Bioconjugate Chem. 1995, 6,502-506
502
TECHNICAL NOTES Quantitation of Triple-Helix Formation Using a Photo-Cross-LinkableAryl Azide/Biotin/OligonucleotideConjugate Daniel A. Geselowitz” and Ronald D. Neumann Department of Nuclear Medicine, Clinical Center, National Institutes of Health, Building 10/1C401, 10 Center Drive MSC 1180, Bethesda, Maryland 20892-1180. Received February 7, 1995@
DNA triple-helix formation has potential applications in gene mapping and as the basis of “antigene” pharmaceuticals; however, the methods for quantitation of triple-helix formation are limited, especially for purine(purine-pyrimidine)-basedtriplexes. We present a novel method for detection and quantitation of triple-helix formation by triple-helix-forming oligonucleotides. The oligonucleotide is conjugated to a photoactivatable cross-linker, sulfosuccinimidyl3-[[2-[6-(biotinamid0)-2-(pazidobenzamido)hexanamido]ethyl]dithio]propionate. After incubation with the target DNA, exposure to light labels the target with biotin. The labeled target can be quantified by a chemiluminescent assay. A 26-mer oligonucleotide previously reported to form a purine(purine-pyrimidine) triplex with the upstream region of the c-myc gene was studied and found to bind to its target with Kd of approximately 100 nM at 37 “C, 10 mM MgC12, pH 7.5, consistent with previous reports. This new technique can be used under a variety of conditions and in kinetic experiments and may be extendible to use in living cells.
INTRODUCTION
Triple-helix-formingoligonucleotidesare receiving considerable attention due to their potential applications in DNA mapping (1-3) and as “antigene” agents and potential pharmaceuticals (4-7). Unfortunately, the methods used to detect triple-helix formation in solution-spectrophotometry (melting curves), affinity cleavage of target DNA by conjugated agents, and gel-shift assays-all have some limitations, and none can currently be used inside a living cell. For example, melting curves are useful for studying Py(PwPy) triplexes, but the results do not translate easily into dissociation constants (8). Moreover, Pu(PwPy) triplex melting curves tend to be difficult to interpret (9, 10). Affinity-cleavage reactions generally depend on hydroxyl radical production by a pendant group and use DNA footprinting to detect partial cleavage of the target DNA, but these cleavage reactions tend to be inefficient. Gel-shift assays are limited to electrophoretic conditions and are not amenable to kinetic studies. A general method giving dissociation constants and kinetic data for triplex formation and which could be used inside a living cell would greatly enhance research in this area. Affinity photo-cross-linking technology offers a functional approach to the solution studies of the association of molecules, but has been used rarely in triplex research. Praseuth and co-workers (11) were able to cross-link a triple-helix-forming oligonucleotide conjugated to proflavin to its target, allowing a footprinting assay of the binding site. An efficient cross-linker would allow the possibility of quantitative detection of the triple-helix interaction and the possibility for use inside cells. One of us has previously reported, for example, using an oligonucleotide conjugated to the lZ5I-labeledDenny-Jaffe photo-cross-linker to detect cellular membrane and cy@
Abstract published in Advance ACS Abstracts, June 1, 1995.
