Quantification of the Sulfated Cholecystokinin CCK-8 in Hamster

Oct 2, 2009 - Cholecystokinin (CCK) and the different molecular forms of CCK are well established as biomarkers for satiety but accurate analysis has ...
0 downloads 0 Views 797KB Size
Download PDF
Anal. Chem. 2009, 81, 9120–9128

Quantification of the Sulfated Cholecystokinin CCK-8 in Hamster Plasma Using Immunoprecipitation Liquid Chromatography-Mass Spectrometry/Mass Spectrometry Scott A. Young,*,† Samir Julka,† Glenn Bartley,§ Jeffrey R. Gilbert,‡ Brian M. Wendelburg,‡ Shao-Ching Hung,† W. H. Kerr Anderson,† and Wallace H. Yokoyama§ The Dow Chemical Company, Analytical Sciences, BioAnalytical, 1897 Building, Midland, Michigan 48667, Dow AgroSciences, 9330 Zionsville Road, Indianapolis, Indiana 46268, and Western Regional Research Center, Agricultural Research Center, U.S. Department of Agriculture, 800 Buchanan Street, Albany, California 94710 Cholecystokinin (CCK) and the different molecular forms of CCK are well established as biomarkers for satiety but accurate analysis has been limited by the multiple naturally occurring forms and extensive similarities to gastrin. Changes in levels of one form, CCK-8, a naturally occurring eight amino acid peptide of CCK, have been correlated with satiety responses. Endogenous CCK-8 has not been well characterized in Syrian Golden hamsters, an important model in the study of fat uptake and digestion. We have cloned and sequenced hamster CCK and identified and characterized endogenous CCK-8 from hamster plasma. Hamster CCK-8 is composed of eight amino acid residues which are highly conserved among other species. Following accurate identification and characterization of hamster CCK-8, we have developed a highly specific and sensitive immunoprecipitation based LC-MS/MS assay for its quantification. The present assay enables determination of active CCK-8 over a concentration range from 0.05 to 2.5 ng/mL in hamster plasma samples. This range covers both the basal and postprandial levels of CCK-8. Method performance validation samples were examined at three concentrations replicated over the course of 4 days. The assay accuracy (percent relative error, % RE) average was 11.3% with a precision (percent coefficient of variation, % CV) of 15.5% over all samples in this 4 day period. Additionally, the method was used to determine increases of endogenous plasma CCK-8 in hamsters challenged with a high-fat meal. Cholecystokinin (CCK) is a gut hormone which plays an important physiological role in the regulation of pancreatic enzyme secretion.1,2 In addition, CCK is also one of the most important hormones involved in the regulation of gastrointestinal motility * Corresponding author. Tel: 989-636-8728. Fax: 989-636-6432. E-mail: [email protected]. † The Dow Chemical Company. ‡ Dow AgroSciences. § U.S. Department of Agriculture. (1) Liddle, R. A. Cholecytokinin In Gut peptides. Comprehensive endocrinology, revised series; Walsh, J. H., Dockray, G. J., Eds.; New York: Raven Press, 1994; pp 175-216. (2) Wank, S. A. Am. J. Physiol. 1995, 269, G628–646.

9120

Analytical Chemistry, Vol. 81, No. 21, November 1, 2009

and has an effect on receptors of the nervous system. Closely related to its role in coordinating the digestion process, CCK excretion induced by the intraluminal presence of digestion products of fat and protein in the small intestine also plays a major role in satiation (meal termination) and postmeal interval of satiety. Specifically, changes in CCK have been shown to trigger transmission of a satiety signal via the vagal afferent fibers which inhibit food intake.3 Due to its important role in the regulation of food intake, various studies on the mechanism of exogenous and endogenous CCK have been reported.4-11 The appetite-suppressing effect of CCK in humans was first reported by Kissileff et al.,4 who observed that the exogenous, peripheral intravenous administration of high nonphysiological doses of CCK suppressed food intake in a test meal in humans by 19%. Studies on endogenously produced CCK have also shown that CCK acts as an appetite suppressant and responds to a number of different dietary stimuli.5-7 Several studies have observed that endogenous CCK suppresses appetite, and higher concentrations of CCK produce larger appetite-suppressing effects. The satiating effect of endogenous CCK induced by intraduodenal administration of fat has been shown to be counteracted by a specific CCK receptor blocker.8 These results together indicate that CCK has an important role in the causal chain, leading to satiation or meal termination after food ingestion. Additionally, the level of CCK excretion from intestinal mucosal cells varies with ingested foods. Meals supplemented with long-chain fatty acids result in higher (3) Dockray, G. J.; Gregory, R. A.; Tracey, H. J.; Zhou, W. Y. J. Physiol. 1981, 314, 501–511. (4) Kissileff, H. R.; Pi-Sunyer, F. X.; Thornton, J.; Smith, G. P. Am. J. Clin. Nutr. 1981, 34, 154–160. (5) Wolkowitz, O. M.; Gertz, B.; Weingartner, H.; Beccaria, L.; Thompson, K.; Liddle, R. A. Biol. Psychiatry 1990, 28, 169–173. (6) French, S. J.; Murray, B.; Rumsey, R. D.; Sepple, C. P.; Read, N. W. Appetite 1993, 2, 95–104. (7) French, S. J.; Bergin, A.; Sepple, C. P.; Read, N. W.; Rovati, L. Int. J. Obes. Relat. Metab. Disord. 1994, 18, 738–741. (8) Matzinger, D.; Gutzwiller, J.; Drewe, J.; Orban, A.; Engel, R.; D’Amato, M. Am. J. Physiol. 1999, 277, R1718–1724. (9) French, S.; Conlon, C.; Mutuma, S.; Arnold, M.; Read, N.; Meijer, G.; Francis, J. Gastroenterology 2000, 119, 943–948. (10) Matzinger, D.; Degen, L.; Drewe, J.; Duebendorfer, R.; Ruckstuhl, N.; D’Amato, M. Gut 2000, 46, 688–693. (11) Hall, W. l.; Millward, D. J.; Long, S. J.; Morgan, L. M. Br. J. Nutr. 2003, 89, 239–248. 10.1021/ac9018318 CCC: $40.75  2009 American Chemical Society Published on Web 10/02/2009

