Proteomics Analysis of Distinct Portal Vein Tumor Thrombi in

Proteomics Analysis of Distinct Portal Vein Tumor Thrombi in Hepatocellular Carcinoma Patients Weixing Guo,†,‡ Jie Xue,†,‡ Jie Shi,† Nan Li,† Yu Shao,§ Xiya Yu,§ Feng Shen,† Mengchao Wu,† Shanrong Liu,*,§ and Shuqun Cheng*,† Eastern Hepatobiliary Surgery Hospital, Second Military Medical University, Shanghai, China, and Changhai Hospital, Second Military Medical University, Shanghai, China Received May 7, 2010

Portal vein tumor thrombosis (PVTT) in patients with hepatocellular carcinoma (HCC) is known as a major complication associated with poor survival. We clinically defined a type of distinct PVTT (dPVTT) in small HCC patients that is distant to liver parenchyma tumor (PT). The biological features of dPVTT are not clear. We utilized two-dimensional electrophoresis and tandem MS to compare and identify differentially expressed proteins between dPVTT and PT tissues. Of the 65 spots identified as differentially expressed (p < 0.05) between the two cancerous tissues, 19 (corresponding to 19 unique proteins) were identified. Further analysis of five proteins confirmed quantitative differences between the two tumor tissues. Upon comparison with PT tissues of HCC, c-kit was also significantly upregulated in dPVTTs in small HCC patients and the CSQT-2 cell line derived from dPVTT tissues, which validated the differences between the dPVTT and PT tissues. The protein expression profiles and proteins identified in this study demonstrate the presence of dPVTTs with more malignant phenotypes and will be useful in clarifying the mechanisms through which dPVTT develops. Specific treatments targeting dPVTT might be applied to HCC patients with dPVTT. Keywords: proteomics • hepatocellular carcinoma • portal vein tumor thrombosis • c-kit

Introduction Hepatocellular carcinoma (HCC) is a common and malignant tumor worldwide.1 Although a significant amount of progress has been made in the diagnosis and treatment of HCC owing to advances in imaging modalities and therapeutic approaches, the overall prognosis for HCC patients remains poor. Potential prognostic factors, such as gender, serum AFP concentration, cirrhosis, tumor size, and microRNA, have been reported.2-4 Portal vein tumor thrombosis (PVTT) in patients with HCC is known as a major complication associated with poor survival.5 It has been reported that about 50-80% of HCC is accompanied by portal or hepatic vein invasion as demonstrated by magnetic resonance imaging (MRI) and ultrasonography.6 Recently, increasing attention has been paid to the study of portal vein tumor thrombi in HCC in the hopes of understanding the impact on prognoses and thereby improving the outcomes for HCC patients.7-11 We have clinically observed two types of PVTTs in patients with small HCC.10 Some patients with small HCC were ac* To whom correspondence should be addressed. Professor Shuqun Cheng Eastern Hepatobiliary Surgery Hospital, The Second Military Medical University, 225 Changhai Road, Shanghai, China. Phone: (86) 21- 81875251. Fax: (86) 21- 65562400. E-mail: [email protected]. Professor Shanrong Liu at Changhai Hospital, Second Military Medical Unversity, 168 Changhai Road, Shanghai, China. Telephone: (86) 21- 55221092. Fax: (86) 21- 65562400. E-mail: [email protected]. † Eastern Hepatobiliary Surgery Hospital. ‡ These authors contributed equally to this work. § Changhai Hospital.

4170 Journal of Proteome Research 2010, 9, 4170–4175 Published on Web 06/28/2010

companied by adjacent PVTT (termed as aPVTT). This kind of PVTT is known to be an extension of liver parenchyma tumor (PT) into the main portal trunk and its branches. It has already reported that aPVTT has a similar expression profile to PT nodules as detected by a cDNA array,12 which indicates both of them have similar biological characteristics. In some small HCC patients, PVTTs were observed to be distant from liver parenchyma tumor nodules (i.e., PT). Even in some minor patients, only PVTT without PT nodules is detected by MRI. We termed this type of PVTT as distinct PVTT (dPVTT). To our knowledge, however, no studies have reported the biological features of dPVTT in HCC patients until now. To identify the unique biological features of dPVTTs, we used a comparative study of differentially expressed proteins to analyze differences between dPVTT and liver parenchyma tumor (PT) tissues. A specific marker for dPVTT was identified.

