pyrene Regulates Osteoblast Proliferation through an Estrogen

proliferating cell nuclear antigen protein levels in nuclear fraction of ... benzo[a]pyrene may modulate the osteoblast proliferation through activati...
1 downloads 0 Views 207KB Size
Download PDF
Chem. Res. Toxicol. 2004, 17, 679-684

679

Benzo[a]pyrene Regulates Osteoblast Proliferation through an Estrogen Receptor-Related Cyclooxygenase-2 Pathway Keh Sung Tsai,† Rong Sen Yang,‡,§ and Shing Hwa Liu*,| Department of Laboratory Medicine, Department of Orthopaedics, and Institute of Toxicology, College of Medicine, National Taiwan University, Taipei 10043, Taiwan Received February 2, 2004

Polycyclic aromatic hydrocarbons (PAHs) have been known as a kind of xenoestrogen. Benzo[a]pyrene, a PAH present in tobacco smoke and tar, has been implicated in the induction of cell proliferation as well as tumors including osteosarcoma. Nevertheless, the literature about the action of benzo[a]pyrene on the bone system is rare. It has been identified that osteoblasts owned the estrogen receptors and estrogen could modulate the osteoblast proliferation. In this study, we found that benzo[a]pyrene was capable of increasing the cell proliferation in cultured rat osteoblasts, human osteosarcoma cell line (MG-63), and estrogen sensitive human cell line (MCF-7) but not in the human estrogen receptor negative cell line (MDA-MB-231). This benzo[a]pyrene-induced osteoblast proliferation could be inhibited by the estrogen receptor antagonist ICI182780 and tamoxifen, PD98059 [extracellular signal-regulated kinase (ERK)/mitogenactivated protein kinase (MAPK) inhibitor], and LY294002 [phosphatidylinositol 3-kinase (PI3K) inhibitor] but not R-naphthoflavone (aryl hydrocarbon receptor antagonist) and SB203580 (p38 MAPK inhibitor). Western blot analysis showed that benzo[a]pyrene could induce the phosphorylation of ERK1/2 and Akt (PI3K downstream effector) in osteoblasts. The proliferating cell nuclear antigen protein levels in nuclear fraction of osteoblasts were also increased by benzo[a]pyrene. Moreover, cyclooxygenase-2 (COX-2), but not COX-1, expression could be induced in osteoblasts under benzo[a]pyrene treatment. Its upregulation was associated with the induction of prostaglandin E2 (PGE2). COX-2 inhibitors NS398 and aspirin are capable of inhibiting the benzo[a]pyrene-induced osteoblast proliferation. These results indicate that benzo[a]pyrene may modulate the osteoblast proliferation through activation of COX-2 protein.

Introduction PAHs1

have been reported to modulate sexual differentiation by interacting with nuclear steroid receptors, and it has been known as a kind of xenoestrogen, whose chemicals possess estrogenic and/or antiestrogenic activities (1-4). There is an ongoing scientific debate concerning the potential threat of xenoestrogens to animal and human health (4-6). So far, the focus has been on the endocrinological system and reproductive organs. In addition to their well-documented effects on reproductive tissue, some select environmental estrogens could dramatically prevent ovariectomy-induced bone loss (1). Recently, it has been demonstrated that PAHs present in cigarette smoke caused bone loss in an ovariectomized rat model (7). Benzo[a]pyrene, a PAH present in tobacco smoke and tar, has been implicated in the induction of cell proliferation as well as tumors including osteosarcoma (8-12). However, the precise regulatory effects of environmental estrogens on bone cells are not yet wellunderstood. * To whom correspondence should be addressed. Tel: +886-223123456ext.8605.Fax: +886-2-23410217.E-mail: [email protected]. † Department of Laboratory Medicine. ‡ Department of Orthopaedics. § Contributions to this study from the first two authors were equal. | Institute of Toxicology. 1 Abbreviations: PAHs, polycyclic aromatic hydrocarbons; ER, estrogen receptors; COX-2, cyclooxygenase-2; MAPK, mitogen-activated protein kinase; ERK, extracellular regulated kinase; PI3K, phosphatidylinositol 3-kinase; PCNA, proliferating cell nuclear antigen.

