) MRC5 48 h (-K).


Page 31 of 59 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table III. Proteins exclusively detected in UV-treated HeLa or MRC5 cells with both the Cdc42-WT and Cdc42-G12V baits and excluding the proteins detected in the respective negative controls (K) and the proteins not yet deposited in PPI databases. Hela 5min (-K) Uniprot Name ADRM1_HUMAN ATPG_HUMAN BORG2_HUMAN COPG_HUMAN COPG2_HUMAN DIAP1_HUMAN IQGA2_HUMAN MARE1_HUMAN PCNP_HUMAN SF3A2_HUMAN VASP_HUMAN

Protein ID Q16186 P36542 Q9UKI2 Q9Y678 Q9UBF2 O60610 Q13576 Q15691 Q8WW12 Q15428 P50552

Hela 48h (-K) Uniprot Name 2AAA_HUMAN ARGI1_HUMAN BORG2_HUMAN CALL5_HUMAN CASPE_HUMAN COPG_HUMAN COPG2_HUMAN DNMBP_HUMAN GIT2_HUMAN IF2B1_HUMAN IQGA2_HUMAN LEG7_HUMAN MRP_HUMAN MYO1C_HUMAN PABP4_HUMAN PHB2_HUMAN SPB3_HUMAN SYAC_HUMAN SYRC_HUMAN

Protein ID P30153 P05089 Q9UKI2 Q9NZT1 P31944 Q9Y678 Q9UBF2 Q6XZF7 Q14161 Q9NZI8 Q13576 P47929 P49006 O00159 Q13310 Q99623 P29508 P49588 P54136

MRC5 5min (-K) Uniprot Name 1433F_HUMAN ALDR_HUMAN APEX1_HUMAN BAP31_HUMAN CDC5L_HUMAN CING_HUMAN CNBP_HUMAN CUL4A_HUMAN CUL4B_HUMAN DYR_HUMAN ECHB_HUMAN EDC4_HUMAN EHD4_HUMAN EIF3F_HUMAN GRWD1_HUMAN HLAG_HUMAN LYSC_HUMAN MATR3_HUMAN MCA3_HUMAN MCM7_HUMAN NPL4_HUMAN P3H1_HUMAN P53_HUMAN PSD12_HUMAN PSMD3_HUMAN PXDN_HUMAN SMC2_HUMAN SNAA_HUMAN SNAB_HUMAN TBB3_HUMAN TMEDA_HUMAN TRIO_HUMAN TYSY_HUMAN VIGLN_HUMAN

Protein ID Q04917 P15121 P27695 P51572 Q99459 Q9P2M7 P62633 Q13619 Q13620 P00374 P55084 Q6P2E9 Q9H223 O00303 Q9BQ67 P17693 P61626 P43243 O43324 P33993 Q8TAT6 Q32P28 P04637 O00232 O43242 Q92626 O95347 P54920 Q9H115 Q13509 P49755 O75962 P04818 Q00341

MRC5 48h (-K) Uniprot Name ATIF1_HUMAN CING_HUMAN CPSF5_HUMAN DSG1_HUMAN DYL1_HUMAN DYL2_HUMAN GRB2_HUMAN H15_HUMAN IF1AX_HUMAN IF1AY_HUMAN MATR3_HUMAN MCM7_HUMAN PAI2_HUMAN PHB2_HUMAN PSIP1_HUMAN RO60_HUMAN SFRS1_HUMAN STAU1_HUMAN SYLC_HUMAN TMEDA_HUMAN ZN622_HUMAN

Protein ID Q9UII2 Q9P2M7 O43809 Q02413 P63167 Q96FJ2 P62993 P16401 P47813 O14602 P43243 P33993 P05120 Q99623 O75475 P10155 Q07955 O95793 Q9P2J5 P49755 Q969S3

For each set of conditions, the number of proteins identified was used as the seed list for scanning protein-protein interaction databases, and a specific color was assigned to their identification in the networks (Table III, Fig. 4 and Supplementary Fig. S4). In the networks, each protein is a "node", and each line representing a physical interaction among proteins is referred to as an "edge" that was experimentally confirmed by at least one appropriate biochemical technique in the assessed public databases. Each obtained network presents the total number of nodes and edges, the proteins used as input obtained from the AP/MS experiments (herein designated with the color assigned to each condition shown in Table III) and other proteins colored in violet, all of which are connected by black edges. Cdc42, which was used as a bait to capture interactions, is presented as a yellow-colored diamond for easy 31 ACS Paragon Plus Environment


