Quantitative Proteome Analyses Identify PrfA-Responsive Proteins

Article pubs.acs.org/jpr

Quantitative Proteome Analyses Identify PrfA-Responsive Proteins and Phosphoproteins in Listeria monocytogenes Sandeep Kumar Misra,†,‡,○ Francine Moussan Désirée Aké,†,‡ Zongfu Wu,§,∥,⊥,∇ Eliane Milohanic,†,‡ Thanh Nguyen Cao,†,‡ Pascale Cossart,§,∥,⊥ Josef Deutscher,†,‡,# Véronique Monnet,†,‡ Cristel Archambaud,§,∥,⊥,◆ and Céline Henry*,†,‡ †

INRA, UMR 1319 Micalis, F-78350 Jouy-en-Josas, France AgroParisTech, UMR 1319 Micalis, F-78350 Jouy-en-Josas, France § Unité des Interactions Bactéries-Cellules, Institut Pasteur, Paris F-75015, France ∥ INSERM, U604, Paris F-75015, France ⊥ INRA, USC2020, Paris F-75015, France # Expression Génétique Microbienne, Institut de Biologie Physico-Chimique, CNRS, FRE3630, 75005 Paris, France ‡

S Supporting Information *

ABSTRACT: Protein phosphorylation is a major mechanism of signal transduction in bacteria. Here, we analyzed the proteome and phosphoproteome of a wild-type strain of the food-borne pathogen Listeria monocytogenes that was grown in either chemically defined medium or rich medium containing glucose. We then compared these results with those obtained from an isogenic prfA* mutant that produced a constitutively active form of PrfA, the main transcriptional activator of virulence genes. In the prfA* mutant grown in rich medium, we identified 256 peptides that were phosphorylated on serine (S), threonine (T), or tyrosine (Y) residues, with a S/T/Y ratio of 155:75:12. Strikingly, we detected five novel phosphosites on the virulence protein ActA. This protein was known to be phosphorylated by a cellular kinase in the infected host, but phosphorylation by a listerial kinase had not previously been reported. Unexpectedly, SILAC experiments with the prfA* mutant grown in chemically defined medium revealed that, in addition to previously described PrfA-regulated proteins, several other proteins were significantly overproduced, among them were several proteins involved in purine biosynthesis. This work provides new information for our understanding of the correlation among protein phosphorylation, virulence mechanisms, and carbon metabolism. KEYWORDS: Listeria monocytogenes, virulence, phosphoproteomic, proteomic

■

INTRODUCTION Protein phosphorylation is one of the most important posttranslational modifications in living organisms, including bacteria.1,2 Over the past decade, numerous phosphoproteome studies have enabled the identification of protein kinases and phosphatases as well as the elucidation of molecular signaling and regulatory mechanisms in bacteria.3 Interestingly, a correlation has recently been established between bacterial pathogenicity and protein phosphorylation on serine (S), threonine (T), and tyrosine (Y).4 Pathogens, such as Helicobacter pylori, contain a large number of tyrosine- and multiply phosphorylated proteins; several of them are involved in pathogen−host interactions5 Listeria monocytogenes is a Gram-positive soil bacterium, but it is also a facultative intracellular pathogen that causes listeriosis, a severe food-borne disease. L. monocytogenes is a model organism in infection biology.6,7 After infecting a © 2014 American Chemical Society

susceptible host, it is able to adapt to hostile environments through multiple cascades of regulation in order to enhance its survival and replication within host cells.8,9 Indeed, L. monocytogenes possesses a large number of signal transduction systems that are based on reversible phosphorylation; these allow the pathogen to survive and grow under the various conditions that are encountered in the host and the environment.10 Sequence analysis of the L. monocytogenes genome has revealed the presence of 16 histidine kinases of two-component systems, 9 eukaryotic-like protein kinases and phosphatases, and 29 phosphoenolpyruvate carbohydrate phosphotransferase systems (PTSs).11,12 To date, much research has focused on the proteins involved in the internalization of L. monocytogenes by host cells, phagosomal Received: September 5, 2014 Published: October 23, 2014 6046