CCK concentrations than do fats with short-chain fatty acids.9,10 Recently, a study showed that casein and whey proteins exert different effects on CCK.11 Collectively, these studies imply that ingredients of foods that have a high potency for releasing CCK may be used to produce foods with a higher satiating effect and indicate that CCK can be used as a biomarker for the determination of satiation. The role of circulating CCK, however, is in many instances still obscure because quantitation of the hormone in plasma is difficult. Many of the previous studies have been challenged by inadequate, nonsensitive, and nonspecific in vitro bioassays. Different assay methods have been attempted to overcome some of the challenges of quantifying CCK, which include (a) multiple molecular forms of CCK, (b) low blood concentrations of CCK, and (c) amino acid sequence similarity between CCK and gastrin.12 CCK has been identified in multiple molecular forms including an 83-amino acid peptide (CCK-83), CCK-58, CCK-33, CCK-22, and CCK-8. In several species, biologically active forms ranging in size from CCK-83 to CCK-8 have been found to exist in intestine, brain, and blood.13,14 The relative distributions of these molecules in plasma have also been shown to be species specific.15-17 All of the different CCK forms are derived from a single CCK gene followed by posttranslational or extracellular processing.18 The biologically active portion of the molecule is its amidated carboxyl terminus. However, a major complexity in developing CCK assays has been its structural similarity to gastrin. Plasma concentrations of gastrin are 20-100 times higher than CCK; as a result, slight antibody cross-reactivity with gastrin poses a substantial problem for the accurate measurement of blood concentrations of CCK.12 CCK and gastrin comprise a family of gastrointestinal peptides that share an identical carboxyl-terminal pentapeptide sequence. As a result, several strategies have been deployed to develop specific immunoassays that do not cross-react with gastrin, by generating antibodies specifically to recognize the tripeptide sequence at the amino terminus of CCK-8, which is common to all forms of CCK but is dissimilar to gastrin. In addition, the sulfation of the tyrosine residue at position seven from the carboxyl terminus of CCK is critical for biological activity. With both the amidated carboxyl terminus and O-sulfated tyrosine, the C-terminal octapeptide CCK-8 is the smallest form that retains the full range of biological activities.19-21 In this study, we specifically focused on the detection, characterization, and quantification of the sulfated form of CCK-8

that has been specifically linked to satiety.22-25 Even though multiple biological active forms of CCK are found in blood, brain, and intestine, the satiety effect of CCK in hamster and other animal species has been observed upon in vitro administration of CCK8. In addition, CCK-8 has not been previously detected in hamster plasma due to the complexity of the distribution and levels of the different CCK species. In the majority of previous reports, CCK has been quantified based on radioimmunoassay (RIA) or by ELISA based approaches. Although these approaches are highly sensitive, they only have limited specificity.26-28 In contrast, immunoprecipitation based LC-MS/MS methods have recently been successfully developed to quantify putative biomarkers due to their high specificity, sensitivity, and accuracy.29-31 In this study, CCK was cloned and sequenced and the CCK-8 peptide was isolated and identified from hamster plasma. The characterization of the isolated CCK-8 from hamster plasma using high accuracy/resolution mass spectrometric analysis confirmed its structural diversity. In order to achieve high specificity and sensitivity for the detection of low levels of CCK-8, an immunoprecipitation based LC-MS/MS method was developed for rapid antigen isolation and quantification. In addition, this method was developed to demonstrate assay specificity, sensitivity, and quantitation accuracy in the comparison of plasma samples from hamsters fed with low-fat and high-fat diets. This report describes, for the first time, the use of an immunoprecipitation based LCMS/MS for accurate quantification of the sulfated form of CCK-8 peptide in hamster plasma samples.

(12) Rehfeld, J. F. Clin. Chem. 1998, 44, 991–1001. (13) Eysselein, V. E.; Eberlein, G. A.; Schaeffer, M.; Grandt, D.; Goebell, H.; Niebel, W.; Rosenquist, G. L.; Meyer, H. E.; Reeve Jr, J. R. Am. J. Physiol. 1990, 258, G253–260. (14) Paloheimo, L. I.; Rehfeld, J. F. Clin. Chim. Acta 1994, 229, 49–65. (15) Liddle, R. A.; Goldfine, I. D.; Williams, J. A. Gastroenterology 1984, 87, 542–549. (16) Rehfeld, J. F. Scand. J. Gastroenterol. 1994, 29, 110–121. (17) Lacourse, K. A.; Friis-Hansen, L.; Samuelson, L. C.; Rehfeld, J. F. FEBS Lett. 1998, 436, 61–66. (18) Deschenes, R. J.; Haun, R. S.; Funckes, C. L.; Dixon, J. E. J. Biol. Chem. 1985, 260, 1280–1286. (19) Inui, A.; Okita, M.; Inoue, T.; Sakatani, N.; Oya, M.; Morioka, H.; Oimomi, M.; Baba, S. Am. J. Physiol. 1989, 257, 946–951. (20) Hirosue, Y.; Inui, A.; Teranishi, A.; Miura, M.; Nakajima, M.; Okita, M.; Nakajima, Y.; Himori, N.; Baba, S.; Kasuga, M. Am. J. Physiol. 1993, 265, 481–486. (21) Marley, P. D.; Rehfeld, J. F.; Emson, P. C. J. Neurochem. 1984, 42, 1523– 1535.