Bone mass is the end point of a dynamic and complex process characterized by a balance between osteoblast bone formation and osteoclast bone resorption. Estrogens play central roles in the control of both cell types. Estrogen-induced cellular responses are mediated by ERs, a nuclear receptor superfamily. The ERs, ER-R and ER-β, have been demonstrated in human and murine osteoblasts (13, 14). Moreover, many data supported the existence and importance of membrane ER in the biological actions of the sex steroid in various cells including osteoblasts (15-18). It has been demonstrated that the membrane and nuclear ER could be derived from a single transcript and have near identical affinities for 17-βestradiol, but there were considerably more nuclear than membrane receptors (19). The membrane ER could activate G proteins, MAPK/ERK, and cell proliferation. On the other hand, it has been reported that preosteoclasts expressed detectable levels of ER-R, but osteoclast maturation and bone resorption were associated with loss of ER-R expression (20). Nevertheless, a recent study has shown that ER-β was expressed in osteoclasts of adult human bone and inferred that it might provide a means for direct action of estrogen on osteoclasts (21). Βenzo[a]pyrene has been shown to be capable of producing the ER-mediated responses in MCF-7 cells (22). However, the effects of benzo[a]pyrene on the cell growth and the response to ER in bone cells are still unclear. The aims of this study, therefore, are to investigate whether PAH

10.1021/tx0499517 CCC: $27.50 © 2004 American Chemical Society Published on Web 04/16/2004

680

Chem. Res. Toxicol., Vol. 17, No. 5, 2004

benzo[a]pyrene regulates osteoblast proliferation and whether the ER-related mechanism is involved in this benzo[a]pyrene-triggered response.

Materials and Methods Cell Cultures. Primary osteoblasts were obtained from the calvaria of 18 day old fetal rats as described previously (23). In brief, the fetal rats were put under anesthesia using intraperitoneal injection of pentobarbital. The calvaria were then dissected by aseptic technique. The soft tissues were divided into small pieces and were treated with 0.1% collagenase solution for 10 min at 37 °C. The next two 20 min sequential collagenase digestions were then pooled and filtered through a 70 µm nylon filter (Falcon; BD Biosciences, San Jose, CA). Moreover, human MG-63 osteosarcoma cells and estrogen sensitive (MCF-7) and estrogen resistant (MDA-MB-231) human breast cancer cells (American Type Culture Collection) were also used in this study. These cells were then grown on plastic cell culture dishes in 95% air-5% CO2 with Dulbecco’s modified Eagle’s medium, which was supplemented with 20 mM HEPES and 10% heatinactivated fetal calf serum, 2 mM glutamine, penicillin (100 U/mL), and streptomycin (100 µg/mL); the pH was adjusted to 7.6. The cell medium was changed twice a week. The osteoblast characteristics were confirmed by morphology and alkaline phosphatase expression. For assays of estrogen dependence, media were charcoal stripped to eliminate exogenous estrogens and phenol red. Cell Proliferation Assay. 1. MTS Assay. Cell proliferation was measured using a nonradioactive cell proliferation assay kit (CellTiter 96 AQueous, Promega). The assay was composed of a solution of tetrazolium compound [3,4-(5-dimethylthiazol-2yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt, MTS] and an electron-coupling reagent (phenazine methosulfate, PMS). The assay was based on the cellular conversion of the colorimetric reagent MTS into soluble formazan by dehydrogenase enzymes found only in metabolically active cells (24). Osteoblasts (1 × 105 cells/mL) in 96 well cell culture dishes were incubated for 24 h with or without benzo[a]pyrene in the presence or absence of inhibitors. Twenty microliters/well of combined MTS/PMS solution was then added. After 1 h of incubation at 37 °C in a humidified 5% CO2 atmosphere, an absorbance of 490 nm was measured using an ELISA microplate reader. 2. PCNA Immunoblotting. PCNA is a marker for cellular proliferation. A PCNA is expressed in the G1, S, and G2 phases of the cell cycle (25). An antibody against PCNA was used to identify cells undergoing DNA synthesis. Cells were treated with tested drugs for 24 h and analyzed by immunoblotting with antibody specific for PCNA. Western Blot Analysis. Immunoblots were performed as described (23). A 30-50 µg sample of each cell lysate or nuclear extract was subjected to electrophoresis on 10% SDS-polyacrylamide gels. The samples were then electroblotted on poly(vinylidene difluoride) membranes. After blocking, blots were incubated with anti-PCNA, anti-COX-2 (BD-Transduction Laboratories), anti-ERK and anti-phospho-ERK, anti-R-tubulin (Santa Cruz Biotechnology), and anti-Akt and anti-phospho-Akt (New England BioLabs) antibodies in PBST (phosphate-buffered saline within 0.1% Tween 20) for 1 h followed by two washes (15 min each) in PBST. The membranes were then incubated with horseradish peroxidase-conjugated secondary antibodies for 30 min. Enhanced chemiluminescence reagents (Amersham Pharmacia Biotech) were employed to depict the protein bands on membranes. Reverse Transcription-Polymerase Chain Reaction (RT-PCR) for COX-2 Expression. The expression of COX-2 mRNA was determined by the RT-PCR analysis technique. In brief, approximately 5 × 105 cells were homogenized with 1 mL of Trizol reagent (GIBCO-BRL). The total RNA was isolated according to the manufacturer’s protocols. The first standard cDNA was synthesized by the extension of (dT) primers with