dx.doi.org/10.1021/pr500929u | J. Proteome Res. 2014, 13, 6046−6057

Journal of Proteome Research

Article

wild-type strains and 117 new phosphoproteins found only in the mutant strain, including the well-known virulence factor ActA. Interestingly, this is the first study to report the phosphorylation of ActA by listerial protein kinases, as this protein was previously only known to be phosphorylated by a host kinase. In order to quantify the differences between the proteomes and phosphoproteomes of the wild-type and prfA* mutant, we used an approach that involved stable isotope labeling by amino acids in cell culture (SILAC).40 This technique enabled us to perform mass spectrometry-based quantitative in-gel proteome as well as quantitative off-gel phosphoproteome analyses. When comparing the proteome and phosphoproteome data obtained with the two strains, we detected 41 proteins that were overproduced in the prfA* mutant, including ActA and several proteins involved in purine biosynthesis, as well as 21 phosphoproteins exhibiting increased levels of phosphorylation in the prfA* mutant.

escape, intracellular proliferation, and intra- and intercellular motility.13,14 L. monocytogenes contains the following eight major virulence factors, which are absent from nonpathogenic Listeria species. The two internalins, InlA and InlB, are surface proteins that mediate host cell invasion. The pore toxin listeriolysin O (LLO or Hly), the phosphatidylinositol phosphodiesterase PI−PLC (PlcA), and the broad range phospholipase PC−PLC (PlcB) enable phagosomal membrane disruption and contribute to vacuole lysis. The hexosephosphate transporter Hpt is required for intracellular growth. The two remaining major virulence factors are the zinc− metalloprotease Mpl, which processes PlcB to its mature form, and the actin assembly inducing protein ActA, which mediates bacterial motility within and between host cells.15,16 The main transcriptional activator of virulence genes is the positive regulatory factor A (PrfA),17−22 whose expression and activity are regulated by several environmental signals. For example, when wild-type L. monocytogenes is grown in rich medium and in the presence of rapidly metabolized carbohydrates such as glucose and cellobiose, its virulence genes are poorly expressed. PrfA is present in these bacteria, but its activity is repressed via a mechanism that probably involves components of the PTS.23−26 Following the entry of L. monocytogenes into host cells, however, PrfA becomes highly active, and PrfA-dependent virulence gene expression is induced.27,28 Certain mutations in PrfA were reported to lock the protein in a constitutively active conformation, designated PrfA*.29,30 Therefore, PrfA*-producing strains exhibit high levels of PrfAdependent virulence gene expression even in growth media that contain a repressing carbohydrate;31,32 consequently, these mutant strains are fully virulent or even hypervirulent in animal models of infection.29,31,32 Recently, several transcriptomic and proteomic studies have been carried out with prfA* mutants in order to better understand the role that PrfA plays in the virulence of this pathogenic bacterium. These studies have led to the identification of more than 200 PrfA-regulated genes,33−36 which encode metabolic enzymes, transporters, regulators, and many members of the σB stress response regulon.34,35 These results suggest that, in addition to controlling the expression of virulence genes, PrfA might also exert more general effects on the physiology of L. monocytogenes. However, direct or indirect roles of PrfA in protein phosphorylation have not been established. We therefore decided to compare the phosphoproteome of a glucose-grown L. monocytogenes wild-type strain (PrfA inactive) to that of a prfA* mutant grown under the same conditions (PrfA active). In a previous study, we analyzed the phosphoproteome of the L. monocytogenes wild-type strain EGD-e grown in rich medium. We identified 112 phosphoproteins, including several proteins related to virulence.37 In the present work, we attempted to mimic the conditions of infection by using a strain in which the virulence gene regulator PrfA was mutated and therefore constitutively highly active. Specifically, we used the strain that contains the most widely studied prfA* mutation, which results from a single amino acid exchange (G145S) in the protein sequence.38,39 As previously shown, the prfA G145S mutant strain (hereafter called prfA*) exhibits stronger virulence traits than the wild-type strain.30 In an initial step, we characterized the phosphoproteome of the prfA* mutant grown in rich medium and compared the results to those previously obtained from the wild-type strain. We identified 74 phosphoproteins that were present in both the mutant and