toplasmic proteins associated with the conjugate after addition to the medium (12). We now report a novel technique to study the association in solution of a triple-helix-forming oligonucleotide with a duplex target using the recently developed SBED [sulfosuccinimidyl3-[[2-[6-(biotinamido)-2-(p-azidobenzamido)hexanamido]ethyl]dithio]propionate]trifunctional reagent. The aryl azides, upon photolysis, yield aryl nitrenes, relatively long-lived species ( s) which can react in a number of ways with a variety of chemical species (13-15). The oligonucleotide conjugate undergoes a photo-cross-linkingreaction tagging its target with biotin, which is easily detectable and quantifiable using a chemiluminescent assay. EXPERIMENTAL PROCEDURES
Oligonucleotide Synthesis. Oligodeoxynucleotides were prepared using the phosphoramidite methodology with commercially available reagents and synthesizer (Applied Biosystems Model 394). The n-hexylamine phosphate group at the 5’-end of the molecule was added using a commercial phosphoramidite reagent (Aminolink 2, Applied Biosystems). The oligonucleotides were precipitated twice with ethanol from 0.3 M sodium acetate and were assayed specrophotometrically. The sequences of the target DNA and the triple-helixforming and control oligonucleotides are shown in Figure 1. The target site is found in the human c-myc gene about 120 bp upstream of the P1 transcription start site. Sequence 1, which is the sequence designated as “PUGT26ap” by Durland and co-workers (161,is based on G(G-C) and T(A-T) triplets with the oligonucleotide running antiparallel to the purine-rich target strand. Sequence 2 differs from sequence 1 at four bases and is designed to serve as a poorly binding control. A third oligonucleotide, 3, of unrelated sequence was also prepared for use as a scavenger. The oligonucleotides
Not subject to U S . Copyright. Published 1995 by American Chemical Society
Bioconjugate Chem., Vol. 6,No. 4, 1995 503
Technical Notes 2180
2190
.
2200
2210
.
5'
CTCCTCCCCACCTTCCCCACCCTCCCCACCCTCCCCATAGCG... (+)strand
3'
GAGGAGGGGTGGAAGGGGTGGGAGGGGTGGGAGGGGTATTCC
. . . (-)strand
5 ' GGTTGGGGTGGGTGGGGTGGGTGGGG
sequence
5' GGTTGAGGTGGGTGGCGTGTGTGAGG
sequence 2
1
Figure 1. Sequences of target region of c-myc and targeting oligonucleotides used in this study. Sequence numbers shown refer to the numbering scheme in Genbank sequence HSMYCC.
0
O N -H
I O-P-O-[5'-Oligonucleotide] I 0Figure 2. Schematic structure of the oligonucleotide-BED conjugates. prepared are shown below, with L referring to the 5'hexylamine group:
(L)GGTTGGGGTGGGTGGGGTGGGTGGGG ( 1-L) (L)GGTTGAGGTGGGTGGCGTGTGTGAGG (2-L) AGCTTATGCTCTGATTTGAAATCAGCTG (3) Preparation of SBED Conjugate. Work with sulfosuccinimidyl3-[[2-[6-(biotinamid0)-2-@-azidobenzamido)hexanamidolethylldithiolpropionate (SBED; Pierce Chemical Co.) was performed under a red safelight. The reagent was dissolved in dimethyl sulfoxide in the dark to give a 50 mM solution. To 45 p L of a 0.50 mM solution of 1-L or 2-L in a sodium borate buffer (pH 8.5,lOO mM) was added 5.0 p L of the SBED stock solution. After 30 min, 250 p L of 0.3 M NaCl solution and 900 pL of ethanol were added, and the tube was centrifuged. The pellet was washed with 70% ethanol, air-dried and then resuspended in 100 p L of water. The conjugates of the oligonucleotides 1-L and 2-L will be designated 1-BED and 2-BED, respectively. The chemical structure of the oligonucleotide-BED conjugate is shown in Figure 2. c-myc Plasmid. A plasmid containing the 862-bp PuuII fragment (corresponding to bases 1979-2840 of Genbank sequence HSMYCC) of the human c-myc gene (MC-41)cloned into pGEM3 was obtained from Dr. Maria Zajac-Kaye. When this 6.7-kb concatameric plasmid is cut with PvuII, it yields the 2.9-kb parent and a 3.8-kb fragment consisting of the parent plasmid plus the insert. Plasmid digested with PuuII was deproteinized using a filter (Probind, Millipore), precipitated with ethanol, redissolved in water, and assayed spectrophotometrically. Photo-Cross-Linking to Triple-Helix Target. A stock solution was prepared containing 5.0 x pg1pL of the cut plasmid in 100 mM TrisHC1, pH 7.5, with 10