Tsai et al. 200 U of SuperScript II reverse transcriptase (GIBCO) in a mixture containing 1 µg of total RNA digested by RNAse-free DNAse (2 U/µg of RNA) for 15 min at 37 °C. Then, the cDNA served as a template in a PCR using the Perkin-Elmer DNA Thermal Cycler (model 480). The primers (5′ or 3′) used for COX-2 were sense primer, CATTCTTTGCCCAGCACTTCAC, and antisense primer, GACCAGGCACCAAGA CCAAAGAC, at a concentration of 0.4 µM. The amplification cycles included 94 °C for 60 s, 55 °C for 60 s, and 72 °C for 90 s. Then, the PCR products were subjected to electrophoresis on a 2% agarose gel after 30 cycles. The electrophoresis products were visualized by ethidium bromide staining. The mRNA of β-actin served as control for the sample integrity and loading. PGE2 Production. PGE2 levels in cell culture supernatants were determined using the PGE2 enzyme immunoassay kit (Cayman). Statistical Analyses. The values given in this paper are presented as means ( SEM. All analyses were performed by ANOVA followed by a Fisher’s least significant difference test. A P value of less than 0.05 was viewed as statistically significant.

Results Effect of Benzo[a]pyrene on the Osteoblast Proliferation. Benzo[a]pyrene (1-10 µM) was capable of triggering the cell proliferation in cultured rat osteoblasts as determined by MTS assay after 24 h in culture (Figure 1A). Benzo[a]pyrene could also induce the cell proliferation in human osteosarcoma cell line MG-63 and estrogen sensitive human MCF-7 cells but not in an ER negative cell lineshuman MDA-MB-231 cells (Figure 1B). Estrogen antagonists ICI182780 (Figure 1A) and tamoxifen (Figure 2B), but not aryl hydrocarbon receptor antagonist R-naphthoflavone (Figure 2B), antagonized the benzo[a]pyrene-induced osteoblast proliferation. Moreover, PCNA has previously been used as an index of cell proliferation (25). We examined the effect of benzo[a]pyrene on the PCNA expression in nuclei of osteoblasts using the method of Western blotting. Benzo[a]pyrene effectively increased the PCNA protein expression, which could be inhibited by ICI182780 (Figure 2A). Inhibitor treatment without benzo[a]pyrene had no effect on the basal proliferation or PCNA protein expression of cells. To test the possible signaling pathways involved in the benzo[a]pyrene-induced osteoblast proliferation, the cells were treated with benzo[a]pyrene in the presence or absence of PD98059 (10 µM), a specific inhibitor of ERK MAPK, or SB203580 (10 µM), a specific inhibitor of p38 MAPK. The results showed that PD98059, but not SB203580, caused a marked reduction in the benzo[a]pyrene-induced osteoblast proliferation (Figure 2B). We further found that benzo[a]pyrene was capable of triggering the phosphorylation of ERK1/2 protein, which was inhibited by ICI182780 and PD98059 (Figure 3A). However, neither benzo[a]pyrene nor PD98059 altered the total amount of ERK1/2 protein. Moreover, PI3K and its downstream effector Akt (protein kinase B, a serine-threonine protein kinase), is a critical regulator of normal cell growth, cell cycle progression, and cell survival; we further investigate whether PI3K/Akt signaling is involved in the benzo[a]pyrene-induced osteoblast proliferation. The results showed that a PI3K inhibitor LY294002 significantly inhibited the benzo[a]pyrene-induced osteoblast proliferation (Figure 2B). Benzo[a]pyrene could also trigger Akt phosphorylation in osteoblasts, which was blocked by ICI182780 and LY294002 (Figure 3B). ICI182780 or LY294002 treatment without benzo[a]pyrene had no effect on the Akt phosphorylation of cells.

Benzo[a]pyrene Modulates Bone Cell Homeostasis

Figure 1. Effect of benzo[a]pyrene on the cell proliferation in osteoblasts. (A) Cell proliferation in cultured rat osteoblasts was determined by MTS assay after 24 h in culture. Cells were pretreated with or without ICI182780 (ICI, 10 µM) for 1 h and then incubated under benzo[a]pyrene (BaP, 1-10 µM) for 24 h. (B) Human MG-63 osteosarcoma cells and estrogen sensitive human MCF-7 cells and estrogen resistant human MDA-MB231 cells were also used to test the effect of benzo[a]pyrene (3 µM). The conversion of MTS was measured by the amount of absorbance in 490 nm. Data are presented as means ( SEM from three to five experiments performed in triplicate. *P < 0.05 as compared with control. #P < 0.05 as compared with benzo[a]pyrene without any other drugs.