Materials and Methods Specimens and Cell Lines. The study was approved by the Ethics Committee of the Eastern Hepatobiliary Surgery Hospital of the Second Military Medical University (Shanghai, China). Written informed consent was obtained from patients according to the regulations of the committee. Liver tissues and cancerous tissues (PT tissues and PVTT) collected from hepatectomy were processed using three approaches. (1) For histological analysis, the specimens were fixed in 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS), frozen in Tissue-Tek O.C.T compound (Sakura Finetek, 10.1021/pr100412w

 2010 American Chemical Society

Proteomics Analysis of Distinct Portal Vein Tumor Thrombi Table 1. Pathologic Data Form Five PVTT Patients with dPVTT no

sex

age (yr)

HBV Ag

grade

P1 male

30

+

III

P2 male

48

+

III

P3 male

49

+

III

P4 male

38

+

III

P5 male

48

+

III

AFP

size

pathological diagnosis

4 × 5 Hepatocellular carcinoma (right lobe) 46 4 × 5 Hepatocellular carcinoma (left lobe) 59 4 × 3 Hepatocellular carcinoma (right lobe) 42.5 4 × 4 Hepatocellular carcinoma (right lobe) 1000 4 × 4 Hepatocellular carcinoma (left lobe) 2.9

USA, Inc.), and stored at -80 °C. (2) For reverse transcriptionPCR, the specimens were immediately snap-frozen in liquid nitrogen and stored at -80 °C. (3) For in vitro culture and flow cytometric analysis, the cancerous tissues were excised and single-cell suspensions were prepared as previously described;13 the single-cell suspensions were then centrifuged, and the pellet was resuspended in freezing liquid (10% DMSO +90% fetal calf serum) and stored in liquid nitrogen. Cell lines, including CSQT-2, HepG2, MHCC97, MHCC97-H, BEL-7404, and QGY-7701, were cultured in minimum essential medium (Gibco-BRL) with 10% fetal bovine serum (Gibco-BRL). Cells were maintained in a humidified 37 °C incubator with an atmosphere of 5% CO2 and routinely cultured and passaged. Among them, HepG2 cells are derived from hepatoblastoma, and the five other cell lines are derived from hepatocellular carcinoma tissues.14-18 MHCC97-H cells with higher metastatic activity are isolated from parent cell line MHCC97.15,17 Specimen Preparation. Five PT tissues and their paired dPVTT tissues were selected from patients with small HCC (Table 1). Tissues were rinsed three times with cold glutaminefree RPMI 1640 medium (glutamine-free, 5% fetal calf serum, 0.2 mM PMSF, 1 mM EDTA, and antibiotics: oxacillin (25 µg/ mL, 50 µg/mL gentamycin, 100 U/mL penicillin, 100 Ug/mL streptomycin, 0.25 µg/mL amphotericin B and 50 U/mL nistatin), homogenized in a liquid nitrogen-cooled mortar and ground with a pestle. The obtained cells were dissolved in lysis buffer (7 M urea, 2 M thiourea, 4% CHAPS, 40 mM Tris, 40 mM DTT, 10 mM PMSF and 1 µL nuclease mix (GE Healthcare). Samples were vortexed 4 to 5 times within 45 min at 4 °C using an ultrasonic processor and centrifuged at 4 °C for 1 h at 20,627 × g (15,000 r/min) to remove DNA, RNA and any particulate materials. Protein concentration was determined by the Bradford assay on a Microplate Reader (Bio-Rad, Model 680) using bovine serum albumin (BSA) as the protein standard. The samples were treated with a 2-D Clean-Up Kit (GE Healthcare) according to the manufacturer’s instructions and stored at -80 °C until use. Two-Dimensional Electrophoresis, Image Acquisition, and Analysis. Lysate containing 1 mg protein was mixed with rehydration buffer (8 M urea, 2% CHAPS, 0.5% IPG Buffer, 0.28% dithiothreitol and bromophenol blue) (Amersham Biosciences) to a final volume of 250 mL. The first dimension of electrophoresis was performed using an IPGphor isoelectric focusing apparatus for pH 3-10 nonlinear IPG strips (13 cm), as described previously19 and per the manufacturer’s instruc-