Page 32 of 59

visualization. We used the bottleneck ranking method to classify the top 20 proteins and to verify the most important nodes of each network based on centrality analyses, which consider the position of each node and the interactions between nodes. The resulting global network for the HeLa cell line and the subnetwork representing the best ranked protein hubs are presented in Fig. 4. The same process was used to analyze the proteins identified in the MRC5 cells (Supplementary Fig. S4). Because this study aimed to identify Cdc42 targets that are potentially involved in genomic instability promoted by UV radiation, particularly when a GTPase presents a gain of function (constitutively active G12V mutation or in the GTP-bound state), the first set of protein targets suggested for further investigations was 9-4-4F APEX1, H1.5, MCM7, P53, SMC2, (MRC5 cells), PAK4 (HeLa cells) and PHB-2 (HeLa and MRC5 cells). These proteins, which were exclusively identified in the UV-treated cells and in the cell lines shown in parentheses, were selected using the AP/MS approaches according to their best score, unique peptides and sequence coverage percentage (Supplementary Tables S1, S2 and S4; Fig. 2). Additionally, these proteins also obeyed other established criteria, such as preferential bait used for affinity capture (G12V) and biological function related to genomic stability (Supplementary Table S4). Among these eight proteins, three (PHB-2, P53 and 9-4-4F' were also the best ranked hubs on the subnetworks obtained from the interactome analysis, which suggests that these proteins significantly contribute to signaling complexes that regulate the Cdc42 GTPase (Fig. 4 and Supplementary Fig. S4). All of these protein targets play isolated or interconnected roles in the cell cycle (cell division, chromosome segregation, and DNA replication), apoptosis, DNA repair (DDR and BER), aging and chromatin remodeling. Furthermore, most of these proteins are biochemically active and functional in the nucleus, whereas others also function in the cytoplasm (and mitochondria), and these new interactions


Page 33 of 59 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


potentially explain the likely functions of membrane-bound (active) Cdc42 throughout a cytosolic transition and its eventual translocation to the nucleus50,51. Nodes = 530 Edges = 8998

A

Nodes = 588 Edges = 13792

B

Fig. 4. Interaction networks between Cdc42 and protein targets in HeLa cells identified by MS. A) Cell lysates obtained 5 min after UV treatment (dark blue) or B) 48 h after UV treatment (light blue). The proteins represented by a color other than dark or light blue (Table III) were identified in response to other cellular conditions. Cdc42 is represented by a yellow diamond. The total numbers of nodes and edges in the general network are shown. The interaction subnetwork shows the top 20 ranked hubs according to the bottleneck



Page 34 of 59

centrality parameter, including Cdc42. The network was visualized with the Cytoscape 3.4.0 software platform using the Prefuse force-directed layout.

A final network was constructed using as input the eight protein targets suggested for Cdc42,

including

the

GTPase

itself,

based

on

the

Reactome-FIs

database

(https://reactome.org/), where FIs stands for functional interactions (Fig. 5)52. In the interactome derived from cells cultured under conditions that promote genomic instability, we observed the following interactions for Cdc42: i) two binary interactions, Cdc42/PAK4 and Cdc42/P53; ii) three ternary interactions, Cdc42/RPS27A/MCM7, Cdc42/P53/APEX1 and Cdc42/PPP2R1A-SOS1-RASGRF1/ 9-4-4FS

iii)

two

quaternary

interactions,

Cdc42/P53/LIG4/SMC2 and Cdc42/P53/HDAC1-ESR1/PHB-2; and iv) no interactions between Cdc42 and histone H1 isoforms. These interactions (following the thick red lines) throughout the network highlight the shortest pathways connecting Cdc42 with protein partners that represent the biological functions and biochemical processes proposed above but do not consider other indirect Cdc42 connections that were also visualized (Fig. 5). Overall, these findings appear to be highly consistent with our previous cell-based assays, which showed that overexpression of the Cdc42-G12V mutant leads to a cellular phenotype characterized by increased sensitivity to UV radiation and susceptibility to apoptosis12. In addition, the overactivation of Cdc42 increases senescence and aging in mice and hematopoietic stem cells13,53, and this active GTPase also exhibits time- and phasedependent localization that promotes the correct cell polarization for cell cycle entry and division in mice and yeast54,55. In addition, high levels of active Cdc42, independent of the causative molecular mechanisms, have been clinically explored in the context of tumorigenesis and have gained importance as a potential drug target, particularly in human gliomas and breast cancers56,57. This study suggests that the new potential protein effectors of Cdc42-GTP signaling pathways that drive cells to genomic instability and death could clarify some biological functions of this GTPase that are not yet completely understood. 34 ACS Paragon Plus Environment

Page 35 of 59 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig. 5. Model of the interactome of Cdc42 with protein targets obtained from cells cultured under genomic instability conditions. The ten proteins (shown by yellow diamond nodes) and the shortest pathways connecting them (through the red thick edges) represent possible signaling networks underlying the functions of Cdc42 in response to UV treatments in both cell lines. Seven hundred ninety-seven nodes and 878 edges were identified, as shown in the PSIMI 25 style network. The interactome was visualized with the Cytoscape 3.4.0 software platform using the predefined Prefuse force-directed layout settings.

3.4. Biochemical validations confirm PAK4, PHB-2 and 14-3-3 as interactors of Cdc42 that mediate cellular responses to UV-induced genotoxic stress To biochemically validate the proposed Cdc42 interactions, the eight Cdc42 protein partners (SMC2, MCM7, P53, H1.5, 9-4-4F APE1, PAK4, and PHB-2) among the set of proteins acquired using the AP/MS, GO and interactome strategies were initially screened through fluorescence confocal microscopy of parental HeLa cells (expressing endogenous 35 ACS Paragon Plus Environment