Effect of Benzo[a]pyrene on the Expression and Activation of COX-2. We found that treatment of benzo[a]pyrene for 24 h in osteoblasts significantly induced the expression of COX-2, which was inhibited by ICI182780 (Figure 4A). Benzo[a]pyrene did not affect the expression of COX-1 protein in osteoblasts (Figure 4C). Furthermore, benzo[a]pyrene significantly induced the expression of COX-2 mRNA in osteoblasts, which was inhibited by ICI182780 (Figure 4B). Benzo[a]pyrene-induced COX-2 protein expression was associated with a release of PGE2 (Figure 5A). Selective COX-2 inhibitor NS398 (20 µM) significantly inhibited the benzo[a]pyrene-induced PGE2 production. To further evaluate the possible role of COX-2 in the benzo[a]pyrene-triggered osteoblast proliferation, the cells were treated with benzo[a]pyrene in the presence or absence of COX-2 inhibitors NS398 (20 µM) and aspirin (2 mM). NS398 and aspirin could inhibit the benzo[a]pyrene-induced osteoblast proliferation (Figure 6). PGE2 (0.1-1 µM) could also induce the proliferation in the rat osteoblasts and MG-63 cells (Figure 5B). Moreover, to test the possible signaling pathways involved in the benzo[a]pyrene-triggered COX-2 protein expression in osteoblasts, the cells were treated with benzo[a]pyrene in the presence or absence of PD98059 (10 µM) and LY294002 (10 µM). The results showed that PD98059

Chem. Res. Toxicol., Vol. 17, No. 5, 2004 681

Figure 2. Inhibition of benzo[a]pyrene-induced osteoblast proliferation. (A) Cells were pretreated with ICI182780 (ICI, 10 µM) or PD98059 (PD, 10 µM) for 1 h and then incubated under benzo[a]pyrene (BaP, 10 µM) for 24 h. Cell nuclear fractions were prepared and were analyzed by immunoblotting with antibody specific for PCNA. C23, a nuclear protein, served as control for sample loading and integrity. Quantification of the PCNA protein expression was performed by densitometric analysis. Data are presented as means ( SEM from three to five independent experiments. *P < 0.05 as compared with benzo[a]pyrene without any other drugs. (B) Cell proliferation in cultured rat osteoblasts as determined by MTS assay after 24 h in culture. Cells were pretreated with or without ICI182780 (ICI, 10 µM), tamoxifen (Tam, 3 µM), R-naphthoflavone (ANF, 3 µM), PD98059 (PD, 10 µM), SB203580 (SB, 10 µM), or LY294002 (10 µM) for 1 h and then incubated under benzo[a]pyrene (BaP, 3 µM) for 24 h. Data are presented as means ( SEM from three to five experiments performed in triplicate. *P < 0.05 as compared with control. #P < 0.05 as compared with benzo[a]pyrene without any other drugs.

and LY294002 caused a marked reduction in the benzo[a]pyrene-induced COX-2 protein expression (Figure 4A).

Discussion The results of our present work characterize the cellular effects of PAH benzo[a]pyrene on osteoblasts. Our data clearly show that benzo[a]pyrene was capable of increasing the cell proliferation in cultured rat osteoblasts, human osteosarcoma MG-63 cells, and estrogen sensitive human MCF-7 cells but not in estrogen resistant human MDA-MB-231 cells. These effects of benzo[a]pyrene could be inhibited by estrogen antagonists ICI182780 and tamoxifen. These results indicate that benzo[a]pyrene may modulate bone cell homeostasis by stimulating osteoblast proliferation through an ERrelated mechanism. COX is the key enzyme that mediates the production of prostaglandins from arachidonic acid. Two COX iso-

682

Chem. Res. Toxicol., Vol. 17, No. 5, 2004

Figure 3. Stimulation of ERK1/2 MAPK and Akt in osteoblasts by benzo[a]pyrene. Cells were pretreated with ICI182780 (ICI, 10 µM) or PD98059 (PD, 10 µM) or LY294002 (LY, 10 µM) for 1 h and then incubated under benzo[a]pyrene (BaP, 10 µM) for 30 min. (A) Whole cell lysates were immunoblotted with antiphospho-ERK1/2 MAP kinase and anti-ERK1/2 MAP kinase antibodies. R-Tubulin served as control for sample loading and integrity. Results shown are representative of at least three independent experiments with consistent results. (B). Whole cell lysates were immunoblotted with anti-phospho-Akt and antiAkt antibodies. Quantification of the phosphorylation of Akt was performed by densitometric analysis. Data are presented as means ( SEM from three to five independent experiments. *P < 0.05 as compared with benzo[a]pyrene without any other drugs.