research articles tions (Amersham Biosciences). The second dimension was performed using 12% SDS-PAGE (13 cm × 12 cm) at 20 mA constant current per gel after equilibration with a Slab Electrophoresis Chamber (ATTO, Tokyo, Japan) to separate proteins. The proteins in the analytical electrophoretic gels were visualized with sliver staining (Merck, Germany) and scanned with a Bio-Rad GS-800 scanner. For each of the five pairs of samples, three independent runs were made to confirm the accuracy of analyses. The replicates were scanned using a GS-800 calibrated densitometer (Bio-Rad) with standardized parameters, and gel images were processed using PDQuest 7.0 software (Bio-Rad). The amount of protein in each spot was estimated by modeling the optical density in individual spot segments. Different expression levels of proteins were assessed by comparing spot volumes, and proteins were considered significantly up-regulated (or down-regulated) only if the corresponding volumes showed an increase (or decrease) of more than 3-fold in at least 80% of the cases (four of five cases). Quantitative analysis was performed by applying Student’s t test between the PT and dPVTT gels, and only spots that showed consistent and significant differences (p < 0.05) were selected for analysis by MS. In-Gel Digestion, Mass Spectrometry Analysis, and Protein Identification. In-gel digestion was then performed according to the method described previously20 with some modifications. Briefly, the significant protein bands were cut out of the preparative Coomassie blue-stained gels, destained with 100 mmol/L NH4HCO3/30% ACN and dried completely by centrifugal lyophilization. The dried gel slices were rehydrated with a total 25 ng of sequencing grade, modified trypsin (Promega) in 100 mmol/L NH4HCO3, at pH 8.3 and incubated at 37 °C for 12 h. The digest buffer was removed and saved. The gel pieces were then extracted with 200 µL of 60% ACN/ 0.1% TFA for 15 min with sonication and the supernatant was removed. The extraction was repeated two more times. The combined extracts were dried in a vacuum concentrator at room temperature and then subjected to MS analysis. The peptide mixture was dissolved in 0.1% TFA and desalted using a C18 ZipTip (Millipore).The eluted peptide in 0.1% TFA/50% CAN mixed with an equal volume of 0.1% TFA/30% CAN saturated with CHCA solution was applied onto the target, airdried and analyzed using a Bruker REFLEX lll MALDI-TOF mass spectrometer (Karlsruhe, Germany) in reflectron-positive mode. Protein database searching was performed with the MASCOT search engine (http://www.matrix.science. com; Matrix Science, London, UK) checking monoisotopic peaks against the NCBI nonredundant protein database (http:// www.ncbi.nlm.nih. gov/). The species was Homo sapiens. Mass tolerance was allowed within 0.05%. Proteins matching more than four peptides and with a MASCOT score higher than 63 were considered significant (p < 0.05). Quantitative Reverse-Transcriptase Polymerase Chain Reaction (qRT-PCR) Assays. Total RNAs of cancerous tissues or cultured cells were purified with the Absolutely RNA Nanoprep kit (Stratagene). qRT-PCR was performed using a standard SYBR Green PCR kit protocol on a Rotor-Gene RG-3000A (Corbetter Research) thermocycler. The relative expression of miRNA normalized against that of u6 was calculated using the 2-∆∆Ct method, as we described previously.3 Primers are listed in Table 2. Histopathologic Analysis. All resected specimens were embedded in optimum cutting temperature compound (Sakura Finetek) and sliced into 8-µm frozen sections with 4% paraformJournal of Proteome Research • Vol. 9, No. 8, 2010 4171

research articles

Guo et al.

Table 2. Primer Sequences for qRT-PCR Assays name

AFP c-Kit CK-19 CD133 CD90 PCNA HMGB1 Prx 1

F R F R F R F R F R F R F R F R

sequence

size

AAATGCGTTTCTCGTTGC TTTCATCCACCACCAAGC AGGATTCCCAGAGCCCACAATAG ACGGTGGCCCAGATGAGTTTAG CTGAGTGACATGCGAAGCCAATA RCAGTAACCTCGGACCTGCTCATC CCCGTGGATGCAGAACTTGA RACAGTCGTGGTTTGGCGTTGTA ATCTCCAGCATTCTCAGCCACA RCCTGGTCAAACCTGCATCTTCA CTGAGGGCGAGAAGCGCCAC CGCTACAGGCAGGCGGGAAG TGAGGAGGCTGCGTCTGGCT AGAGTCGCCCAGTGCCCGTC GCGGGAACCTGGTTGAACCCC CCGTGGGGCACACAAAGGTGA

275bp 113bp 148bp 125bp 118bp 174 bp 106 bp 198 bp

aldehyde in phosphate buffer. After washing with PBS, the sections were stained with hematoxylin and eosin (HE). Flow Cytometric Analysis. Tumor tissues from patients were excised and single cell suspensions were prepared as previously described.13 The single-cell suspension was analyzed by direct (PE antihuman c-kit antibody (clone: 104D2)) or indirect (rabbit antihuman Stmn-1 (1:50), Epitomics; mouse antihuman Gal-1 mAb (clone: 1E8-1B2, Sigma-Aldrich)) fluorescent immunostaining, as described in our previous report.21 As controls, some samples were only treated with blocking solution. All cells were incubated for 2 h at room temperature. The secondary antibodies were then added in dilution according to the supplier’s recommendations and the tubes were incubated for 45 min at room temperature in the dark. Given that tumor tissues inevitably varied in size at the time of harvesting, we quantified the number of positive cells in 1 × 106 total tumor cells to normalize the results across different tumor specimens. Data were analyzed using CellQuestPro software (BD Biosciences). Statistical Analysis. The Student’s t test was used to compare two groups unless otherwise indicated. P < 0.05 was considered statistically significant.