Page 36 of 59

WT Cdc42) exposed or not exposed to UV stress (not shown). The most promising targets identified through these confocal analyses, namely, PAK4, PHB-2 and 14-3-3 , were revaluated in HeLa cells and mutant clones of HeLa cells ectopically overexpressing Cdc42G12V12 under high and moderate UV stress conditions (Fig. 6). These three proteins strongly colocalized with endogenous WT Cdc42 (GDP and/or GTP bound) and the Cdc42-G12V mutant because the antibody against Cdc42 is not capable of discriminating which form of the GTPase (active or inactive) is preferable for binding. However, using the HeLa-Cdc42-G12V clone, which has higher sensitivity to UV stress than the parental cells harboring only the WT Cdc42, we showed the different intensities and localizations of the Cdc42 interactions and correlated them with previously observed phenotypes12. For example, we found that both Cdc42-WT and Cdc42-G12V baits interacted with PAK4 through MS analysis and fluorescence confocal microscopy, and Cdc42-PAK4 colocalization was mostly detected in the perinuclear region of HeLa cells under high stress and in the HeLa-Cdc42-G12V clone under moderate UV stress (Fig. 6, upper panels). PLA also revealed (and confirmed) this specific distribution pattern in the HeLa-Cdc42-G12V clone under the same UV-treated conditions, whereas a more random distribution was found in control cells (Fig. 7A). For PHB-2, the confocal analysis revealed a high degree of colocalization with Cdc42 in the cytoplasm and perinuclear region (mitochondria, Golgi apparatus or endoplasmic reticulum) in HeLa cells under moderate or high genotoxic stress conditions, and a substantially more intense colocalization was found in the HeLa-Cdc42-G12V clone (Fig. 6, middle panels). PLAs also showed a higher degree of interaction between Cdc42 and PHB-2 in the HeLaCdc42-G12V clone following UV treatment (moderate stress) (Fig. 7B). Although we did not employ specific probes for each of these organelles, a previous study revealed that Cdc42 interacts in the Golgi with the ^ H, subunit of the coatomer58 and thereby regulates traffic between the Golgi and endoplasmic reticulum59,60. Interestingly, COPG1 and COPG2 were 36 ACS Paragon Plus Environment

Page 37 of 59 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


also identified in HeLa cells (line 148; Supplementary Table S1). Moreover, some studies have provided evidence showing the presence of active Cdc42 in the Golgi61-63, and Cdc42GEFs (Tuba) were previously found to interact with the Golgi protein GM13064. In addition, PAK4 activation in Golgi appears to be dependent on active Cdc42 signaling65. The confocal microscopy analysis of 14-3-3 protein confirmed a high degree of colocalization with Cdc42 in the cytoplasm and perinuclear region in HeLa cells after moderate or high genotoxic stress. Surprisingly, this colocalization was less evident in the HeLa-Cdc42-G12V clone, which apparently shows reduced expression of 14-3-3

protein compared with the parental cells

(Fig. 6, bottom panels), but no differences in the expression of this protein were observed between UV-treated versus control cells. The PAK4, PHB-2 and 14-3-3 protein expression profiles were also confirmed by immunoblotting (not shown), and these results indicate that Cdc42 activation should not be able to substantially interfere with these interactors, at least with their protein levels, but we cannot ensure that the same finding would be obtained for many other protein partners. Therefore, we believe that the constitutive activation of Cdc42 (G12V mutant) very likely changes the inherent proteome of a “normal” HeLa cell line (WT). This observation originates from experimental data showing that the HeLa-Cdc42-G12V mutant behaves differently in culture (e.g., morphological changes, different growth rates, and high rates of polynucleation) and in biological assays (reduced cell survival in response to radiation/attenuated DNA damage) compared with the HeLa parent12. Although the prediction of all phenotypical modifications and their associations to particular/well-defined signaling networks are difficult, these are certainly activated via different mechanisms, which results in the generation of a different interactome.



HeLa Parental High stress

Moderate stress

Control

High Moderate stress stress

Cdc42 14-3-3 A

DAPI

Merge Cdc42

PHB-2

DAPI

Merge

Cdc42

PAK-4

DAPI

Control

HeLa Cdc42-G12V

Merge

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 38 of 59

Fig. 6. Fluorescence confocal microscopy validating the colocalization of Cdc42 with PAK4, PHB-2 and 14-3-3 proteins under genotoxic stress. HeLa cells and HeLa-Cdc42-G12V clones were seeded 24 h prior to treatment and exposed to UVC irradiation under high stress (100 J/m², incubation for 5 min) or moderate stress (10 J/m², incubation for 48 h) conditions. The results are representative of at least three independent experiments.


Page 39 of 59


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60




Page 40 of 59

Page 41 of 59 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Cdc42, whereas PHB-2 and 14-3-3 proteins were likely pulled down as major protein complexes. However, in terms of biological functions, these three protein partners of Cdc42 appear to be directly or indirectly correlated with genomic instability events. For instance, a previous study revealed that the translocation of PAK4 between the cytoplasm and nucleus controls the -catenin pathway68 and regulates the spindle position of microtubules by acting on motor proteins of the actin-myosin cytoskeleton, which affect the spindle assembly checkpoint (SAC) and mitosis69. PAK4 also colocalizes with nucleolin at the nucleolus of ovarian cancer cell lines.70 All these studies reinforce our findings, which suggest that the Cdc42-PAK4 interaction and downstream effectors might act as mediators of genomic instability. PHB-2 and PHB-1 were originally characterized as inhibitors of cellular proliferation, but many other roles for these proteins, such as those in transcription and nuclear signaling, have been uncovered.71 Another example is the recently discovered actions of PHB-2 in the nucleolus of rhabdomyosarcoma cells, which involve controlling the cell cycle and DNA synthesis72. Prohibitins are also important regulators of diverse mitochondrial functions that affect cell fate in many human diseases, including cancer, and aging73. Moreover, several isoforms of the 14-3-3 family, including 14-3-3 `74, a75, b76, and c77, are reportedly involved in events regulating genomic instability. Interestingly, the specific depletion of the 14-3-3 isoform sensitizes glioblastoma cells to gamma radiation and thereby increases mitotic cell death78. The physical interactions of the 14-3-3 family with atypical GTPases, such as those belonging to the Rnd subfamily via its C-terminal domain, have previously been reported79. It is well known that Rho GTPases, such as Rac1 and Cdc42, are also phosphorylated at Ser71 by Akt80,81 and that this residue belongs to a proposed consensus binding motif for 14-3-3 family recognition82. These results provide evidence for an interaction between 14-3-3 and Cdc42 through unclear mechanisms that likely mediate Cdc42 subcellular relocalization and/or acts as an adaptor protein for the local recruitment of 41 ACS Paragon Plus Environment