forms have been identified, COX-1 and COX-2. COX-1 is constitutively expressed in most tissues, whereas COX-2 is induced by a number of inflammatory, mitogenic, and physical stimuli (26). In a number of cell and animal models, induction of COX-2 has been shown to promote cell growth, inhibit apoptosis, and enhance cell motility and adhesion (27). It has been reported that there were the expression of cyclooxygenase genes and involvement of endogenous prostaglandins during osteogenesis in the rat tibial bone marrow cavity and suggested that COX-2 and COX-1 would both be involved in the early stage of osteogenesis and COX-2 is likely to be more associated with the maturation of osteoblasts in the later stage (28). Moreover, the recent data from animal studies have suggested that the nonspecific and specific inhibitors of cyclooxygenases impaired fracture healing, which was due to the inhibition of COX-2 but not COX-1 (29-31). PAH benzo[a]pyrene has also been shown to induce COX-2 expression in smooth muscle cells derived from aortas of normal rats or from atherosclerotic human arteries (32). In this study, our data showed that benzo[a]pyrene was capable of inducing the expression of COX2, but not COX-1, in rat osteoblasts and human MG-63 osteosarcoma cells, which could be inhibited by ICI182780.

Tsai et al.

Figure 4. Effects of benzo[a]pyrene on the COX-2 expression in rat osteoblasts and human MG-63 cells. Cells were incubated under benzo[a]pyrene (BaP, 3-10 µM) for 3 (mRNA analysis) or 24 h (protein analysis). In some experiments, cells were pretreated with ICI182780 (ICI, 10 µM) or PD98059 (PD, 10 µM) or LY294002 (LY, 10 µM) for 1 h and then incubated under benzo[a]pyrene (BaP, 3 and 10 µM). For measurement of the COX-2 protein expression, Western blot analysis was carried out using anti-COX-2 antibody. R-Tubulin served as control for sample loading and integrity. Quantification of the COX-2 protein expression was performed by densitometric analysis. Data are presented as means ( SEM from three to five independent experiments. *P < 0.05 as compared with benzo[a]pyrene without any other drugs. Moreover, the COX-2 mRNA levels were detected using the method of RT-PCR (B). In C, the measurement of the COX-1 protein expression, Western blot analysis was carried out using anti-COX-1 antibody. Results shown are representative of four independent experiments.

This upregulation of COX-2 was associated with the induction of PGE2. Osteoblast proliferation was also induced under PGE2 treatment. COX-2 inhibitors NS398 and aspirin could also suppress the benzo[a]pyreneinduced osteoblast proliferation. These results indicate that ER-related COX-2 activity is necessary for osteoblast proliferation in response to benzo[a]pyrene. Moreover, it has been reported that the induction of COX-2 in osteoblasts was involved in interleukin-1R plus interleukin6-induced osteoclast formation (33). Therefore, it needs to clarify whether the induction of COX-2 in osteoblast by benzo[a]pyrene is involved in benzo[a]pyrene-triggered osteoclast formation in the future. The stimulation of ERK MAPK activity by 17β-estradiol has been shown in MCF-7 cells mediated through ER (34). It has been reported that binding by 17βestradiol to Chinese hamster ovary cells, which were transiently transfected cDNAs for ER-R or ER-β, enhanced the cell proliferation, critically dependent upon

Benzo[a]pyrene Modulates Bone Cell Homeostasis

Figure 5. Effect of benzo[a]pyrene on the PGE2 production and the effect of PGE2 on the cell proliferation in osteoblasts. (A) Bar graphs showing release of PGE2 in osteoblasts exposed to benzo[a]pyrene (1-10 µM) in the presence or absence of NS398 (20 µM). (B) Cells (rat osteoblasts and MG-63 cells) were treated with PGE2 (0.1-1 µM) for 24 h and then detected the cell proliferation. Data are presented as means ( SEM from three to five experiments performed in duplicate. *P < 0.05 as compared with control. #P < 0.05 as compared with benzo[a]pyrene without any other drugs.