Results Similar Histopathologic Characteristics between dPVTT and PT in Small HCC Patients. To demonstrate whether dPVTT had unique biological features, five HCC patients accompanied by dPVTT were selected from our library. A representative case (CT 183747) is shown in Figure 1. The CT scan revealed malignant tumors in both the liver parenchyma (PT, Figure 1A, left panel, white arrow) and the portal vein (dPVTT, Figure 1A, right panel, black arrow) of the patient. The schematic distribution (Figure 1 B) of the HCC PT and dPVTT in this patient showed the anatomical location; PT was in the posterior right segment, and dPVTT was located in the sagittal part of the left portal vein. To confirm the malignant histologic features, histopathologic analyses were performed on the dPVTT and PT nodules. Our findings showed that both the thrombus and the parenchyma nodules were malignant and that there were no histological differences between them (Figure 1C). 2-DE Profiling of the Differentially Expressed Proteins between dPVTT and PT tissues. The protein expression profiles of the dPVTT and PT tissues were examined by 2-DE. This experiment was repeated five times independently using dPVTT 4172

Journal of Proteome Research • Vol. 9, No. 8, 2010

Figure 1. dPVTT clinically defined in small HCC patients. (A) Axial contrast-enhanced CT scan image showing liver parenchyma tumor nodule (i.e., PT) (left panel, white arrow) and PVTT in portal vein (i.e., dPVTT) (right panel, black arrow) in the representative case (CT 183747). A schematic distribution diagram of an HCC parenchyma nodule and dPVTT in this case (B) clearly showing the different anatomical locations of these two tumor sites. (C) Histopathological analysis of PVTT and PT tissues by HE staining. Bar represents 20 µm.

and PT tissues from the selected five small HCC patients. A representative 2-DE map is shown in Figure 2A. The overall spot patterns were largely similar in the two groups. After automatic spot detection, background subtraction and volume normalization, 1350 ( 78 protein spots were detected in the PT tissues while 1230 ( 53 spots were detected in the dPVTT tissues. Based on PDQuest software analysis, 65 spots had significant variations, of which 19 spots showed protein expression levels that differed by more than 3-fold in at least 80% (four) of the patients. Ten proteins were downregulated and 9 proteins were upregulated in dPVTT tissues when compared to PT tissues. All of these proteins were closely related to important cell biological activities involved in carcinogenesis (Table 3). Among them, five proteins, Gal-1, Stmn-1, PCNA, HMGB1 and Prx1, related to proliferation/apoptosis and/or metastasis/invasion were taken into consideration.22-25 Two protein spots representative of Gal-1 and Stmn-1 were first enlarged and showed quantitative differences between the two tumor tissues (Figure 2B). Next, we validated the differential expression of these two proteins by flow cytometry. Consistent with the observations in 2-DE analysis, Stmn-1 was significantly upregulated by approximately 7-fold in dPVTT tissues when compared to the PT tissues (Figure 2C), while Gal-1 expression was markedly reduced and the mean fluorescence intensity (MFI) was about one-sixth of that in the PT tissues (Figure 2D). To further confirm the differential expression profiles between the two cancerous tissues, the other three proteins were validated by qRT-PCR assays. Consistent with the results shown in Figure 2A and Table 3, in dPVTT tissues, proliferating cell nuclear antigen (PCNA) was significantly upregulated, whereas high-mobility group box 1(HMGB1) and peroxiredoxin 1 (Prx 1), both reported to be inhibitors of tumor suppressors,23,24

research articles

Proteomics Analysis of Distinct Portal Vein Tumor Thrombi

Figure 2. dPVTT exhibited a different protein expression profile when compared to PT tissues. (A) Representative 2-DE gels of dPVTT (left) and PT (right). The overall spot patterns were largely similar in the two groups. The circles show identified spots. The spot numbers correspond to those in Table 3. (B) Representative enlargements of silver-stained gel spots of Stmn-1 and Gal-1, showing quantitative differences between dPVTT and PT. Differential expression levels of Stmn-1 and Gal-1 were further analyzed by flow cytometry using specimens from the five HCC patients (C, D). Profiles on the left are representative of five independent experiments (left). Statistical analysis of mean fluorescence intensity (MFI) is shown on the right. The differences were statistically significant (right, PT vs dPVTT, **, P < 0.01). (E) Differential expression levels of PCNA, HMGBI and Prx 1 were further analyzed using specimens from the five HCC patients by real-time PCR. The specificity of every real-time PCR reaction was assessed by including a melting curve in a tentative test. All data are shown as the mean ( standard deviation based on three independent experiments (PT vs dPVTT * P < 0.05).