■

MATERIALS AND METHODS

Bacterial Strains and Growth Conditions

In this study, we used the L. monocytogenes wild-type strain EGD-e (BUG 1600) and its isogenic prfA*,39 ΔlysA, and prfA*ΔlysA mutants. In the phosphoproteome experiment, the L. monocytogenes prfA* mutant was grown in brain−heart infusion (BHI) medium (hereafter called rich medium).37 For SILAC experiments, we used ΔlysA mutant strains because they lack the ability to synthesize lysine and, in order to produce proteins therefore, must utilize labeled heavy ” lysine (13C615N2, Lys8) added to the culture medium. In this way, the entire proteome of the bacterium is labeled with Lys8, which allows its comparison with the proteome of mutants grown with light lysine (12C614N2, Lys0). We chose to use only Lys8 rather than Lys8 and “heavy” arginine because a conversion of arginine into proline has been reported for Bacillus subtilis,41 and we assumed that a similar transformation might occur in L. monocytogenes, a phylogenetically close relative of B. subtilis. The prfA*ΔlysA double mutant and the ΔlysA mutant strains were grown at 37 °C in chemically defined medium (CDM) that contained 25 mM glucose instead of the usual 50 mM because we observed more efficient growth.42 This medium was complemented with 100 μg/mL Lys8 in the case of the prfA*ΔlysA mutant and with 100 μg/mL Lys0 in the case of the ΔlysA mutant. In both experiments, bacteria were grown until the growth medium reached an OD600 = 0.6; two biological replicates were performed. Construction of lysA Deletion Mutants

In order to construct lysA deletion mutants, the regions up- and downstream of the lysA gene (556 and 445 bp, respectively) were amplified by PCR using L. monocytogenes genomic DNA as a template. The two primers used for the amplification of the upstream region were lysA1-BamHI (5′- TGTGGATCCTAGACTTATTGCTCAAG) and lysA1-SalI (5′- TGAAAGATCATTGTCGACATTCATTGTTCCAAGCC); the BamHI and SalI sites, respectively, are marked in bold and underlined. The primers used for the amplification of the downstream region were lysA2-SalI (5′- GGAACAATGAATGTCGACAATGATCTTTCATTATAGTAGG) and lysA2-NcoI (5′AATCCATGGGTGGTTTACTAAAATAAAAGC); the SalI and NcoI sites, respectively, are marked in bold and underlined. The two PCR products resulting from these amplifications were used as template, and the two distal oligos were used as primers for a subsequent PCR, which enabled the fusion of the two 6047



Article

DNA fragments. The correct sequence of the amplified DNA fragment was verified by DNA sequencing. The resulting PCR product was cloned into the vector pMAD,43 and the pMADderived plasmid pMAD-lysA was subsequently used to transform wild-type L. monocytogenes strains EGD-e and the EGD-e-derived prfA* mutant by electroporation. Erythromycin-resistant blue colonies were selected from solid BHI medium that contained X-Gal. One integration mutant was isolated for each strain (wild-type and prfA* mutant) and grown at 30 °C in liquid BHI medium for several days to allow excision of the plasmid. Subsequently, several erythromycinsensitive white colonies obtained from solid X-Gal-containing BHI medium were screened by PCR to identify mutants in which the second recombination step had resulted in deletion of the lysA gene. The correct in-frame deletion was confirmed by DNA sequencing.

peptides. The recovered peptides were dried and suspended in 20 μL of 0.1% trifluoroacetic acid (TFA) and 2% acetonitrile (ACN). Two technical replicates of each of the 21 samples were analyzed with LC−MS/MS as described below. The results regarding biological and technical variability are shown in Figure S3 in the Supporting Information. For quantitative phosphoproteome analyses, phosphopeptides of the two strains were enriched and analyzed by LC− MS/MS as described below. For each phosphopeptide, we normalized the phosphorylation level with the corresponding protein ratio determined by SILAC experiments in order to eliminate peptides in which the increased phosphorylation was only due to elevated protein synthesis. Biological and technical variability of the phosphopeptide samples was determined, and the results are shown in Figure S4 in the Supporting Information.