Chem. Res. Toxicol., Vol. 17, No. 5, 2004 683

that the modulator of nongenomic activity of ER (MNAR) modulated ER interaction with members of the Src family of tyrosine kinases, which led to a stimulation of Src enzymatic activity and activation of ERK1 and ERK2 (36). A recent study has shown that the administration of 17β-estradiol to ovariectomized mice induced phosphorylation of ERKs and upregulated the expression of egr-1, an ERK/SRE target gene in vertebrae (37). Moreover, it has been found that fluid shear stress could induce the expression of COX-2 in osteoblasts and that induction occurs largely via an ERK MAPK signaling pathway (38). The involvement of ERK MAPK signaling in the benzo[a]pyrene-induced COX-2 expression in vascular smooth muscle cells has also been demonstrated (32). On the other hand, PI3K and its downstream effector Akt (protein kinase B) are mitogen-activated survival factors. Akt signaling has been demonstrated to be activated by platelet-derived growth factor in osteoblasts (39). Recently, 17β-estradiol has been demonstrated to induce a biphasic phosphorylation of Akt, which was dependent on ER, and it could be modulated by tumor suppressor PTEN via an ERK MAPK pathway in HepG2 cells (40). Recent studies have also shown that the activation of PI3K and Akt might play a role in regulating the COX-2 expression in some cultured cells (41-43). The present experiments demonstrate that benzo[a]pyrene can trigger the phosphorylation of ERK MAPK and Akt, which is inhibited by ICI182780, and the ERK MAPK inhibitor PD98059 and PI3K inhibitor LY294002 prevent the expression of COX-2 and the proliferation of osteoblasts induced by benzo[a]pyrene. However, PD98059 cannot affect the phosphorylation of Akt induced by benzo[a]pyrene in osteoblasts (data not shown). These results, therefore, indicate that benzo[a]pyrene triggers COX-2 expression and cell proliferation in osteoblasts through the ER-related ERK MAPK and PI3K/Akt signaling pathways, independently. In conclusion, we present evidence that benzo[a]pyrene modulates the activity of osteoblasts in vitro through an ER-related mechanism. The activation of ERK MAPK and PI3K/Akt signaling pathways may play the regulatory role in benzo[a]pyrene-induced COX-2 expression and cell proliferation in osteoblasts. These results also imply that the xenoestrogens may have the ability to modulate bone cell homeostasis.

Acknowledgment. This study was supported by a grant from the National Science Council of Taiwan (NSC 90-2314-B002-224). Figure 6. Inhibition of benzo[a]pyrene-induced cell proliferation in rat osteoblasts and human MG63 cells by COX-2 inhibitors. Cell proliferation in cultured rat osteoblasts and human MG63 cells was determined by MTS assay after 24 h in culture. Cells were pretreated with or without NS398 (NS, 20 µM) or aspirin (Asp, 2 mM) for 1 h and then incubated under benzo[a]pyrene (BaP, 3 µM) for 24 h. Data are presented as means ( SEM from three to five experiments performed in triplicate. *P < 0.05 as compared with control. #P < 0.05 as compared with benzo[a]pyrene without any other drugs.

the activation of the ERK (19). Recently, Santen et al. have suggested that estradiol stimulated cell proliferation by mechanisms that involved the activation of MAPK, either through rapid, nontranscription effects or by increasing growth factor production and consequently MAPK activation (35). A further study has also shown

References (1) Dodge, J. A., Glasebrook, A. L., Magee, D. E., Phillips, D. L., Sato, M., Short, L. L., and Bryant, H. U. (1996) Environmental estrogens: effectcs on cholesterol lowering and bone in the ovariectomized rat. J. Steroid Biochem. Mol. Biol. 59, 155-161. (2) Santodonato, J. (1997) Review of the estrogenic and antiestrogenic activity of polycyclic aromatic hydrocarbons: relationship to carcinogenicity. Chemosphere 34, 835-848. (3) Villeneuve, D. L., Khim, J. S., Kannan, K., and Giesy, J. P. (2002) Relative potencies of individual polycyclic aromatic hydrocarbons to induce dioxinlike and estrogenic responses in three cell lines. Environ. Toxicol. 17, 128-137. (4) Mueller, S. O. (2004) Xenoestrogens: mechanisms of action and detection methods. Anal. Bioanal. Chem. 378, 582-587. (5) Davis, D. L., Bradlow, H. L., Wolff, M., Woodruff, T., Hoel, D. G., and Anton-Culver, H. (1993) Medical hypothesis: xenoestrogens as preventable causes of breast cancer. Environ. Health Perspect. 101, 372-377.