were markedly reduced when compared with the levels in PT samples (Figure 2E). dPVTT has a Different Cellular Phenotype Identified by the Expression of C-Kit. It is well-known that four types of cells in the hepatic lineage are involved in liver carcinogenesis, and five related markers including AFP, CD90, c-kit, CK-19 and CD133 have been identified.26-29 Expression of these markers was quantified by qRT-PCR to explore the possibly unique phenotype of cells from dPVTT. As shown in Figure 3A, the mRNA of three genes including AFP, CD90, and CK-19 was highly expressed in both PT and dPVTT tissues; however, there was no significant difference in the expression of the three genes between the two tissues. In contrast, the expression of c-kit mRNA was significantly higher in dPVTT tissues when compared to PT tissues (p < 0.01). CD133, a well-known marker of cancer stem cells, was weakly detected in the five selected HCC specimens. The quantitative and qualitative differences of c-kit expression were further analyzed by flow cytometry. Compared with isotype antibody staining (data not shown), almost all cells (86.62 ( 12.85) in the dPVTTs expressed c-kit at a very high level. Very few (1.08 ( 0.16), if any, cells from PT tissues showed significant expression (Figure 3B). This finding

could interpret differences in mRNA expression. Given that cancerous tissues consist of a mixture of cells, c-kit expression was further evaluated in six HCC cell lines using qRT-PCR assays Of the six cell lines, only CSQT-2 was derived from dPVTT tissues that showed high metastatic activity,18 and the other five cell lines were established using parenchyma tumor nodules. Compared with the other five cell lines, the c-kit mRNA level was significantly upregulated in CSQT-2 by approximately 5-fold (versus BEL-7407) to about 500-fold (versus MHCC-P) (Figure 3C).

Discussion On the basis of our clinical observations, we define a type of distinct PVTT (i.e., dPVTT) (Figure 1). We compared the proteome of dPVTT with that of PT. Proteins expression levels with differences of more than 3-fold in at least 80% (four) of the patients were further identified by the MALDI-TOF MS-based PMF analysis. In total, 19 proteins were detected including Galectin-1, Peroxiredoxin I, HMGB1, Cyclophilin B, PCNA and stathmin 1 among others (Figure 2, Table 3). Most of these are involved in the pathways of carcinogenesis or metastasis/invasion, and we discuss below some of the interesting proteins. Journal of Proteome Research • Vol. 9, No. 8, 2010 4173

research articles

Guo et al.

Table 3. Nineteen Proteins with Differential Expression (g 3-fold increase or decrease, Student’s t-test) between PT and dPVTT by MAIDI-TOF MS NCBI Ssp no accession no

2102 5406 6117 6220 7318 9020 9106 9108 9110 4110

protein desciption

theoretical protein Mr/pI coverage

10 down-regulated proteins in dPVTT gi|42542977 Galectin-1 14.87/5.34 gi|15277503 ACTB protein 40.53/5.55 gi|55958715 HMGBI 25.14/5.76 gi|76779255 NP protein 32.33/6.45 gi|77744391 P53 inducible 36.67/6.67 protein 3 gi|4028622 Chaperonin 10- related 10.29/8.98 protein gi|32455264 peroxiredoxin 1 22.32/8.27 gi|1421614 Nucleoside 17.27/8.55 Diphosphate Kinase gi|1310882 Cyclophilin B 19.71/8.58 gi|4557797 nonmetastatic 17.15/5.83 cells 1, protein

9 up-regulated proteins in dPVTT 4114 gi|5031851 Stathmin 1 17.30/5.90 0204 gi|4505641 proliferating 28.77/4.57 cell nuclear antigen (PCNA) 3109 gi|296653 hp2-alpha 42.12/6.25 3305 gi|180414 alpha-1 type III collagen 36.98/6.21 5113 gi|999893 Triosephosphate Isomerase 26.81/6.51 5117 gi|11275310 antiTNF-R antibody light- 23.67/6.90 chainFab fragment 8306 gi|359734 aldolase B group box 1 39.85/8.28 39.47/8.35 8310 gi|14738249 similar to fructosebisphosphate aldolase B 8311 gi|1473824 similar to fructose22.32/8.27 bisphosphate aldolase B

35% 20% 42% 78% 30% 55% 69% 53% 61% 45%

49% 34% 19% 30% 36% 36% 30% 54% 69%

Galectin-1(Gal1) was the first identified member of the galectin family of beta-galactosidase-binding proteins. Gal1 has important roles in processes fundamental to the growth and survival of cancer cells.30,31 Gal1 modulates the proliferation of both normal and malignant cells, depending on the cell type. Growth inhibition may be observed at high Gal1 levels, whereas lower concentrations enhance cell proliferation.22 The expression of Gal1 was downregulated in dPVTT compared to that in PT tissues, while PCNA was upregulated in dPVTT, which suggests that dPVTT has a stronger proliferative activity than that of PT. Cyclophilin B (Cyp-B), another significantly reduced protein in dPVTT, is a secreted CSA-binding protein involved in inflammatory events. It can induce chemotaxis in human neutrophils and T lymphocytes. Cyp-B transmits a signal from T-cell receptors to calnecium in conjunction with calciummodulating Cyp-B binding protein.32 Allain et al. demonstrate that CypB induces chemotaxis and integrin-mediated adhesion of T cells to the extracellular matrix (ECM) in vitro. This effect appears to be targeted predominantly to memory CD4+ T cells.33 Cyp-B has been used as one of the peptide antigens for specific immunotherapy. Two Cyp-B-derived peptides are used to induce HLA-A2-restricted and tumor-specific CTLs in patients as a cancer vaccines.34 Stathmin-1 (Stmn-1) expression, which was upregulated in dPVTT, has been reported to be an important prognostic factor for HCC and may serve as a useful marker for the prediction of early tumor recurrence.25 Our data further demonstrated that dPVTTs markedly upregulate c-kit expression (Figure 3). This finding indicated that dPVTT and PT might be from different origins. Hepatic oval cells might be responsible for the dPVTT origin. First, oval cells express c-kit.35 Second, oval cells were observed at the periportal area and in the surrounding parenchyma.26,35 Taken 4174