(22) Chandler, P. C.; Wauford, P. K.; Oswald, K. D.; Maldonado, C. R.; Hagan, M. M. Peptides 2004, 25, 299–306. (23) Little, T. J.; Feltrin, K. L.; Horowitz, M.; Meyer, J. H.; Wishart, J.; Chapman, I. M.; Feinle-Bisset, C. Am. J. Physiol. 2008, 294, R45–R51. (24) Blevins, J. E.; Morton, G. J.; Williams, D. L.; Caldwell, D. W.; Bastian, L. S.; Wisse, B. E.; Schwartz, M. W.; Baskin, D. G. Am. J. Physiol. 2009, 296, R476–R484. (25) Vishnuvardhan, D.; Beinfeld, M. C. Biochemistry 2000, 39, 13825–13830. (26) Andren, P. E.; Caprioli, R. M. Brain Res. 1999, 845, 123–129. (27) Anari, M. R.; Bakhtiar, R.; Zhu, B.; Huskey, S.; Franklin, R. B.; Evans, D. C. Anal. Chem. 2002, 74 (16), 4136–4144. (28) Chen, Z.; Linse, K. D.; Taub-Montemayor, T. E.; Rankin, M. A. Insect Biochem. Mol. Biol. 2007, 37, 799–807. (29) Berna, M.; Ott, L.; Engle, S.; Watson, D.; Solter, P.; Ackermann, B. Anal. Chem. 2008, 80, 561–566. (30) Berna, M. J.; Zhen, Y.; Watson, D. E.; Hale, J. E.; Ackermann, B. Anal. Chem. 2007, 79, 4199–4205. (31) Ciccimaro, E.; Hanks, S. K.; Yu, K. H.; Blair, I. A. Anal. Chem. 2009, 81, 3304–3313.

EXPERIMENTAL SECTION Materials. Standard peptide, sulfated-tyrosine CCK-8 (DYMGWMDF) octapeptide was purchased from Sigma-Aldrich (St. Louis, MO). Stable isotope-labeled sulfated-tyrosine CCK-8 was synthesized by Thermo Fisher Scientific (Ulm, Germany). The following reagents were purchased from the specified companies. Formic acid (FA) 96% and ammonium formate were purchased from Fisher Scientific (Pittsburgh, PA). EDTA (0.5 M, pH 8), sodium chloride (5 M), Tris-HCl buffer (1 M, pH 8), PBS, pH 7.8, and a protein-G immunoprecipitation kit were obtained from Sigma-Aldrich. Purified rabbit anti-IgG monoclonal CCKantibodies was purchased from Phoenix Pharmaceuticals Inc., (Belmont, CA). HPLC-grade acetonitrile (ACN) and methanol was purchased from J.T. Baker (Phillipsburg, NJ). For all analyses, Milli-Q (Millipore, Billerica, MA) deionized water was used.

Analytical Chemistry, Vol. 81, No. 21, November 1, 2009

9121

Table 1. Primers for Cloning and Sequencing #

sequence 5′f3′

direction

name

1 2 3 4 5 6 7

TGGAACTCGCCAAGCCAGC TACATCCAGCAGGTCCGCAAAG GACTACATGGGCTGGATGGATTT CACATTGGGGACTTAATAAATA AAGGAAATCTCTTTAATAGCAT CTTTGCGGACCTGCTGGATGTAT TTCTCGAGTTTTTTTTTTTTT