Page 42 of 59

other Cdc42 protein partners that are essential for the maintenance of genomic stability following exposure to genotoxic stress.


Page 43 of 59 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


CONCLUSIONS The classical and novel biological functions of the small Rho GTPase Cdc42 have been updated and revisited in the literature due to increasing evidence showing its involvement in human diseases. DNA-related biological processes, such as the cell cycle, proliferation, aging (death and/or senescence), gene expression (chromatin remodeling) and genomic stability (DNA repair), appear to depend on Cdc42 signaling. Therefore, in the present study, we identified proteins that preferentially interact with the Cdc42-G12V mutant (and also the WT protein) in cells harboring normal (MRC5) or deficient (HeLa) levels of the tumor suppressor gene p53 and thus exhibiting normal or impaired DNA repair mechanisms, respectively, after specific UV-promoted DNA lesions. After several filtering steps, namely, literature mining of known Cdc42 biological functions, MS data analysis, and interactome investigations of centrality, we identified the following proteins that could be examined in the future through in vitro biochemical and cellular assays: SMC2, MCM7, P53, H1.5, 9-4-4F APEX1, PAK4, and PHB-2. Some of these targets have been ascribed complementary or associated functions and are thus very likely to mediate the Cdc42 signals that control different aspects of genomic instability through unpredicted mechanisms, as demonstrated by our promising results from biochemical validations, which confirmed PAK-4, 9-4-4F and PHB-2 as preferred protein partners of overactivated Cdc42 GTPase under cellular stressdependent conditions.



Page 44 of 59

ASSOCIATED CONTENT Supporting information: The following supporting information is available free of charge at the ACS website (http://pubs.acs.org): Table S1. List of proteins identified in all samples of HeLa cellsby MS Table S2. List of proteins identified in all samples of MRC5 cellsby MS Table S3. Number of proteins identified in HeLa and MRC5 cells under each treatment condition Table S4. AP/MS criteria used for the selection of protein targets with functions related to genomic stability Figure S1. Agarose gel analysis of the PCR products with the cloned Cdc42 sequences Figure S2. Recombinant Cdc42 production, quantification and purification Figure S3. Flowchart of the experimental AP/MS strategy used for the detection of Cdc42 protein partners Figure S4. Interaction networks between Cdc42 and proteins identified in MRC5 cellsby MS


Page 45 of 59 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


MASS SPECTROMETRY DATA DEPOSITION The

mass

spectrometry

data

have

been

deposited

to

the

Massive

Archive

(https://massive.ucsd.edu/ProteoSAFe/static/massive.jsp?redirect=auth) with the data set identifier ftp://[email protected] (Raw_files/

18/07/2019 17:43:00).

ACKNOWLEDGMENTS This project was supported by grants from the Sao Paulo Foundation - FAPESP (Grant Nos. 2008/58264-5, 2015/03983-0 and 2018/01753-6), Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - CAPES (88887.136364/2017-00) and the National Council for Scientific and Technological Development - CNPq (Grant No. 230420/2016/7) to FLF. LKI was also supported by FAPESP Grant No. 2013/07467-1. LES, RCS, and LFM are students pursuing a Master’s degree, and ESK is a PhD student, all funded by CAPES and CNPq who are enrolled in the postgraduate program at the Department of Biochemistry and Molecular Biology, Institute of Chemistry, University of Sao Paulo. We thank Prof. Dr. Solange M.T. Serrano for performing the mass spectrometry analysis at CeTICS, Institute Butantan, Sao Paulo-SP, Brazil and BO and JRD from the LSSB laboratory for providing excellent technical assistance. We also thank Dr. Lilian Cristina Russo Vieira for performing the confocal microscopy analysis under the supervision of Prof Dr. Helena Bonciani Nader at INFAR, Federal University of Sao Paulo, Brazil, and Prof. Dr. Alexandre Bruni Cardoso for allowing use of the fluorescence microscope at the ECM-Signaling Laboratory, Institute of Chemistry, University of Sao Paulo, Brazil.