Journal of Proteome Research • Vol. 9, No. 8, 2010

Figure 3. C-kit was significantly and highly expressed in dPVTT. (A) Expression of five markers (c-kit, AFP, CD133, CD90 and CK19) at the mRNA level in five pairs of PT nodules and dPVTT tissues from the five cases was detected using real-time PCR. (B) C-kit protein expression was detected by flow cytometry in the five pairs of PT nodules and dPVTT tissues from the five cases. (C) C-kit expression at the mRNA level in six cell lines was detected using real-time PCR. The specificity of every real-time PCR reaction was assessed by including a melting curve in a tentative test. All data are shown as the mean ( standard deviation based on three independent experiments. ** P < 0.01.

together, these findings indicate that dPVTT with different molecular signatures, showing a more malignant phenotype, is distinct from PT, although there are still many potential biomarkers left unidentified, and the mechanisms of the changes in proteins are still unclear. It has been reported that administration of the drug imatinib, a tyrosine kinase inhibitor of c-kit, improves the prognosis of HCC patient.36 Therefore, a combination treatment that includes an inhibitor of c-kit might be more effective in HCC patients with dPVTTs. Prospective studies will be necessary to determine whether treatment targeting dPVTT could be used for HCC patients. Further examination is necessary to clarify the underlying mechanisms through which dPVTT develops, which would definitely promote the development of more effective treatments for HCC patients with PVTT. Much of this work is underway in our laboratory. In conclusion, a map of the differentially expressed proteome between dPVTT and PT tissues was generated, and a total of 19 unique, differentially expressed proteins were identified, which demonstrates the presence of dPVTTs with a more malignant

research articles

Proteomics Analysis of Distinct Portal Vein Tumor Thrombi phenotype. C-kit may be useful as a potential marker to distingushish dPVTT from PT. Additionally, specific treatments targeting dPVTT might be applied to HCC patients with dPVTT