forward forward forward reverse reverse reverse reverse

CCF1 CCF3 CCF4 CCR1 CCR3 CCR4 XIT

Cloning and Sequencing of CCK. Total RNA was isolated from hamster hypothalamus tissue using the TRIzol Plus RNA Purification Kit (Invitrogen, Carlsbad, CA). This kit utilizes TRIzol and a silica spin column. The manufacturers’ protocol was followed with these exceptions: approximately 0.2 g of hypothalamus tissue was ground in liquid nitrogen to a powder and added to 1 mL of TRIzol in a 1.7 mL microfuge tube. Total RNA concentration was measured spectrophotometrically and by gel electrophoresis with staining by ethidium bromide. Reverse transcriptase-polymerase chain reaction (RT-PCR) was performed on total RNA using an RNA PCR kit (Applied Biosystems, Foster City, CA) according to the manufacturer’s protocol with the following modifications: purified total RNA was reverse transcribed for 1 h at 42 °C using an oligo dT primer containing an XhoI recognition site followed by 5 min at 99 °C to inactivate the reverse transcriptase.32 The cDNA mixture was used for PCR amplification with the following regime: an initial denaturation at 95 °C for 4 min and then 30 cycles of denaturation at 94 °C for 30 s, annealing at 49 or 50 °C for 1 min, and extension at 72 °C for 30 s. An extension at 72 °C for 1 min was performed after all cycles were complete. Primers were designed based on areas of conservation between the rat, mouse, and human nucleotide sequences of the cDNAs of cholecystokinin mRNAs (Table 1). Sequences were aligned using the alignment program Clustal X 2.0.33 Where divergent nucleotides occurred, the mouse sequence was used. PCR was performed using various primer combinations, and the best candidate PCR products were used for direct sequencing. PfuUltra high fidelity DNA polymerase (Stratagene, La Jolla, CA) was used as per the manufacturers’ protocols according to the above temperature regime for all PCR reactions except for the initial primer test. In this case, iQSYBR Green Supermix (Bio-Rad, Hercules, CA) was used with the same temperature regime. One principal PCR product of approximately 600 base pairs (bp), CCF1/CCR3, was sequenced by Elim Biopharmaceuticals, Inc. (Hayward, CA). To obtain the best sequence possible, PCR products resulting from amplification with CCF1 and CCR3 were cloned and sequenced. The CCF1/CCR3 PCR product was gel purified using a Spin-X column (Costar, Cambridge, MA), tailed,34 and then ligated and cloned into the PCR2.1vector using the Original TA Cloning Kit (Invitrogen) according to the manufacturers’ protocol. Two clones were chosen for sequencing. The inserts contained in these clones, pCC4 and pCC6, were also sequenced (32) Bartley, G. E.; Ishida, B. K. Plant Mol. Biol. Rep. 2002, 20, 115–130. (33) Thompson, J. D.; Gibson, T. J.; Plewniak, F.; Jeanmougin, F.; Higgins, D. G. Nucleic Acids Res. 1997, 25, 4876–4882. (34) Farrell, R. E., Ed. RNA Methodologies, A laboratory guide for isolation and characterization, 3rd ed.; Elsevier Academic Press: Burlington, MA, 2005; p 484.

9122

Analytical Chemistry, Vol. 81, No. 21, November 1, 2009

and compared to the sequence of other CCK species. Sequences of the primers used for cloning are not included in the submitted mRNA sequence because this may not be the exact endogenous mRNA sequence. Standard primers, M13 Reverse and M13 Forward -20, with sequences contained in the vector were also used for sequencing. There was one nucleotide difference contained in the primer sequence CCF1 between the two clones. CCK sequences were retrieved from GenBank database (http://www.ncbi.nlm.nih.gov/Genbank) for primer design and alignments as follows: hamster (Mesocricetus auratus) GQ916946, mouse (Mus musculus) NM_031161, human (Homo sapiens) NM_000729, and rat (Rattus norvegicus) NM_012829. The program BLAST was used with default settings to determine similarity of peptide sequences.35 Hamster Study Design. Male Syrian Golden hamsters with a starting body weight of approximately 80 g (LVG strain, Charles River, Wilmington, MA) were acclimatized and fed commercial rodent chow (Ralston Purina, St. Louis, MO) and water ad libitum for 7 days. The animals were housed individually in wire-bottom cages in an environmentally controlled room maintained at 20-22 °C and 60% relative humidity. A 12 h alternating light-dark cycle was maintained. The animal experimental protocols for this study were approved by the Western Regional Research Center (WRRC) Animal Care and Use Committee, USDA, Albany, CA. After the acclimatization, hamsters were fasted for 12 h and randomized into three diet groups of five hamsters each, one “control” group and two “treatment” groups (low fat and high fat), respectively. The control group was sacrificed directly after fasting. The two treatment groups were fed by gavage (one time only) with a 5% low-fat diet or a 30% high-fat diet. Two hours after feeding, the experimental low-fat and high-fat diet hamsters were sacrificed and blood samples were collected by cardiac puncture into EDTA, centrifuged at 2000g for 30 min at 4 °C and kept at -80 °C until analysis. Plasma samples were thawed in the presence of a cocktail of dipeptide peptidase IV inhibitors (aprotinin (0.04 mg/mL), EDTA (25 mg/mL), isoleucine-prolineisoleucine (IPI) (1 mM), bacitracin (0.4 mg/mL), streptomycin sulfate (0.2 mg/mL), phenylmethylsulphonyl fluoride (PMSF) (0.5 mg/mL), and chloramphenicol (2 mg/mL)) at a volume ratio of 10/1. Sample Preparation. To facilitate LC-MS/MS and optimize sensitivity, a stable isotope-labeled (SIL) CCK-8 DY(SO3H)MGWMDF[U13C9N15] was prepared by a solid-phase peptide synthesis. The presence of 13C915N stable isotope tagged peptide ensured that identical chromatographic retention and matrix ionization efficiency effects were achieved for both internal standard and analyte, thereby minimizing any quantitation variability.36 The 0.5 ng/mL SIL standard was prepared by spiking 7.5 µL of a 60 ng/mL solution into 900 µL of hamster plasma. CCK-8 was used to prepare standard samples, which were analyzed with each analytical set at 0.025, 0.050, 0.10, 0.25, 0.50, 1.0, 2.5, and 3.0 ng/mL. A CCK-8 standard at 0.01 ng/ mL was also analyzed to demonstrate an instrumental lower limit of detection. All samples were spiked with SIL standard to have an identical final known concentration of 0.5 ng/mL. Validation (QC) samples were prepared to evaluate accuracy (35) Altschul, S. F.; Gish, W.; Miller, W.; Myers, E. W.; Lipman, D. J. J. Mol. Biol. 1990, 215, 403–410. (36) Zhang, R.; Regnier, F. E. J. Proteome Res. 2002, 1, 139–147.