mM MgC12. Additionally, 10.0 mM cytidine or 10.0 pM oligonucleotide 3 was present in some experiments. Under safelight, the oligonucleotide conjugate 1-BEDor 2-BED was serially diluted into the stock solution to give five 21.6-pL samples at 1000, 320, 100, 32, and 10 nM. In separate tubes, a sample of each conjugate which had been exposed to light was also diluted to give 1000 nM or a lower concentration. The tubes were incubated in the dark at 37 "C for 1h; they were then exposed to white light from a light box for 5 min. The samples were treated with 2 pL of 50 mM D'M' and 0.5 p L of 0.5 M EDTA for 5 min at 60 "C and then with loading buffer, and half of the sample was loaded onto a 1.2% agarose1 Tris-acetate-EDTNethidium gel (11 x 14 cm) and electrophoresed. After determination of the band positions by UV transillumination, the gel was treated with denaturing buffer (0.5 M NaOH, 1.5 M NaCl), neutralizing buffer (0.5 M Tris, 1.5 M NaC1, pH 7.01, and 20x SSC for 30 min each and then capillary-blotted onto a nylon (Maximum Strength Nytran, Schleicher and Schuell) membrane. Standards prepared by dilution of the stock conjugate solution were dotted onto the lower portion of the blot, and the blot was treated with U V light (0.12 J/cm2) (Stratagene Stratalinker). The blot was then developed using a kit (New England Biolabs Phototope) involving treatment with streptavidin, a biotin-alkaline phosphatase conjugate, and AMPPD chemiluminescent substrate and then exposed to X-ray film. Densitometry. The developed films were transilluminated with a white-light box and photographed using a black-and-white video camera with a 55-mm lens. The data were digitized and analyzed on a personal computer (Macintosh IIfx) with a video capture board and image analysis software (NIH Image (17)). The spots or bands of interest were quantified by calculating the mean density of an area around the band, subtracting the mean density of an appropriate background region, and multiplying by the area. For a given exposure, a standard curve was prepared for integrated density versus quantity of conjugate in the spot. These plots were found to give smooth curves, easily interpolable from about 1 to 50 fmol. Precision was not thoroughly analyzed, but reproducibility seemed to be better than 10%. It was difficult to assess the effect on accuracy of a high background signal in the lane, but background was quite low in most of the lanes. Analyses were also done using the intensity data subjected to a log transform, and these were found to yield similar results. RESULTS
When the c-myc plasmid fragments are treated with 1-BED or 2-BED a t pH 7.5,lO mM MgC12, for 1h at 37 "C and then photolyzed, both fragments are labeled with biotin in the photo-cross-linking reaction. In Figure 3, the results of the study with 10 mM of cytidine present are shown. The results of the reaction in the absence of
Geselowitz and Neumann
504 Bioconjugafe Chem., Vol. 6, No. 4, 1995
1
2
3
5
4
7
6
8
9
10111213
-
3.8 kb -2.9 kb
I
Oligonucleotide
Figure 3. Photo-cross-linking of oligonucleotide conjugates to plasmid fragments in the absence of scavenger. Conjugate oligonucleotide 1-BED a t 1000, 316, 100, 31.6, or 10 nM (lanes 1-51 or 2-RED a t 1000, 316, 100, 31.6, or 10 nM (lanes 6-10) was pg/icL of the digested c - m y plasmid in 100 mM 'I'ris, 10 mM MgC12, and 10 mM cytidine, pH 7.5, for 1 h incubated with 5.0 x a t 37 "C, then photolyzed, and treated and electrophoresed as described. Lanes 11-13 arc controls using photo-deactivated 1-BED a t 1000 and 100 nM, and 2-RED a t 1000 nM, respectively. The 3.8-kb f r a p e n t contains the target site; the 2.9-kb fragment docs not.