684

Chem. Res. Toxicol., Vol. 17, No. 5, 2004

(6) Hilscherova, K., Kannan, K., Holoubek, I., and Giesy, J. P. (2002) Characterization of estrogenic activity of riverine sediments from the Czech Republic. Arch. Environ. Contam. Toxicol. 43, 175-185. (7) Lee, L. L., Lee, J. S., Waldman, S. D., Casper, R. F., and Grynpas, M. D. (2002) Polycyclic aromatic hydrocarbons present in cigarette smoke cause bone loss in an ovariectomized rat model. Bone 30, 917-923. (8) Rudenko, F. V., and Furmanchuk, A. V. (1984) Effect of intravascular pressure changes on the induction of bone neoplasms in rats. Eksperimentalnaia Onkologiia 6, 70-72. (9) Schmidt, H., and Rath, F. W. (1993) Cytogenetic analysis of a benzpyrene induced osteosarcoma in the rat (Rattus norvegicus). Cancer Genet. Cytogenet. 71, 139-143. (10) Culp, S. J., Warbritton, A. R., Smith, B. A., Li, E. E., and Beland, F. A. (2000) DNA adduct measurements, cell proliferation and tumor mutation induction in relation to tumor formation in B6C3F1 mice fed coal tar or benzo[a]pyrene. Carcinogenesis 21, 1433-1440. (11) Jeffy, B. D., Schultz, E. U., Selmin, O., Gudas, J. M., Bowden, G. T., and Romagnolo, D. (1999) Inhibition of BRCA-1 expression by benzo[a]pyrene and its diol epoxide. Mol. Carcinog. 26, 100118. (12) Jeffy, B. D., Chirnomas, R. B., and Romagnolo, D. (2002) Epigenetics of breast cancer: polycyclic aromatic hydrocarbons as risk factors. Environ. Mol. Mutagen. 39, 235-244. (13) Migliaccio, S., Wetsel, W. C., Fox, W. M., Washburn, T. F., and Korach, K. S. (1993) Endogenous protein kinase-C activation in osteoblast-like cells modulates responsiveness to estrogen and estrogen receptor levels. Mol. Endocrinol. 7, 1133-1143. (14) Vidal, O., Kindblom, L. G., and Ohlsson, C. (1999) Expression and localization of estrogen receptor-beta in murine and human bone. J. Bone Miner. Res. 14, 923-929. (15) Lieberherr, M., Grosse, B., Kachkache, M., and Balsan, S. (1993) Cell signaling and estrogens in female rat osteoblasts: a possible involvement of unconventional nonnuclear receptors. J. Bone Miner. Res. 8, 1365-1376. (16) Pappas, T. C., Gametchu, B., Yannariello-Brown, J., Collins, T. J., and Watson, C. S. (1994) Membrane estrogen receptors in GH3/ B6 cells are associated with rapid estrogen-induced release of prolactin. Endocrine 2, 813-822. (17) Watters, J. J., Campbell, J. S., Cunningham, M. J., Krebs, E. G., and Dorsa, D. M. (1997) Rapid membrane effects of steroids in neuroblastoma cells: effects of estrogen on mitogen activated protein kinase signaling cascade and c-fos immediate early gene transcription. Endocrinology 138, 4030-4033. (18) Le Mellay, V., Grosse, B., and Lieberherr, M. (1997) Phospholipase C beta and membrane action of calcitriol and estradiol. J. Biol. Chem. 272, 11902-11907. (19) Razandi, M., Pedram, A., Greene, G. L., and Levin, E. R. (1999) Cell membrane and nuclear estrogen receptors (ERs) originate from a single transcript: studies of ERalpha and ERbeta expressed in Chinese hamster ovary cells. Mol. Endocrinol. 13, 307319. (20) Oreffo, R. O., Kusec, V., Virdi, A. S., Flanagan, A. M., Grano, M., Zambonin-Zallone, A., and Triffitt, J. T. (1999) Expression of estrogen receptor-alpha in cells of the osteoclastic lineage. Histochem. Cell Biol. 111, 125-133. (21) Braidman, I. P., Hainey, L., Batra, G., Selby, P. L., Saunders, P. T., and Hoyland, J. A. (2001) Localization of estrogen receptor beta protein expression in adult human bone. J. Bone Miner. Res. 16, 214-220. (22) Charles, G. D., Bartels, M. J., Zacharewski, T. R., Gollapudi, B. B., Freshour, N. L., and Carney, E. W. (2000) Activity of benzo[a]pyrene and its hydroxylated metabolites in an estrogen receptor-alpha reporter gene assay. Toxicol. Sci. 55, 320-326. (23) Yang, R. S., Tang, C. H., Ling, Q. D., Liu, S. H., and Fu, W. M. (2002) Regulation of fibronectin fibrillogenesis by protein kinases in cultured rat osteoblasts. Mol. Pharmacol. 61, 1163-1173. (24) Cory, A. H., Owen, T. C., Barltrop, J. A., and Cory, J. G. (1991) Use of an aqueous soluble tetrazolium/formazan assay for cell growth assays in culture. Cancer Commun. 3, 207-212. (25) Morris, G. F., and Mathews, M. B. (1989) Regulation of proliferating cell nuclear antigen during the cell cycle. J. Biol. Chem. 264, 13856-13864.