and precision at 0.05, 0.5, and 2.5 ng/mL using the same procedure used to prepare the standard samples. Double blank (immunodepleted CCK-8 and no SIL) samples were analyzed with each set of standard samples to verify the assay selectivity in each of the multiple reaction monitoring (MRM) transitions. Immunoprecipitation. The protein-G immunoprecipitation procedure was conducted as described by the manufacturer Sigma-Aldrich. Approximately 500 µL of hamster plasma (EDTA plasma) was combined with approximately 5 µg of purified antiIgG monoclonal CCK-antibodies and incubated overnight at 4 °C, mixing the sample by inversion. Protein-G-Agarose beads (30 µL suspension) were washed twice with 1.0 mL of buffer (PBS, pH 7.8) by gently vortexing and spinning in a microcentrifuge at 12 000g for 30 s. Following the last wash, 50 µL of fresh PBS buffer was added to the beads. After incubation, the Protein-G beads (50 µL suspension) were transferred to the hamster plasma containing the anti-CCK monoclonal antibodies and incubated for 2 h at 4 °C for binding under gentle inversion. The plasma was removed carefully by centrifuging at 12 000g for approximately 20 s at 4 °C in a spin column. The removal of nonspecific binding was accomplished by resuspending the beads in 700 µL of PBS buffer, washing, and centrifuging the spin column at 12 000g for 15 to 30 s at 4 °C five times. After that, the precipitated peptides were eluted with 50 µL of methanol containing 0.5% formic acid for 15 min under vortexing and centrifuged at 12 000g for 30 s at 4 °C. The supernatant containing the peptides was transferred into a clean microfuge tube for MS analysis. Mass Spectrometric Conditions for Identification of CCK8. Mass spectrometry identification experiments were performed on a Finnigan LTQ-FT Linear Ion Trap-Fourier transform ion cyclotron resonance (7 T FTICR) mass spectrometer (Thermo Electron, Bremen, Germany). Gas-phase ions were generated from the sample solution using an Advion Triversa Nanomate chip based nanospray system (Advion Biosciences Inc., Ithaca, NY), operated in the positive ion mode. Nanospray ionization was initiated by applying a +1.4 to +1.7 kV voltage to the sample solution, and a stable spray was maintained through the application of a 0.30 psi nitrogen pressure to the sample solution. Full scan mass spectra were acquired on the FTICR operating at 100 000 resolution (fwhm). MS and MS/MS spectra were acquired with and without in-source CID (SID) over a range of 70-100 V. MS/MS spectra were obtained by isolating the precursor ion of interest and performing CID in the linear ion trap followed by detection of the resulting fragment ions in the FTICR. Collision conditions for these MS/MS spectra were optimized over a range of 20-30 V to obtain the best sequence coverage. Disposable conductive pipet tips were used throughout all experiments. After each measurement, the pipet tip was ejected and a fresh tip and nozzle was used for the next experiment to avoid any sample carryover. Chromatographic and Mass Spectrometry Conditions. Chromatography was performed by gradient elution from a Hypersil GOLD column (Thermo Scientific, Waltham, MA) at ambient temperature with column dimensions of 50 × 2.1 mm and a 1.9 µm particle size on a Symbiosis Pharma system (Spark Holland, Emmen, Netherlands). The LC column was equilibrated using 85% mobile phase A (water with 0.01% formic acid) and 15%

mobile phase B (90:10 acetonitrile/water + 0.01% formic acid) at a flow rate of 250 µL/min for 8 min. The samples were injected using a partial loop fill injection mode and a 25 µL injection volume. Elution was performed at a flow rate of 250 µL/min initially in a linear gradient over 6 min ranging from 15% to 50% mobile phase B. At the end of this gradient, an isocratic elution was applied for 3 min with 50% mobile phase B. A final isocratic elution was applied at 100% mobile phase B. The column was then re-equilibrated before the next injection as described above. Between each injection, a regimen of autosampler needle washes (methanol, 50:50 methanol/water + 0.1% formic acid, and water) was used to minimize sample carryover. A switching valve (Valco Instruments Company Inc., Houston, TX) was used to divert the solvent flow to waste outside of the retention time of the analyte. Negative-ion electrospray ionization (ESI) was performed on an API 5000 triple quadrupole mass spectrometer (Applied Biosystems, Foster City, CA) with a TurboIonSpray source. Analyst version 1.4.2 (Applied Biosystems, Foster City, CA) was used as the mass spectrometric data system for all analyses. The resolution of the Q1 and Q3 quadrupoles were set at unit and low, respectively, to enhance sensitivity and enable effective quantitation at the analyte concentrations of interest. Multiple reaction monitoring (MRM) transitions were observed at Q1/Q3 570.4/439.0 for CCK8 and Q1/Q3 575.3/439.0 for the SIL. Instrumental parameters for mass spectral acquisition were as follows: curtain gas (CUR) was set at 10, ion source gas 1 (GS1) was 40, ion source gas 2 (GS2) was 55, ion transfer voltage (IS) was -4200 V, temperature (TEM) was 550 °C, interface heater (ihe) was on, collision gas (CAD) was 8, declustering potential (DP) was -65 V, and entrance potential (EP) was -10 V. Unique settings for CCK8 included a dwell time of 200 ms, a collision energy (CE) of -28 V, and a cell exit potential (CXP) of -29 V, as determined during quantitative optimization by direct infusion into the mass spectrometer. These settings for the SIL were 100 ms, -30 V, and -35 V, respectively. Validation Experiments. The accuracy and precision of the assay to measure CCK-8 was evaluated on each of 4 days by analyzing five replicates at three concentration levels (0.05, 0.5, and 2.5 ng/mL). Each validation sample set was bracketed by duplicate standard sets which spanned the dynamic range of 0.025-3.0 ng/mL. Assay intraday and interday accuracy (percent relative error, % RE) and precision (percent coefficient of variation, % CV) were calculated and are presented in Table 2. Because of endogenous CCK-8 in hamster plasma, immunodepleted hamster plasma was used as the control matrix to measure assay selectivity. Two different lots of hamster plasma were pooled and immunodepleted, this was followed by immunoprecipitation and subsequent LC-MS/MS analyses. In addition, analyte carryover was evaluated by analyzing solvent blanks immediately following the highest standard sample. The percent absolute carryover and selectivity of the method were calculated as a percent relative to the low (0.05 ng/mL) recovery level. These results are presented in the Results and Discussion section. CCK-8 and SIL stock solutions were prepared in 70:30 HPLC water/acetonitrile (v/v) and stored at approximately -80 °C when not in use. The stability of the stock solutions was evaluated over different time intervals by comparing the results obtained to the Analytical Chemistry, Vol. 81, No. 21, November 1, 2009