Protein Extraction

Off-Gel Protein Digestion and Phosphopeptide Enrichment

When the growth medium reached an OD600 = 0.6, bacteria were harvested by centrifugation (5 min at 6000g, 4 °C). The bacterial pellet was washed with phosphate buffered saline (PBS), resuspended in lysis buffer (50 mM Tris HCl pH 7.4, 0.5 mg/mL lysozyme, 5 mM glycerol 2-phosphate, 5 mM sodium fluoride, 5 mM sodium pyrophosphate, 5 mM sodium vanadate), and incubated at 37 °C for 40 min.44 The cells were disrupted by sonication on ice, and cell debris was removed by centrifugation (20 min at 18 000g, 4 °C). Proteins were extracted with phenol (1:1 v/v) and then with 50 mM TrisHCl, pH 7.4, 20 mM KCl, 10 mM EDTA, and 0.4% βmercaptoethanol (1:1 v/v). Proteins in the phenol phase were precipitated overnight at −20 °C after the addition of four volumes of cold methanol containing 100 mM ammonium acetate. After centrifugation (10 min at 8000g, 4 °C), the protein pellet was washed twice with cold precipitation solution and once with cold methanol, dried, and solubilized in denaturing buffer (6 M urea, 2 M thiourea, 25 mM Tris-HCl, pH 8.0). Protein concentrations were measured with the Bradford assay.45 This protein extract was used for both proteome and phosphoproteome analyses.

Prior to digestion, 8 mg of protein in 6 M urea, 2 M thiourea, 25 mM Tris-HCl, pH 8.0, were reduced with 2 mM DTT (Sigma) for 30 min and alkylated with 10 mM iodoacetamide (Sigma) in the dark for 45 min. Proteins were first digested with 80 μg of lysine-C for 3 h at room temperature; then, following a 4-fold dilution with 20 mM ammonium bicarbonate, they were digested for 17 h with 80 μg of sequencing-grade modified trypsin (Promega) at 30 °C. The resulting peptide mixtures were precleaned with a C18 Sep-Pak column (Waters), and the pH of the eluate was adjusted to 2.7. The first step of phosphopeptide enrichment was performed by strong cation exchange chromatography (SCX) using a Resource S (1 mL, GE-Healthcare) column.37 For the second step of phosphopeptide enrichment, we followed a previously established protocol37 with some modifications. Briefly, we added 3 mg of titanium dioxide-coated beads (GL Biosciences) to each SCX fraction and incubated them for 40 min under gentle shaking with 60% ACN, 0.2% TFA, and 300 mg/mL lactic acid (Wako). The phosphopeptides were eluted twice with 100 μL of 0.5% ammonium hydroxide (pH 10.5). The samples were concentrated under vacuum almost to dryness and resuspended in 12 μL of 0.1% TFA and 2% ACN for analysis in a high-resolution mass spectrometer.