Page 46 of 59

REFERENCES 1. Vigil, D.; Cherfils, J.; Rossman, K. L.; Der, C. J., Ras superfamily GEFs and GAPs: validated and tractable targets for cancer therapy? Nature Reviews Cancer 2010, 10, (12), 842-857. 2. Wennerberg, K.; Der, C. J., Rho-family GTPases: it's not only Rac and Rho (and I like it). Journal of cell science 2004, 117, (8), 1301-1312. 3. Hall, A.; Nobes, C. D., Rho GTPases: molecular switches that control the organization and dynamics of the actin cytoskeleton. Philosophical Transactions of the Royal Society of London B: Biological Sciences 2000, 355, (1399), 965-970. 4. Adams, A.; Johnson, D. I.; Longnecker, R. M.; Sloat, B. F.; Pringle, J. R., CDC42 and CDC43, two additional genes involved in budding and the establishment of cell polarity in the yeast Saccharomyces cerevisiae. J. Cell Biol 1990, 111, (1), 131-42. 5. Johnson, D. I.; Pringle, J. R., Molecular characterization of CDC42, a Saccharomyces cerevisiae gene involved in the development of cell polarity. The Journal of cell biology 1990, 111, (1), 143-152. 6. Arias-Romero, L. E.; Chernoff, J., Targeting Cdc42 in cancer. Expert opinion on therapeutic targets 2013, 17, (11), 1263-1273. 7. Seo, M.; Cho, C.-H.; Lee, Y.-I.; Shin, E.-Y.; Park, D.; Bae, C.-D.; Lee, J. W.; Lee, E.-S.; Juhnn, Y.-S., Cdc42-dependent mediation of UV-induced p38 activation by G protein V^ subunits. Journal of Biological Chemistry 2004, 279, (17), 17366-17375. 8. Tu, S. S.; Wu, W. J.; Yang, W.; Nolbant, P.; Hahn, K.; Cerione, R. A., Antiapoptotic Cdc42 mutants are potent activators of cellular transformation. Biochemistry 2002, 41, (41), 12350-12358. 9. Vanni, C.; Ottaviano, C.; Guo, F.; Puppo, M.; Varesio, L.; Zheng, Y.; Eva, A., Constitutively active Cdc42 mutant confers growth disadvantage in cell transformation. Cell Cycle 2005, 4, (11), 1675-1682. 10. Muris, D.; Verschoor, T.; Divecha, N.; Michalides, R., Constitutive active GTPases Rac and Cdc42 are associated with endoreplication in PAE cells. European Journal of Cancer 2002, 38, (13), 1775-1782. 11. Ma, J.; Xue, Y.; Liu, W.; Yue, C.; Bi, F.; Xu, J.; Zhang, J.; Li, Y.; Zhong, C.; Chen, Y., Role of activated rac1/cdc42 in mediating endothelial cell proliferation and tumor angiogenesis in breast cancer. PloS one 2013, 8, (6), e66275. 12. Ascer, L. G.; Magalhaes, Y. T.; Espinha, G.; Osaki, J. H.; Souza, R. C.; Forti, F. L., CDC42 Gtpase Activation Affects Hela Cell DNA Repair and Proliferation Following UV Radiation Induced Genotoxic Stress. Journal of cellular biochemistry 2015, 116, (9), 20862097. 13. Wang, L.; Yang, L.; Debidda, M.; Witte, D.; Zheng, Y., Cdc42 GTPase-activating protein deficiency promotes genomic instability and premature aging-like phenotypes. Proceedings of the National Academy of Sciences 2007, 104, (4), 1248-1253. 14. Ngok, S. P.; Lin, W.-H.; Anastasiadis, P. Z., Establishment of epithelial polarity–GEF who's minding the GAP? J Cell Sci 2014, 127, (15), 3205-3215. 15. Laemmli, U. K., Cleavage of structural proteins during the assembly of the head of bacteriophage T4. nature 1970, 227, (5259), 680-685. 16. García Mata, R.; Wennerberg, K.; Arthur, W. T.; Noren, N. K.; Ellerbroek, S. M.; Burridge, K., Analysis of activated GAPs and GEFs in cell lysates. Methods in enzymology 2006, 406, 425-437.