9123

Table 2. Intra- and Interday Validation Statistics for CCK-8 Spiked into Hamster Plasma validation sample concn (ng/mL) day 1

2

3

4

all (1-4)

statistic mean (ng/mL) accuracy (% RE) precision (% CV) n mean (ng/mL) accuracy (% RE) precision (% CV) n mean (ng/mL) accuracy (% RE) precision (% CV) n mean (ng/mL) accuracy (% RE) precision (% CV) n mean (ng/mL) accuracy (% RE) precision (% CV) n

0.05 0.055a 9.6 25.9 5 0.062 24.4 21.8 5 0.055 9.2 21.3 5 0.060 20.4 23.0 5 0.058 15.9 22.0 20

0.50 0.570 14.0 5.8 5 0.514 2.8 3.7 5 0.513 2.6 13.0 5 0.592 18.4 9.8 5 0.547 9.5 10.4 20

2.5 2.839 13.6 10.9 5 2.597 3.9 12.4 5 2.788 11.5 6.9 5 2.644 5.8 9.3 5 2.717 8.7 9.9 20

all (0.05-2.5) 12.4 15.2 15 10.4 17.4 15 7.8 14.3 15 14.9 15.8 15 11.3 15.5 60

a Values have been rounded to show significant digits; statistical calculations have been done with full precision.

initial mean values obtained after fresh preparation of the stock solutions. Room temperature matrix stability was evaluated in hamster plasma over periods of 4 and 24 h. Three aliquots of hamster plasma were supplemented with 0.5 ng/mL SIL CCK-8 and incubated for 0, 4, and 24 h at room temperature. Following incubations, the stability samples were immunoprecipitated and analyzed by LC-MS/MS. Room-temperature stability was evaluated by comparing the incubated samples to freshly prepared samples. Room temperature stability in immunoprecipitated samples and calibration standard solutions were assessed by injecting a full set of calibration standards both before and after each group of validation samples. An identical response in the reinjected standards indicates the presence of stability over the course of LC-MS/MS analysis. Calibration curves were obtained by plotting the peak area ratio of CCK-8 to its internal standard versus concentration. A weighted (1/concentration) least-squares regression was used to obtain a linear equation over the range of the calibration graph. For the standard curve calculations, the equation was not forced through the origin. RESULTS AND DISCUSSION CCK8 Immunoprecipitation and MS Characterization. Endogenous CCK-8 has not previously been identified in hamster plasma. Therefore, a highly specific immunoprecipitation followed by MS analysis for identification and characterization of endogenous CCK-8 was developed. Total CCK was immunoprecipitated from crude hamster plasma samples using an anti-CCK monoclonal antibody. Thus, peptides were affinity purified and concentrated prior to MS analysis. The present immnoprecipitation-MS assay enabled the identification of CCK-8. Figure 1A shows the (+)chipESI-FTICR mass spectrum of the purified immunoprecipitant. The LTQ-FT mass spectrum revealed the presence of a major component producing an [M + H]+ adduct ion at m/z 9124

Analytical Chemistry, Vol. 81, No. 21, November 1, 2009

Figure 1. (A) Product ion spectrum of the immunoaffinity-purified CCK-8 peptide by (+)chipESI-FTICR mass spectrum. (B) Product ion spectrum of the CCK-8 peptide presented indicating predominant y and b ions. The spectrum was obtained at low collision energy to verify the identity of the peptide.