Acknowledgment. We thank Shunxing Zhang and Deborah R. Breiter for their critical reading of the manuscript. This work was supported by the grants of The Ministry of Technology Key Program (No:2008zx10002-025), National Natural Science Foundation (No:30873352), Shanghai Science and Technology Committee (No: 07JC14066), and Shanghai Education Committee of Shuguang Plan (No: 05SG39), and supported by Program for New Century Excellent Talents in University and specially appointed Professor of Shanghai. References (1) Pisani, P.; Parkin, D. M.; Bray, F.; Ferlay, J. Erratum: Estimates of the worldwide mortality from 25 cancers in 1990. Int. J. Cancer 1999, 83 (6), 870–873; Int. J. Cancer 1999, 83, 18-29. (2) Ji, J.; Shi, J.; Budhu, A.; Yu, Z.; Forgues, M.; Roessler, S.; Ambs, S.; Chen, Y.; Meltzer, P. S.; Croce, C. M.; Qin, L. X.; Man, K.; Lo, C. M.; Lee, J.; Ng, I. O.; Fan, J.; Tang, Z. Y.; Sun, H. C.; Wang, X. W. MicroRNA expression, survival, and response to interferon in liver cancer. N. Engl. J. Med. 2009, 361 (15), 1437–47. (3) Zhang, X.; Liu, S.; Hu, T.; Liu, S.; He, Y.; Sun, S. Up-regulated microRNA-143 transcribed by nuclear factor kappa B enhances hepatocarcinoma metastasis by repressing fibronectin expression. Hepatology 2009, 50 (2), 490–9. (4) Zhu, X. D.; Zhang, J. B.; Zhuang, P. Y.; Zhu, H. G.; Zhang, W.; Xiong, Y. Q.; Wu, W. Z.; Wang, L.; Tang, Z. Y.; Sun, H. C. High expression of macrophage colony-stimulating factor in peritumoral liver tissue is associated with poor survival after curative resection of hepatocellular carcinoma. J. Clin. Oncol. 2008, 26 (16), 2707–16. (5) Yamanaka, N.; Okamoto, E.; Fujihara, S.; Kato, T.; Fujimoto, J.; Oriyama, T.; Mitsunobu, M.; Toyosaka, A.; Uematsu, K.; Yamamoto, K. Do the tumor cells of hepatocellular carcinomas dislodge into the portal venous stream during hepatic resection. Cancer 1992, 70 (9), 2263–7. (6) Llovet, J. M.; Bruix, J. Novel advancements in the management of hepatocellular carcinoma in 2008. J. Hepatol. 2008, 48, S20–37, suppl 1. (7) Lencioni, R.; Caramella, D.; Sanguinetti, F.; Battolla, L.; Falaschi, F.; Bartolozzi, C. Portal vein thrombosis after percutaneous ethanol injection for hepatocellular carcinoma: value of color Doppler sonography in distinguishing chemical and tumor thrombi. AJR Am. J. Roentgenol. 1995, 164 (5), 1125–30. (8) Li, N.; Lai, E. C.; Shi, J.; Guo, W. X.; Xue, J.; Huang, B.; Lau, W. Y.; Wu, C.; Cheng, S. Q. A comparative study of antiviral therapy after resection of hepatocellular carcinoma in the immune-active phase of hepatitis B virus infection. Ann. Surg. Oncol. 2010, 17 (1), 179– 85. (9) Qiu, J. G.; Fan, J.; Liu, Y. K.; Zhou, J.; Dai, Z.; Huang, C.; Tang, Z. Y. Screening and detection of portal vein tumor thrombiassociated serum low molecular weight protein biomarkers in human hepatocellular carcinoma. J. Cancer Res. Clin. Oncol. 2008, 134 (3), 299–305. (10) Shuqun, C.; Mengchao, W.; Han, C.; Feng, S.; Jiahe, Y.; Guanghui, D.; Wenming, C.; Peijun, W.; Yuxiang, Z. Tumor thrombus types influence the prognosis of hepatocellular carcinoma with the tumor thrombi in the portal vein. Hepatogastroenterology 2007, 54 (74), 499–502. (11) Zeng, Z. C.; Fan, J.; Tang, Z. Y.; Zhou, J.; Wang, J. H.; Wang, B. L.; Guo, W. Prognostic factors for patients with hepatocellular carcinoma with macroscopic portal vein or inferior vena cava tumor thrombi receiving external-beam radiation therapy. Cancer Sci. 2008, 99 (12), 2510–7. (12) Ye, Q. H.; Qin, L. X.; Forgues, M.; He, P.; Kim, J. W.; Peng, A. C.; Simon, R.; Li, Y.; Robles, A. I.; Chen, Y.; Ma, Z. C.; Wu, Z. Q.; Ye, S. L.; Liu, Y. K.; Tang, Z. Y.; Wang, X. W. Predicting hepatitis B virus-positive metastatic hepatocellular carcinomas using gene expression profiling and supervised machine learning. Nat. Med. 2003, 9 (4), 416–23. (13) Liu, S.; Foster, B. A.; Chen, T.; Zheng, G.; Chen, A. Modifying dendritic cells via protein transfer for antitumor therapeutics. Clin. Cancer Res. 2007, 13 (1), 283–91. (14) Chen, R.; Zhu, D.; Ye, X.; Shen, D.; Lu, R. Establishment of three human liver carcinoma cell lines and some of their biological characteristics in vitro. Sci. Sin. 1980, 23 (2), 236–47.