Page 47 of 59 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


17. Panico, K.; Forti, F. L., Proteomic, cellular, and network analyses reveal new DUSP3 interactions with nucleolar proteins in HeLa cells. Journal of proteome research 2013, 12, (12), 5851-5866. 18. Kleifeld, O.; Doucet, A.; Prudova, A.; auf dem Keller, U.; Gioia, M.; Kizhakkedathu, J. N.; Overall, C. M., Identifying and quantifying proteolytic events and the natural N terminome by terminal amine isotopic labeling of substrates. Nature protocols 2011, 6, (10), 1578-1611. 19. Cox, J.; Mann, M., MaxQuant enables high peptide identification rates, individualized ppb-range mass accuracies and proteome-wide protein quantification. Nature biotechnology 2008, 26, (12), 1367-1372. 20. Tyanova, S.; Temu, T.; Carlson, A.; Sinitcyn, P.; Mann, M.; Cox, J., Visualization of LC MS/MS proteomics data in MaxQuant. Proteomics 2015, 15, (8), 1453-1456. 21. Tyanova, S.; Temu, T.; Sinitcyn, P.; Carlson, A.; Hein, M. Y.; Geiger, T.; Mann, M.; Cox, J., The Perseus computational platform for comprehensive analysis of (prote) omics data. Nature methods 2016, 13, (9), 731-40. 22. Choi, H.; Larsen, B.; Lin, Z. Y.; Breitkreutz, A.; Mellacheruvu, D.; Fermin, D.; Qin, Z. S.; Tyers, M.; Gingras, A. C.; Nesvizhskii, A. I., SAINT: probabilistic scoring of affinity purification-mass spectrometry data. Nat Methods 2011, 8, (1), 70-3. 23. Mootha, V. K.; Lindgren, C. M.; Eriksson, K.-F.; Subramanian, A.; Sihag, S.; Lehar, J.; Puigserver, P.; Carlsson, E.; Ridderstråle, M.; Laurila, E., ,= - R- ) genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes. Nature genetics 2003, 34, (3), 267-273. 24. Subramanian, A.; Tamayo, P.; Mootha, V. K.; Mukherjee, S.; Ebert, B. L.; Gillette, M. A.; Paulovich, A.; Pomeroy, S. L.; Golub, T. R.; Lander, E. S., Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proceedings of the National Academy of Sciences 2005, 102, (43), 15545-15550. 25. De Las Rivas, J.; Fontanillo, C., Protein–protein interaction networks: unraveling the wiring of molecular machines within the cell. Briefings in functional genomics 2012, 11, (6), 489-496. 26. Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N. S.; Wang, J. T.; Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T., Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome research 2003, 13, (11), 2498-2504. 27. Hernandez-Toro, J.; Prieto, C.; De Las Rivas, J., APID2NET: unified interactome graphic analyzer. Bioinformatics 2007, 23, (18), 2495-2497. 28. Chin, C.-H.; Chen, S.-H.; Wu, H.-H.; Ho, C.-W.; Ko, M.-T.; Lin, C.-Y., cytoHubba: identifying hub objects and sub-networks from complex interactome. BMC systems biology 2014, 8, (4), S11. 29. Fidyk, N.; Wang, J.-B.; Cerione, R. A., Influencing cellular transformation by modulating the rates of GTP hydrolysis by Cdc42. Biochemistry 2006, 45, (25), 7750-7762. 30. Sinha, S.; Yang, W., Cellular signaling for activation of Rho GTPase Cdc42. Cellular signalling 2008, 20, (11), 1927-1934. 31. Ye, H.; Zhang, Y.; Geng, L.; Li, Z., Cdc42 expression in cervical cancer and its effects on cervical tumor invasion and migration. International journal of oncology 2015, 46, (2), 757763. 32. Lin, Q.; Yang, W.; Baird, D.; Feng, Q.; Cerione, R. A., Identification of a DOCK180related guanine nucleotide exchange factor that is capable of mediating a positive feedback activation of Cdc42. Journal of Biological Chemistry 2006, 281, (46), 35253-35262. 33. Okura, H.; Golbourn, B. J.; Shahzad, U.; Agnihotri, S.; Sabha, N.; Krieger, J. R.; Figueiredo, C. A.; Chalil, A.; Landon-Brace, N.; Riemenschneider, A., A role for activated Cdc42 in glioblastoma multiforme invasion. Oncotarget 2016, 7, (35), 56958. 47 ACS Paragon Plus Environment


Page 48 of 59

34. Qadir, M. I.; Parveen, A.; Ali, M., Cdc42: role in cancer management. Chemical biology & drug design 2015, 86, (4), 432-439. 35. Stengel, K.; Zheng, Y., Cdc42 in oncogenic transformation, invasion, and tumorigenesis. Cellular signalling 2011, 23, (9), 1415-1423. 36. Arnau, J.; Lauritzen, C.; Petersen, G. E.; Pedersen, J., Current strategies for the use of affinity tags and tag removal for the purification of recombinant proteins. Protein expression and purification 2006, 48, (1), 1-13. 37. Chang, I. F., Mass spectrometry based proteomic analysis of the epitope tag affinity purified protein complexes in eukaryotes. Proteomics 2006, 6, (23), 6158-6166. 38. Adar, S.; Hu, J.; Lieb, J. D.; Sancar, A., Genome-wide kinetics of DNA excision repair in relation to chromatin state and mutagenesis. Proc Natl Acad Sci U S A 2016, 113, (15), E2124-33. 39. Hu, J.; Adebali, O.; Adar, S.; Sancar, A., Dynamic maps of UV damage formation and repair for the human genome. Proc Natl Acad Sci U S A 2017, 114, (26), 6758-6763. 40. Scherer, W. F.; Syverton, J. T.; Gey, G. O., Studies on the propagation in vitro of poliomyelitis viruses. IV. Viral multiplication in a stable strain of human malignant epithelial cells (strain HeLa) derived from an epidermoid carcinoma of the cervix. J Exp Med 1953, 97, (5), 695-710. 41. Jacobs, J. P.; Jones, C. M.; Baille, J. P., Characteristics of a human diploid cell designated MRC-5. Nature 1970, 227, (5254), 168-70. 42. Farrugia, A. J.; Calvo, F., The Borg family of Cdc42 effector proteins Cdc42EP1–5. Biochemical Society Transactions 2016, 44, (6), 1709-1716. 43. Neubauer, K.; Zieger, B., The mammalian septin interactome. Frontiers in cell and developmental biology 2017, 5, (3), 1-9. 44. Kremer, B. E.; Adang, L. A.; Macara, I. G., Septins regulate actin organization and cellcycle arrest through nuclear accumulation of NCK mediated by SOCS7. Cell 2007, 130, (5), 837-850. 45. Palomera-Sanchez, Z.; Zurita, M., Open, repair and close again: chromatin dynamics and the response to UV-induced DNA damage. DNA repair 2011, 10, (2), 119-125. 46. Spivak, G., Nucleotide excision repair in humans. DNA repair 2015, 36, 13-18. 47. Gadéa, G.; Lapasset, L.; Gauthier Rouvière, C.; Roux, P., Regulation of Cdc42 mediated morphological effects: a novel function for p53. The EMBO journal 2002, 21, (10), 23732382. 48. Thomas, A.; Giesler, T.; White, E., p53 mediates bcl-2 phosphorylation and apoptosis via activation of the Cdc42/JNK1 pathway. Oncogene 2000, 19, (46), 5259. 49. Yasuda, S.; Taniguchi, H.; Oceguera-Yanez, F.; Ando, Y.; Watanabe, S.; Monypenny, J.; Narumiya, S., An essential role of Cdc42 like GTPases in mitosis of HeLa cells. FEBS letters 2006, 580, (14), 3375-3380. 50. Williams, C. L., The polybasic region of Ras and Rho family small GTPases: a regulator of protein interactions and membrane association and a site of nuclear localization signal sequences. Cellular signalling 2003, 15, (12), 1071-1080. 51. Heynen, S.; Tanimoto, N.; Joly, S.; Seeliger, M.; Samardzija, M.; Grimm, C., Retinal degeneration modulates intracellular localization of CDC42 in photoreceptors.Molecular Vision2011, 17, 2934-46. 52. Fabregat, A.; Korninger, F.; Viteri, G.; Sidiropoulos, K.; Marin-Garcia, P.; Ping, P.; Wu, G.; Stein, L.; D'Eustachio, P.; Hermjakob, H., Reactome graph database: Efficient access to complex pathway data. PLoS Comput Biol 2018, 14, (1), e1005968. 53. Florian, M. C.; Dörr, K.; Niebel, A.; Daria, D.; Schrezenmeier, H.; Rojewski, M.; Filippi, M.-D.; Hasenberg, A.; Gunzer, M.; Scharffetter-Kochanek, K., Cdc42 activity regulates hematopoietic stem cell aging and rejuvenation. Cell stem cell 2012, 10, (5), 520-530. 48 ACS Paragon Plus Environment