Tsai et al. (26) Vane, J. R., Bakhle, Y. S., and Botting, R. M. (1998) Cyclooxygenases 1 and 2. Annu. Rev. Pharmacol. Toxicol. 38, 97-120. (27) Cao, Y., and Prescott, S. M. (2002) Many actions of cyclooxygenase-2 in cellular dynamics and in cancer. J. Cell. Physiol. 190, 279-286. (28) Sato, Y., Arai, N., Negishi, A., and Ohya, K. (1997) Expression of cyclooxygenase genes and involvement of endogenous prostaglandin during osteogenesis in the rat tibial bone marrow cavity. J. Med. Dent. Sci. 44, 81-92. (29) Endo, K., Sairyo, K., Komatsubara, S., Sasa, T., Egawa, H., Yonekura, D., Adachi, K., Ogawa, T., Murakami, R., and Yasui, N. (2002) Cyclooxygenase-2 inhibitor inhibits the fracture healing. J. Physiol. Anthropol. Appl. Hum. Sci. 21, 235-238. (30) Goodman, S., Ma, T., Trindade, M., Ikenoue, T., Matsuura, I., Wong, N., Fox, N, Genovese, M., Regula, D., and Smith, R. L. (2002) COX-2 selective NSAID decreases bone ingrowth in vivo. J. Orthop. Res. 20, 1164-1169. (31) Einhorn, T. A. (2003) COX-2: Where are we in 2003?-The role of cyclooxygenase-2 in bone repair. Arthritis Res. Ther. 5, 5-7. (32) Yan, Z., Subbaramaiah, K., Camilli, T., Zhang, F., Tanabe, T., McCaffrey, T. A., Dannenberg, A. J., and Weksler, B. B. (2000) Benzo[a]pyrene induces the transcription of cyclooxygenase ascular smooth muscle cells. J. Biol. Chem. 275, 4949-4955. (33) Tai, H., Miyaura, C., Pilbeam, C. C., Tamura, T., Ohsugi, Y., Koishihara, Y., Kubodera, N., Kawaguchi, H., Raisz, L. G., and Suda, T. (1997) Transcriptional induction of cyclooxygenase-2 in osteoblasts is involved in interleukin-6-induced osteoclast formation. Endocrinology 138, 2372-2379. (34) Migliaccio, A., Di Domenico, M., Castoria, G., de Falco, A., Bontempo, P., Nola, E., and Auricchio, F. (1996) Tyrosine kinase/ p21ras/MAP-kinase pathway activation by estradiol-receptor complex in MCF-7 cells. EMBO J. 15, 1292-1300. (35) Santen, R. J., Song, R. X., McPherson, R., Kumar, R., Adam, L., Jeng, M. H., and Yue, W. (2002) The role of mitogen-activated protein (MAP) kinase in breast cancer. J. Steroid Biochem. Mol. Biol. 80, 239-256. (36) Wong, C. W., McNally, C., Nickbarg, E., Komm, B. S., and Cheskis, B. J. (2002) Estrogen receptor-interacting protein that modulates its nongenomic activity-crosstalk with Src/Erk phosphorylation cascade. Proc. Natl. Acad. Sci. U.S.A. 99, 1478314788. (37) Kousteni, S., Han, L., Chen, J. R., Almeida, M., Plotkin, L. I., Bellido, T., and Manolagas, S. C. (2003) Kinase-mediated regulation of common transcription factors accounts for the boneprotective effects of sex steroids. J. Clin. Invest. 111, 1651-1664. (38) Wadhwa, S., Godwin, S. L., Peterson, D. R., Epstein, M. A., Raisz, L. G., and Pilbeam, C. C. (2002) Fluid flow induction of cyclooxygenase 2 gene expression in osteoblasts is dependent on an extracellular signal-regulated kinase signaling pathway. J. Bone Miner. Res. 17, 266-274. (39) Chaudhary, L. R., and Hruska, K. A. (2001) The cell survival signal Akt is differentially activated by PDGF-BB, EGF, and FGF-2 in osteoblastic cells. J. Cell. Biochem. 81, 304-311. (40) Marino, M., Acconcia, F., and Trentalance, A. (2003) Biphasic Estradiol-induced AKT Phosphorylation Is Modulated by PTEN via MAP Kinase in HepG2 Cells. Mol. Biol. Cell. 14, 25832591. (41) Weaver, S. A., Russo, M. P., Wright, K. L., Kolios, G., Jobin, C., Robertson, D. A., and Ward, S. G. (2001) Regulatory role of phosphatidylinositol 3-kinase on TNF-alpha-induced cyclooxygenase 2 expression in colonic epithelial cells. Gastroenterology 120, 1117-1127. (42) Tang, Q., Gonzales, M., Inoue, H., and Bowden, G. T. (2001) Roles of Akt and glycogen synthase kinase 3beta in the ultraviolet B induction of cyclooxygenase-2 transcription in human keratinocytes. Cancer Res. 61, 4329-4332. (43) Sheng, H., Shao, J., and Dubois, R. N. (2001) K-Ras-mediated increase in cyclooxygenase 2 mRNA stability involves activation of the protein kinase B1. Cancer Res. 61, 2670-2675.

TX0499517