SILAC Experiments

The pipeline of our experimental approach is presented in Figure S1 in the Supporting Information. In order to test the efficiency of protein labeling, protein extracts were prepared by phenol extraction (see preceding section) from cells grown in Lys8-containing CDM. After in-solution digestion, 200 ng of protein was injected in a LTQ-Orbitrap apparatus for LC−MS/ MS analysis, and we quantified 391 peptides with MaxQuant. The percentage of SILAC labeling efficiency at the peptide level was calculated as 100[1 − (1 divided by H/L)], where H/L is the ratio of incorporated Lys8 and Lys0. In our experiments, the median H/L ratio for peptides was 28.75, which corresponds to 96.5% incorporation of Lys8 (Figure S2 in the Supporting Information). For quantitative proteome analyses, we separated 15 μg of the protein mixture (protein extracts of Lys0-ΔlysA and Lys8ΔlysA prfA*) on a 1% SDS/12% polyacrylamide gel (Invitrogen) by 1D electrophoresis. Lanes were cut into 21 pieces, and the proteins present in the gel fragments were reduced by DTT (Sigma), alkylated by iodoacetamide (Sigma), and subsequently digested with 100 ng of sequencing-grade modified trypsin (Promega) as previously described.46 We used trypsin because it is more efficient under these conditions than lysine-C, which provided numerous incompletely digested

Liquid Chromatography−Mass Spectrometry

Mass spectrometry was performed on the PAPPSO platform (MICALIS, INRA, France, http://pappso.inra.fr/). An LTQOrbitrap Discovery apparatus (Thermo Fisher Scientific) coupled to a Dionex RS-LC nanoHPLC system (Thermo Fisher Scientific) was used for the nano-LC−MS/MS analysis as previously described,37 with slight modifications. The MS scan range was m/z 300−1600, and the resolution was set to 30 000. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium47 via the PRIDE partner repository with the data set identifier PXD001108. Processing and Bioinformatic Analyses

The L. monocytogenes EGD-e database was downloaded from the EBI Web site (http://www.ebi.ac.uk, July 2011, 2844 protein entries). This database, in conjunction with reverse and contaminant databases, was searched by MaxQuant (version 1.2.2.5, www.maxquant.org).48 The probabilistic search engine Andromeda, which is incorporated into the MaxQuant package,49 was used to search the peak lists. Strict trypsin cleavage specificity was required, and up to two missed 6048



Article

Figure 1. Summary of the results of the proteome and phosphoproteome and SILAC experiments. The left panel shows the phosphoproteome data of prfA* and wild-type L. monocytogenes grown in rich medium. The right panel shows the results of the quantitative comparison of the proteome and the phosphoproteome data between ΔlysA and ΔlysA prfA* strains grown in CDM. The data were normalized by taking into account the protein ratios independently determined for each phosphoprotein.

cleavages were allowed. The carbamidomethylation of cysteine residues was set as a fixed modification, and the oxidation of methionine, as a variable modification. Phosphorylation at S/ T/Y residues was used as a variable modification for phosphopeptide-enriched samples. The precursor mass tolerance was 6 ppm, and the fragment mass tolerance was 0.5 Da. Retention time-dependent mass recalibration was used to improve the accuracy of precursor ions. Peptides composed of at least six amino acids were accepted, whereas those with a posterior error probability score > 0.1 or an Andromeda score < 70 were ignored. The maximum false discovery rate (FDR) at the protein and peptide levels as well as at the phosphorylation site level was set to 1%. For SILAC experiments, Lys8 was set as a fixed modification. Phosphopeptide and protein ratios in SILAC experiments were considered to be significant only when they had a value greater than 1.5. In addition, we requested that the calculation of protein ratios in the proteome study be based on at least two unique peptides, with the exception of 12 proteins for which only one identical unique peptide was detected in each of the two replicates. The “match between run” option, with a time window of 2 min, was used to match identifications across different replicates, adjacent lanes of the SDS-PAGE, or various SCX fractions. For quantitative phosphorylation site analysis, only phosphopeptides with a localization probability of at least 0.75 and a score difference of 5 were considered. The final quantification values reported by MaxQuant were the median of the H/L ratios of all peptides for a particular protein, across biological and technical replicates. To identify the phosphoproteins and proteins whose phosphorylation or production level were significantly different in the ΔlysA and ΔlysA prfA* mutants, we always estimated the biological and technical reproducibility by using two biological and two technical replicates. The H/L ratio of one replicate was