Page 49 of 59 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


54. Dehapiot, B.; Carrière, V.; Carroll, J.; Halet, G., Polarized Cdc42 activation promotes polar body protrusion and asymmetric division in mouse oocytes. Developmental biology 2013, 377, (1), 202-212. 55. Witte, K.; Strickland, D.; Glotzer, M., Cell cycle entry triggers a switch between two modes of Cdc42 activation during yeast polarization. bioRxiv 2017, 114504. 56. Chrysanthou, E.; Gorringe, K. L.; Joseph, C.; Craze, M.; Nolan, C. C.; Diez-Rodriguez, M.; Green, A. R.; Rakha, E. A.; Ellis, I. O.; Mukherjee, A., Phenotypic characterisation of breast cancer: the role of CDC42. Breast Cancer Research and Treatment 2017, 164, (2), 317-325. 57. Aguilar, B.; Zhou, H.; Lu, Q., Cdc42 Signaling Pathway Inhibition as a Therapeutic Target in Ras-Related Cancers. Current medicinal chemistry 2017, 24, (32), 3485-3507. 58. Wu, W. J.; Erickson, J. W.; Lin, R.; Cerione, R. A., The ^of the coatomer complex binds Cdc42 to mediate transformation. Nature 2000, 405, (6788), 800. 59. Luna, A.; Matas, O. B.; k 6# J. A.; Mato, E.; Durán, J. M.; Ballesta, J.; Way, M.; Egea, G., Regulation of protein transport from the Golgi complex to the endoplasmic reticulum by CDC42 and N-WASP. Molecular biology of the cell 2002, 13, (3), 866-879. 60. Farhan, H.; Hsu, V. W., Cdc42 and cellular polarity: emerging roles at the Golgi. Trends in cell biology 2016, 26, (4), 241-248. 61. Nalbant, P.; Hodgson, L.; Kraynov, V.; Toutchkine, A.; Hahn, K. M., Activation of endogenous Cdc42 visualized in living cells. Science 2004, 305, (5690), 1615-1619. 62. Itoh, R. E.; Kurokawa, K.; Ohba, Y.; Yoshizaki, H.; Mochizuki, N.; Matsuda, M., Activation of rac and cdc42 video imaged by fluorescent resonance energy transfer-based single-molecule probes in the membrane of living cells. Molecular and cellular biology 2002, 22, (18), 6582-6591. 63. Baschieri, F.; Farhan, H., Crosstalk of small GTPases at the Golgi apparatus. Small GTPases 2012, 3, (2), 80-90. 64. Kodani, A.; Kristensen, I.; Huang, L.; Sütterlin, C., GM130-dependent control of Cdc42 activity at the Golgi regulates centrosome organization. Molecular biology of the cell 2009, 20, (4), 1192-1200. 65. Callow, M. G.; Clairvoyant, F.; Zhu, S.; Schryver, B.; Whyte, D. B.; Bischoff, J. R.; Jallal, B.; Smeal, T., Requirement for PAK4 in the anchorage-independent growth of human cancer cell lines. Journal of Biological Chemistry 2002, 277, (1), 550-558. 66. Ha, B. H.; Boggon, T. J., CDC42 binds PAK4 via an extended GTPase-effector interface. Proceedings of the National Academy of Sciences 2018, 115, (3), 531-536. 67. Abo, A.; Qu, J.; Cammarano, M. S.; Dan, C.; Fritsch, A.; Baud, V.; Belisle, B.; Minden, A., PAK4, a novel effector for Cdc42Hs, is implicated in the reorganization of the actin cytoskeleton and in the formation of filopodia. The EMBO Journal 1998, 17, (22), 6527-6540. 68. Li, Y.; Shao, Y.; Tong, Y.; Shen, T.; Zhang, J.; Li, Y.; Gu, H.; Li, F., Nucleo-cytoplasmic shuttling of PAK4 modulates Vintracellular translocation and signaling. Biochimica et Biophysica Acta (BBA)-Molecular Cell Research 2012, 1823, (2), 465-475. 69. Bompard, G.; Morin, N., p21-activated kinase 4 regulates mitotic spindle positioning and orientation. Bioarchitecture 2012, 2, (4), 130-133. 70. Siu, M. K.; Chan, H. Y.; Kong, D. S.; Wong, E. S.; Wong, O. G.; Ngan, H. Y.; Tam, K. F.; Zhang, H.; Li, Z.; Chan, Q. K., p21-activated kinase 4 regulates ovarian cancer cell proliferation, migration, and invasion and contributes to poor prognosis in patients. Proceedings of the National Academy of Sciences 2010, 107, (43), 18622-18627. 71. Yang, J.; Li, B.; He, Q.-Y., Significance of prohibitin domain family in tumorigenesis and its implication in cancer diagnosis and treatment. Cell death & disease 2018, 9, (6), 580. 49 ACS Paragon Plus Environment