1
2
3
4
5
6
7
8
9 1011121314
-
-3.8 kb 2.9 kb
Oligonucleotide Figure 4. Photo-cross-linking of oligonucleotide conjugates to plasmid fragments in the presence of scavenger. Conjugate oligonucleotide 1-BED a t 1000,316, 100, 31.6, or 10 nM (lanes 3-7) or 2-RED a t 1000, 316, 100, 31.6, or 10 nM (lanes 8-11) was p g / i t L of the digested c - m y plasmid in 100 mM 'l'ris, 10 mM MgC12, and 10 pM of oligonucleotide 3,pH incubated with 5.0 x 7.5, for 1 h a t 37 "C, then photolyzed, and treated and electrophoresed as described. Lanes 1.2, 13, and 14 are controls using photodeactivated 1-BED a t 1500 and '70 nM, and 2-RED a t I500 and 70 nM, respectively. cytidine (not shown) are almost identical to these. Note that, in lanes 1 and 2, with 1-BED a t 1000 or 316 nM, the 3.8-kb plasmid fragment, which contains the target sequence, is preferentially labeled over the 2.9-kb fragment. Quantitation suggests that the 3.8-kb plasmid band has approximately 10 fmol of biotin (there is about 8.4 fmol of plasmid in the band). However, a s the concentration of 1-BED is lowered, the relative amount of labeling of the 2.9-kb fragments increases; this is a nonspecific labeling. At 100 or 32 nM (lanes 3 and 4), the amount of nonspecific labeling actually increases over
that a t 1000 or 316 nM, and targeted labeling of the 3.8kb band is obscured. The control conjugate 2-BED shows no preferential labeling of the 3.8-kb fragment a t 1000 nM, but shows a similar nonspecific labeling of both fragments a s its concentration is lowered. The ratio of label in the oligonucleotide band to that in the plasmid fragments plainly decreases dramatically a s the concentration of conjugate is lowered. When the experiment is performed in the presence of 10 jtM of the scavenger oligonucleotide 3,the results are quite different (Figure 4). When the restriction-digested
Technical Notes
10
Bioconjugate Chem., Vol. 6,No. 4, 1995 505
1
8 '0
c
mm
..-E
6 -
C
C
0
iz
4 -
0
0' 10
3 1
1
dJ
100
1000
Concentration of Conjugate I nM
Figure 5. Amount of biotin in 3.8-kb fragment bands from Figure 4 plotted versus concentration of conjugate. The bands were quantified densitometrically from photographic film as described. The five data for 1-BED were fitted to a simple dissociation equilibrium equation, yielding values of 12.4 fmol a t 100% binding and Kd = 126 nM.
c-myc plasmid is treated with 1-BED or 2-BED and then photolyzed, virtually no labeling of the 2.9-kb fragment is seen at any of the concentrations used (lanes 3-12). However, the 3.8-kb target fragment is plainly labeled by 1-BED, with the amount of label decreasing with decreasing concentration of the conjugate (lanes 3-7). Only a low level of labeling of the 3.8-kb target is seen at all concentrations of the control conjugate, 2-BED (lanes 8-12). As before, a tendency of the deactivated conjugate to comigrate with the 3.8-kb band is observed at 1000 nM (lanes 1 and 13). Assuming the binding has reached equilibrium in 1h (16), the data can be used to estimate the triplex dissociation constant, &. The densitometrically quantified values of biotin in the 3.8-kb bands for the five concentrations studied are shown in Figure 5. When the five data for 1-BED are fitted to a simple dissociation equation, the 100%binding value is calculated to be 12.4 fmol and the & is found to be 126 nM. Each lane contains 8.4 fmol of plasmid, and it is likely that the discrepancy in the calculated 100%binding value is due to the value of 11fmol at 1000 nM being an overestimate due to the background signal in the lane; the value at 316 nM, where there is little background signal, is 8.8 fmol. The concentration of conjugate yielding one-half of this latter value is about 70 nM. The correction for backgound signal needs to be further considered to improve precision, but the value of Kd almost certainly lies in the range 70-130 nM, and we will take the value to be approximately 100 nM. DISCUSSION