(15) Li, Y.; Tang, Z. Y.; Ye, S. L.; Liu, Y. K.; Chen, J.; Xue, Q.; Chen, J.; Gao, D. M.; Bao, W. H. Establishment of cell clones with different metastatic potential from the metastatic hepatocellular carcinoma cell line MHCC97. World J. Gastroenterol. 2001, 7 (5), 630–6. (16) Pan, X. B.; Wei, L.; Chen, H. S.; Liu, F.; Gao, Y. Liver-derived cell lines QSG-7701 and HepG2 support different HBV replication patterns. Arch. Virol. 2007, 152 (6), 1159–73. (17) Tian, J.; Tang, Z. Y.; Ye, S. L.; Liu, Y. K.; Lin, Z. Y.; Chen, J.; Xue, Q. New human hepatocellular carcinoma (HCC) cell line with highly metastatic potential (MHCC97) and its expressions of the factors associated with metastasis. Br. J. Cancer 1999, 81 (5), 814–21. (18) Wang, T.; Hu, H. S.; Feng, Y. X.; Shi, J.; Li, N.; Guo, W. X.; Xue, J.; Xie, D.; Liu, S. R.; Wu, M. C.; Cheng, S. Q. Characterisation of a novel cell line (CSQT-2) with high metastatic activity derived from portal vein tumour thrombus of hepatocellular carcinoma. Br. J. Cancer 2009, 102 (11), 1618–26. (19) Cui, J. F.; Liu, Y. K.; Pan, B. S.; Song, H. Y.; Zhang, Y.; Sun, R. X.; Chen, J.; Feng, J. T.; Tang, Z. Y.; Yu, Y. L.; Shen, H. L.; Yang, P. Y. Differential proteomic analysis of human hepatocellular carcinoma cell line metastasis-associated proteins. J. Cancer Res. Clin. Oncol. 2004, 130 (10), 615–22. (20) Yu, L. R.; Zeng, R.; Shao, X. X.; Wang, N.; Xu, Y. H.; Xia, Q. C. Identification of differentially expressed proteins between human hepatoma and normal liver cell lines by two-dimensional electrophoresis and liquid chromatography-ion trap mass spectrometry. Electrophoresis 2000, 21 (14), 3058–68. (21) Hu, T.; Liu, S.; Breiter, D. R.; Wang, F.; Tang, Y.; Sun, S. Octamer 4 small interfering RNA results in cancer stem cell-like cell apoptosis. Cancer Res. 2008, 68 (16), 6533–40. (22) Adams, L.; Scott, G. K.; Weinberg, C. S. Biphasic modulation of cell growth by recombinant human galectin-1. Biochim. Biophys. Acta 1996, 1312 (2), 137–44. (23) Banerjee, S.; Kundu, T. K. The acidic C-terminal domain and A-box of HMGB-1 regulates p53-mediated transcription. Nucleic Acids Res. 2003, 31 (12), 3236–47. (24) Prochownik, E. V. Functional and physical communication between oncoproteins and tumor suppressors. Cell. Mol. Life Sci. 2005, 62 (21), 2438–59. (25) Yuan, R. H.; Jeng, Y. M.; Chen, H. L.; Lai, P. L.; Pan, H. W.; Hsieh, F. J.; Lin, C. Y.; Lee, P. H.; Hsu, H. C. Stathmin overexpression cooperates with p53 mutation and osteopontin overexpression, and is associated with tumour progression, early recurrence, and poor prognosis in hepatocellular carcinoma. J. Pathol. 2006, 209 (4), 549–58. (26) Fujio, K.; Evarts, R. P.; Hu, Z.; Marsden, E. R.; Thorgeirsson, S. S. Expression of stem cell factor and its receptor, c-kit, during liver regeneration from putative stem cells in adult rat. Lab. Invest. 1994, 70 (4), 511–6. (27) Omori, M.; Evarts, R. P.; Omori, N.; Hu, Z.; Marsden, E. R.; Thorgeirsson, S. S. Expression of alpha-fetoprotein and stem cell factor/c-kit system in bile duct ligated young rats. Hepatology 1997, 25 (5), 1115–22. (28) Shiojiri, N.; Lemire, J. M.; Fausto, N. Cell lineages and oval cell progenitors in rat liver development. Cancer Res. 1991, 51 (10), 2611–20. (29) Thorgeirsson, S. S. Hepatic stem cells in liver regeneration. FASEB J. 1996, 10 (11), 1249–56. (30) Lahm, H.; Andre, S.; Hoeflich, A.; Kaltner, H.; Siebert, H. C.; Sordat, B.; von der Lieth, C. W.; Wolf, E.; Gabius, H. J. Tumor galectinology: insights into the complex network of a family of endogenous lectins. Glycoconj. J. 2004, 20 (4), 227–38. (31) Salatino, M.; Croci, D. O.; Bianco, G. A.; Ilarregui, J. M.; Toscano, M. A.; Rabinovich, G. A. Galectin-1 as a potential therapeutic target in autoimmune disorders and cancer. Expert Opin. Biol. Ther. 2008, 8 (1), 45–57. (32) Bram, R. J.; Crabtree, G. R. Calcium signalling in T cells stimulated by a cyclophilin B-binding protein. Nature 1994, 371 (6495), 355–8. (33) Bukrinsky, M. I. Cyclophilins: unexpected messengers in intercellular communications. Trends Immunol. 2002, 23 (7), 323–5. (34) Clevenger, C. V. Role of prolactin/prolactin receptor signaling in human breast cancer. Breast Dis. 2003, 18, 75–86. (35) Fujio, K.; Hu, Z.; Evarts, R. P.; Marsden, E. R.; Niu, C. H.; Thorgeirsson, S. S. Coexpression of stem cell factor and c-kit in embryonic and adult liver. Exp. Cell Res. 1996, 224 (2), 243–50. (36) Ramadori, G.; Fuzesi, L.; Grabbe, E.; Pieler, T.; Armbrust, T. Successful treatment of hepatocellular carcinoma with the tyrosine kinase inhibitor imatinib in a patient with liver cirrhosis. Anticancer Drugs 2004, 15 (4), 405–9.

PR100412W Journal of Proteome Research • Vol. 9, No. 8, 2010 4175