1143.36 and a sodiated adduct [M + Na]+ at m/z 1165.40. The measured mass for the protonated adduct at m/z 1143.36 was within 0.001% of the calculated precursor mass theoretical [M + H]+ at m/z 1143.3585. The 1143.36 m/z CCK-8 peptide ion mass was further sequenced for confirmation. Manual interpretation of the full scan MS and CID MSn spectra of all observed precursor charge states revealed the following sequence Asp-Tyr(SO3H)-Met-Gly-TrpMet-Asp-Phe-NH2 (Figure 1B). Every amino acid residue was confirmed by, at a minimum, either a y or b fragment ion (Table 3). The y ion series observed was generated from the peptide containing the sulfated tyrosine, and the b ion series were generated from the fragment ions after the sulfate was removed. Interestingly, this peptide contains two isobaric fragment ions “y6ion” at m/z 785.31 and a “b6-M + 1 isotope ion” at m/z 784.28. These could be differentiated even though the isotopes of these two fragment ions overlap using the combination of the nanochipESI (NanoMate) and infusion and the FTICR to provide improved signal-to-noise and high resolution, respectively. Figure 1B illustrates the high resolution observed with the inset. Thus, the assignments of the peptide fragment ions were achieved with high confidence. Because the nucleotide sequence information of the hamster cholecystokinin was not available, the PCR based methods described were used to clone the hamster cholecystokinin using

Table 3. Theoretical and Observed Fragment Ions from Collision Induced Dissociation (CID) of CCK-8a ion charge

D

y ions (+1) y-H2O ions b ions (+1) b-H2O ions a

Y

M

G

W

M

D

F

1028.34 1028.37 1010.33 1010.36 279.10

785.31 785.31 767.30 767.30 410.14

654.27 654.27 636.26

597.25 597.25 579.24

411.17

280.13

165.10

393.16

262.12

467.16 467.16 449.15

653.24 653.24 635.23 635.23

784.28 784.28 766.27 766.27

899.31 899.31 881.30 881.30

261.09

392.13

Bold: observed ions.

Figure 2. Nucleotide sequence encoding CCK from Syrian Golden hamsters (Mesocricetus auratus) and the deduced amino acid sequence of the precursor polypeptide, and the comparison CCK precursor with other mice, rat, and human precursors. (A) Nucleotides are numbered from the 5′ end of the sequence shown with the derived amino acid sequence. (B) Amino acid sequence alignment showing posttranslational modification conversation (* indicate the high conservation). The arrows indicate the highly conserved proteolytic sites that result in the multiple forms of CCK. GeneBank accessions: hamster (Mesocricetus auratus) GQ916946, mouse (Mus musculus) NM_031161, rat (Rattus norvegicus) NM_012829, and human (Homo sapiens) NM_000729.

the hamster hypothalamus tissue mRNA. The nucleotide and deduced amino acid sequences of hamster cholecystokinin are shown in Figure 2A. The clone was found to have an open reading frame that encodes a polypeptide composed of 116 amino acids, including the mature CCK sequences. The structural organization of cholecystokinin amino acid sequences from hamster is quite similar to other species which exhibit 86%, 84%, and 78% identities with mouse, rat, and human cholecystokinin, respectively. In addition, the proteolytic sites that comprise the multiple molecular forms of cholecystokinin are also conserved (see arrows in Figure 2B). More importantly, CCK-8 is highly conserved, which encodes the deduced amino acids, DYMGWMDF at the C-terminal region

of cholecystokinin. The biologically active portion of the CCK-8 peptide is its amidated carboxyl terminus with sulfation of the tyrosine residue at position seven from the carboxyl terminus of CCK. Method Development. Multiple molecular forms of CCK have been observed for both basal and postprandial levels, this presents a selectivity and sensitivity issue with either ELISA or RIA based assays. In addition, the similarity in amino acid sequence between CCK and gastrin can result in antibody cross-reactivity, making it difficult to accurately measure the concentrations of CCK-8 within plasma with the current immunobased approaches. This led to the decision to develop a method for quantitative determiAnalytical Chemistry, Vol. 81, No. 21, November 1, 2009

9125

Figure 3. (A) MRM chromatogram obtained from the analysis of hamster plasma spiked with CCK-8 at 0.05 ng/mL. CCK-8 peptide was monitored at the MRM transition m/z 570.4 to 439.0 (left) and the stable isotope-labeled version of CCK-8 at m/z 575.3 to 439.4 (right). (B) Hamster plasma sample spiked with 0.5 ng/mL of CCK-8 and CCK-8 SIL. (C) A typical standard curve for CCK-8 determination over the range 0.025-3.0 ng/mL.

nation of the biologically active form of CCK-8 in hamster plasma by immunoprecipitation followed by LC-MS/MS analyses. Although CCK-8 provides better overall fragmentation in the positive mode with the singly charged ion, we took advantage of the negative charge of the sulfate group for quantification because this reduced the overall sample complexity with only a few analytes ionizing in the negative ion mode. Using this method, the recovery of CCK-8 was affected by several factors including immunoprecipitation, chromatography, and ionization. However, through the use of a stable isotope labeled internal standard spiked in plasma before immunoprecipitation, differences originating from each of the above factors were normalized. The absolute recovery, which includes all of these factors, was estimated by comparing the average peak area for CCK-8 SIL observed in all calibration standards to the average peak area for CCK-8 SIL observed in all recovery samples through the study. The absolute recovery was determined to be approximately 53%. The use of a stable isotope labeled internal standard in the preparation of calibration standards and in samples before immunoprecipitation, provides a direct means to quantitate CCK-8 in hamster plasma samples in light of these common procedural losses. Assay Validation. The assay was observed to be linear over the range of 0.025-3.0 ng/mL for CCK-8 in hamster plasma. The validation results for intraday and interday accuracy and precision are presented in Table 2. The assay accuracy (% RE) average was 11.3% with a precision (% CV) of 15.5% over all samples in this 4 9126