Our results suggest that photo-cross-linking affinity studies using the BED conjugates will be a useful technique for solution studies of triple-helix association. The technique is reasonably fast and sensitive and requires no radioactivity. Detection of the photo-crosslinked products requires blotting of an electrophoretic gel
followed by about an hour of workup, and 1 fmol of product is detectable within 30 min of film exposure. The data are reasonably quantitative and allow the determination of binding isotherms. We find that these experiments must be done in the presence of a scavenger of the aryl nitrenes. Nonspecific labeling is a common problem with aryl azide crosslinkers, due to the relatively long lifetime and selective reactivity of the nitrene intermediates (13). Tris, which is recommended as a scavenger, plainly was ineffective at 100 mM, as was cytidine added at 10 mM. It is obvious that polynucleotides are preferred targets for the aryl nitrene, and oligonucleotide 3 made an excellent scavenger. It is crucial that any scavenger used not bind to the oligonucleotide-BED conjugate, as this would lower the effective concentration of the conjugate in solution. Duplex formation between scavenger 3 and 1-BED or 2-BED is not expected under these conditions, and the binding to the target does not appear to be affected, based on a comparison of Figures 3 and 4. The nonspecific labeling seen in the absence of scavenger (Figure 3) follows an interesting pattern, increasing roughly 10-fold to almost 1 biotin per 3.8-kb fragment as the conjugate concentration is lowered from 1000 to 100 nM, then decreasing as the concentration is further lowered. The relative amount of labeling of plasmid fragments and the conjugate itself increases as the conjugate concentration is lowered over the entire range. At the conjugate concentration of 316 nM, where a similar amount of labeling of plasmid and conjugate is seen, the plasmid represents 15 pM total nucleotide and the oligonucleotide about 8 pM total nucleotide. This suggests a bimolecular mechanism, where the conjugate reacts primarily with either another conjugate molecule or a plasmid molecule in amounts depending on the relative concentrations of target nucleotide. This is interesting as it suggests that the intramolecular reaction of the conjugate with itself is relatively insignificant under these conditions. Our results indicate that 1-BED binds to the c-myc 862-bp PuuII fragment (presumably at the target site) while 2-BED, differing in sequence at four bases, does not. This demonstrates the base selectivity of triplex binding. Our data indicate a value of approximately 100 nM for the dissociation constant of the 1-BED-target complex. This is consistent with that seen in an affinitycleavage study (16)using an oligonucleotide of sequence 1 conjugated to eosin. Those results, under similar conditions to those used here (10 mM Tris, pH 7.4, 20 mM MgC12, 37 "C), suggest that Kd is approximately 50 nM. Of course, the two experiments are not exactly comparable as the conjugate portion of the molecule may influence the binding constant. The technique described here should allow the determination of dissociation constants of triple-helix-forming oligonucleotides under a wide variety of conditions. The use of scavengers and possibly of smaller target fragments should control the nonspecific labeling. With a bright light source, the aryl azide should be depleted within seconds (23)) and kinetic experiments should require only the photolysis of samples at the desired times. Moreover, these conjugates should be useful in protein binding studies as well. We have found that these oligonucleotide-BED conjugates will readily label associated proteins, both in solution and in living cells (data not shown). We hope to develop this photo-crosslinking technique into a screening method of general utility in antisense and antigene work to study oligonucleotide-target interactions inside cultured cells.