Page 50 of 59

72. Zhou, Z.; Ai, H.; Li, K.; Yao, X.; Zhu, W.; Liu, L.; Yu, C.; Song, Z.; Bao, Y.; Huang, Y., Prohibitin 2 localizes in nucleolus to regulate ribosomal RNA transcription and facilitate cell proliferation in RD cells. Scientific reports 2018, 8, (1), 1479. 73. Bavelloni, A.; Piazzi, M.; Raffini, M.; Faenza, I.; Blalock, W. L., Prohibitin 2: At a communications crossroads. IUBMB life 2015, 67, (4), 239-254. 74. Chen, Y.; Li, Z.; Dong, Z.; Beebe, J.; Yang, K.; Fu, L.; Zhang, J.-T., 9-4-4` Contributes to Radioresistance by Regulating DNA Repair and Cell Cycle via PARP1 and CHK2. Molecular Cancer Research 2017, 15, (4), 418-428. 75. Tang, S.; Bao, H.; Zhang, Y.; Yao, J.; Yang, P.; Chen, X., 9-4-4a mediates the cell fate decision-making pathways in response of hepatocellular carcinoma to Bleomycin-induced DNA damage. PLoS One 2013, 8, (3), e55268. 76. Wang, B.; Liu, K.; Lin, F.-T.; Lin, W.-C., A role for 9-4-4b in E2F1 stabilization and DNA damage-induced apoptosis. Journal of Biological Chemistry 2004, 279, (52), 5414054152. 77. Gao, X.; Dan, S.; Xie, Y.; Qin, H.; Tang, D.; Liu, X.; He, Q. Y.; Liu, L., 14 3 4c reduces DNA damage by interacting with and stabilizing proliferating cell nuclear antigen. Journal of cellular biochemistry 2015, 116, (1), 158-169. 78. Park, G.; Han, J.; Han, Y.; Kim, S.; Kim, J.; Jo, W.; Chun, S.; Jeong, D.; Lee, C.; Yang, K., 14-3-3 eta depletion sensitizes glioblastoma cells to irradiation due to enhanced mitotic cell death. Cancer gene therapy 2014, 21, (4), 158. 79. Riou, P.; Kjær, S.; Garg, R.; Purkiss, A.; George, R.; Cain, R. J.; Bineva, G.; Reymond, N.; McColl, B.; Thompson, A. J., 14-3-3 proteins interact with a hybrid prenylphosphorylation motif to inhibit G proteins. Cell 2013, 153, (3), 640-653. 80. Kwon, T.; Chun, J.; Kim, J. H.; Kang, S. S., Akt protein kinase inhibits Rac1-GTP binding through phosphorylation at serine 71 of Rac1. Journal of Biological Chemistry 2000, 275, (1), 423-428. 81. Schwarz, J.; Proff, J.; Hävemeier, A.; Ladwein, M.; Rottner, K.; Barlag, B.; Pich, A.; Tatge, H.; Just, I.; Gerhard, R., Serine-71 phosphorylation of Rac1 modulates downstream signaling. PloS one 2012, 7, (9), e44358. 82. Brandwein, D.; Wang, Z., Interaction between Rho GTPases and 14-3-3 proteins. International journal of molecular sciences 2017, 18, (10), 2148.


Page 51 of 59 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1 101x177mm (300 x 300 DPI)



Figure 2 177x76mm (300 x 300 DPI)


Page 52 of 59

Page 53 of 59 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3 105x177mm (300 x 300 DPI)



Figure 4 101x152mm (300 x 300 DPI)


Page 54 of 59

Page 55 of 59 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5 228x215mm (300 x 300 DPI)



Figure 6 105x139mm (300 x 300 DPI)


Page 56 of 59

Page 57 of 59 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 7 105x152mm (300 x 300 DPI)



Figure 8 152x50mm (300 x 300 DPI)


Page 58 of 59

Page 59 of 59 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


For TOC only 82x44mm (300 x 300 DPI)


Proteomic and interactome approaches reveal ... - ACS Publications

Recommend Documents