Analytical Chemistry, Vol. 81, No. 21, November 1, 2009

day period. Representative MRM chromatograms obtained from the analysis of a standard sample of CCK-8 with its spiked internal standard and of a blank sample are presented in Figure 3. The assay selectivity was measured as demonstrated in Figure 4A,B by analyzing the immunodepleted plasma spiked with SIL and double blank (immunodepleted plasma with no SIL). The background in the blank run at the retention time of CCK8 was found to be 2.8% of the LLOQ. On the basis of the LC-MS/MS data, it was concluded that the assay can differentiate and quantitate CCK-8 from other putative plasma components. The presence of endogenous CCK-8 in the plasma obtained from healthy hamsters complicated the preparation of standard samples for the overall validation of the assay. Consequently, in order to develop a validation study, plasma from 10 different hamsters were pooled and prepared according to the immunoprecipitation method described above. The endogenous CCK-8 basal level measured in the hamster plasma as depicted in Figure 4C was found to be 0.30 ng/mL. A response above the instrumental limit of quantitation (S/N 10:1) was observed on a 0.025 ng/mL CCK-8 standard, supporting its use as the low calibration standard. Three fortification levels were examined for the purposes of this validation assay: 0.05, 0.50, and 2.5 ng/mL. Absolute carryover present in a blank sample that followed the high (3.0 ng/mL) standard was found to be approximately 1%. This translates to approximately 10% of the peak response found in low (0.05 ng/mL) recovery samples. To further mitigate any carryover

Figure 4. MRM chromatograms obtained from the analysis of (A) double blank (immunodepleted CCK8 plasma + no SIL); (B) single blank (immunodepleted plasma + SIL); and (C) CCK-8 basal level with spiked SIL at 0.5 ng/mL.

effects, solvent blanks were placed throughout the set to separate samples of analytical interest. Analyte stability in solution and in hamster plasma was also studied during method development. The synthetic peptide CCK-8 was found to be stable in 70:30 water/acetonitrile (v/v) for at least 6 months when the solution was stored at -20 °C. Roomtemperature stability was also evaluated in hamster plasma, and CCK-8 was found to have an approximate 40% loss after 4 h. The CCK-8 stability test resulted in a 95% loss after 24 h at roomtemperature compared to freshly prepared samples. These effects are negated by the use of the SIL as an internal standard. However, on the basis of the above observations, the LC-MS/MS analysis should be done within 4 h. Significant differences were not observed when standards were injected both before and after the analysis of a sample set which ensured that the analyte is stable in the injection solvent for at least the duration of the LC-MS/ MS assay. Low-Fat and High-Fat Fed Hamster Study. To determine changes of the CCK-8 levels induced by different diets compared to background levels, the plasma CCK-8 levels were measured from hamsters gavaged with either a high-fat or a low-fat diet. Instead of regular ad lib feeding, food was introduced by gavage to ensure accurate dosing, due to the irregular feeding habits of hamsters after fasting. This approach allowed us to measure CCK-8 response to food intake more accurately. The concentration of CCK-8 was measured following fasting and 2 h after gavages with either a 5% low-fat diet or a 30% high-fat diet. The treatment group fed a 30% high-fat diet demonstrated a significant increase (p < 0.05) in CCK-8 (1023 ± 106 pg/mL) relative to both the control

Figure 5. CCK-8 concentrations in hamster plasma samples following fasting and 2 h after gavages with either a 5% low-fat or a 30% high-fat diet. Diet groups with different letters (a, b, or c) are significantly different (p < 0.05).

group (170 ± 17 pg/mL) and the 5% low-fat diet (302 ± 48 pg/ mL); see Figure 5. In addition, statistically significant difference of the CCK-8 levels was also observed between the control and 5% low-fat diet groups. These observations are consistent with the role of CCK8 in mediating fat-induced satiety signal.37 Furthermore, these results suggest that the application of the described method in a hamster study demonstrates that the detection range for the CCK-8 is sufficient for the determination of the basal levels and postprandial release. These preliminary results indicate that CCK-8 levels can be measured using the assay method to evaluate the effects of different types of supplemented diets on satiety. (37) Beglinger, C.; Degen, L. Physiol. Behav. 2004, 83, 617–621.

Analytical Chemistry, Vol. 81, No. 21, November 1, 2009

9127

CONCLUSION Due to the potential for inconsistent results when using immunoaffinity based approaches alone to measure satiety biomarker peptides and due to high variability of CCK levels owing to stability, molecular heterogeneity, and low abundance issues, an immunoprecipitation based LC-MS/MS method was developed for CCK-8. With the combination of sample purification and preconcentration by means of immunoprecipitation and LC-MS/ MS analysis, it was possible to determine CCK-8 at physiological plasma concentrations. In contrast to currently available CCK assays, the active form of CCK-8 was selectively differentiated from other molecular forms of CCK. The purpose of this assay is to overcome the issues of both sensitivity and selectivity that

9128

Analytical Chemistry, Vol. 81, No. 21, November 1, 2009

complicate both ELISA and RIA assays. The assay was successfully applied to a hamster feeding study and was sufficient to measure concentrations at physiologically relevant levels. This current method for CCK-8 is adaptable to other animal models and potentially for human blood samples. ACKNOWLEDGMENT Authors express their gratitude to Debbie Schwedler and Bob Harfmann for technical assistance. Received for review August 14, 2009. Accepted September 20, 2009. AC9018318