Corrections
506 Bioconjugate Chem., Vol. 6,No. 4, 1995 LITERATURE CITED
(1) Ferrin, L. J., and Camerini-Otero, R. D. (1994) Long-range mapping of gaps and telomeres with RecA-assisted restriction endonuclease (RARE) cleavage. Nut. Genet. 6, 379-83. (2) Moser, H. E., and Dervan, P. B. (1987) Sequence-specific cleavage of double helical DNA by triple helix formation. Science (Washington, DE.) 238, 645-50. (3) Perrouault, L., Asseline, U., Rivalle, C., Thuong, N. T., Bisagni, E., Giovannangeli, C., Le Doan, T., and Helene, C. (1990) Sequence-specific artificial photo-induced endonucleases based on triple helix-forming oligonucleotides. Nature (London) 344,358-60. (4) Birg, F., Praseuth, D., Zerial, A,, Thuong, N. T., Asseline, U., Le Doan, T., and Helene, C. (1990) Inhibition of simian virus 40 DNA replication in CV-1 cells by an oligodeoxynucleotide covalently linked to an intercalating agent. Nucleic Acids Res. 18, 2901-8. (5) Postel, E. H., Flint, S. J., Kessler, D. J., and Hogan, M. E. (1991) Evidence that a triplex-forming oligodeoxyribonucleotide binds to the c-myc promoter in HeLa cells, thereby reducing c-myc mRNA levels. Proc. Natl. Acad. Sci. U.S.A. 88,8227-31. (6) Postel, E. H. (1992) Modulation of c-myc transcription by triple helix formation. Ann. N.Y. Acad. Sci. 660, 57-63. (7) Uhlmann, E., and Peyman, A. (1990) Antisense oligonucleotides: A new therapeutic principle. Chem. Rev. 90, 544-84. (8) Roberts, R. W., and Crothers, D. M. (1991) Specificity and stringency in DNA triplex formation. Proc. Natl. Acad. Sci. U.S.A. 88, 9397-401. (9) Xodo, L. E., Alunni-Fabbroni, M., Manzini, G., and Quadrifoglio, F. (1993) Sequence-specific DNA-triplex formation at
imperfect homopurine-homopyrimidine sequences within a DNA plasmid. Eur. J.Biochem. 212, 395-401. (10) Pilch, D. S., Levenson, C., and Shafer, R. H. (1991) Structure, stability, and thermodynamics of a short intermolecular purine-purine-pyrimidine triple helix. Biochemistry 30, 6081-8. (11) Praseuth, D., Le Doan, T., Chassignol, M., Decout, J. L., Habhoub, N., Lhomme, J., Thuong, N. T., and Helene, C. (1988) Sequence-targeted photosensitized reactions in nucleic acids by oligo-a-deoxynucleotides and oligo-p-deoxynucleotides covalently linked to proflavin. Biochemistry 27,30318. (12) Geselowitz, D. A., and Neckers, L. M. (1992) Analysis of oligonucleotide binding, internalization, and intracellular trafficking utilizing a novel radiolabeled cross-linker. Antisense Res. Dev. 2, 17-25. (13) Das, M., and Fox, C. F. (1979) Chemical cross-linking in biology. Annu. Rev. Biophys. Bioeng. 8, 165-93. (14) Peters, K., and Richard, F. M. (1977) Chemical crosslinking reagents and problems in studies of membrane structure. Annu. Rev. Biochem. 46, 523-51. (15) Knowles, J. R. (1972) Photogenerated reagents for biological receptor-site labeling. Acc. Chem. Res. 5, 155-60. (16) Durland, R. H., Kessler, D. J., Gunnell, S., Duvic, M., Pettitt, B. M., and Hogan, M. E. (1991) Binding of triple helix forming oligonucleotides to sites in gene promoters. Biochemistry 30, 9246-55. (17) Rasband, W., NIH Image 1.55, National Institutes of Health, Bethesda, MD. BC9500204
CORRECTIONS Volume 6, Number 2, MarcWApril 1995.
Julie B. Stimmel, Marie Frederick C. Kull, Jr."
E. Stockstill, and
YTTRIUM-90 CHELATION PROPERTIES OF TETRAAZATETRAACETIC ACID MACROCYCLES, DIETHYLENETRIAMINEPENTAACETIC ACID ANALOGUES, AND A NOVEL TERPYRIDINE ACYCLIC CHELATOR Page 221. In the Experimental Procedures under Radiolabeling Efficiency and Duration of Yttrium-90 Chelation, the concentrations of chelator stock and yttrium-90 stock should be micromolar. Under Dissociation of Yttrium-90-labeled Chelators a t pH 2.0, the concentration of yttrium-90 stock was 400 pM. Page 222. In Figure 2, the text in the legend should state that the yttrium-90 concentration was 200 pM and the final volume of chelation was 10 pL. Page 223. The legend for Figure 3 should state that the final concentration of chelator was 67 pM. BC950185C