divided by the H/L ratio of the other replicate, which provided the so-called ratio of ratios. These values, which were calculated for all proteins, were log2-transformed and plotted as a histogram. Standard deviations (σ) were calculated from the log2-transformed values, and the median ±2σ was defined as the cutoff value that determined inclusion in the list of up- or downregulated phosphopeptides and proteins.50 We required that both replicates pass this cutoff criterion. PSORTb (v3.0) was used to predict the cellular localization of the identified proteins and phosphoproteins.51 A biological gene ontology (GO) analysis was performed using the quick GO tool (http:// www.ebi.ac.uk/GOA) in order to predict the different processes in which the phosphoproteins are involved. STRING52 was used to visualize the network connections between different proteins that were overexpressed in response to the prfA* mutation. In Vitro Phosphorylation

To carry out in vitro phosphorylation experiments with ActA, we first purified a truncated form of the protein (amino acids 1−613) from L. monocytogenes strain DPL2723 as previously described.53 This protein carries a C-terminal His-tag in place of the transmembrane domain. We then amplified by PCR an allele of lmo1820 that encodes only the N-terminal catalytic domain of the protein kinase (amino acids 1−340) lacking the transmembrane part. For this we used the primers PrkC1_340_BHI (GGAGGATCCATGATGATTGGTAAGCG) and PrkC1_340_SI (AGAGTCGACTTAAGCAATTTTCTTTTTCTTGC), in which the BamHI and SalI restriction sites, respectively, are marked in bold and underlined. The amplified DNA fragment was cut with BamHI and SalI and cloned into the pQE30 vector that had been digested with the same enzymes. The resulting plasmid was used to 6049



Article

transform Escherichia coli strain M15[pREP4], and the Histagged protein kinase was purified as previously described.54 For the phosphorylation of ActA with γ-[32P]ATP, the assay mixture contained 25 mM Tris/HCl, pH 7.4, 10 mM MgCl2, 0.1 mM γ-[32P]ATP, 5 μM Lmo1820, and 9 μM ActA. Control samples lacking either ActA or Lmo1820 were also prepared. After incubation for 1 h at 37 °C, Lmo1820 and ActA were separated by electrophoresis on a 0.1% SDS/12.5% polyacrylamide gel. ActA was also phosphorylated with unlabeled ATP in order to carry out subsequent mass spectrometry. The reaction mixtures contained 25 mM Tris/HCl, pH 7.4, 10 mM MgCl2, 10 mM ATP, 7 μM Lmo1820, and 13 μM ActA. A control experiment without ATP was also carried out. The phosphorylation of ActA at Ser470 was detected only in the ATP-containing sample.

■

RESULTS AND DISCUSSION

Phosphoproteome of the prfA* Mutant in Rich Medium

In a previous study, we analyzed the phosphoproteome of wildtype L. monocytogenes strain EGD-e grown in rich medium and identified 143 phosphorylation sites on 155 unique peptides, which corresponded to 112 phosphoproteins.37 The distribution of S/T/Y phosphorylation sites was 93:43:7. Here, we performed a similar phosphoproteome analysis with the L. monocytogenes prfA* strain, also grown in rich medium, to unravel potential PrfA-dependent phosphorylation events (Figure 1). In the prfA* mutant, we detected a total of 191 phosphoproteins, containing 256 unique phosphopeptides and 242 unique phosphosites, with a S/T/Y distribution of 155:75:12. Compared to the wild-type L. monocytogenes phosphoproteome,37 we identified 187 new phosphopeptides in the prfA* mutant, corresponding to 117 new phosphoproteins (Figure 2A,B). Even within the 74 phosphoproteins that were found in both the wild-type and prfA* phosphoproteomes, the phosphosites were not always conserved. The spectra and the list of all identified peptides are provided in Figure S5 and Table S1, respectively, in the Supporting Information. The 191 phosphoproteins identified in the prfA* mutant are involved in numerous biological processes such as cell division, transcription regulation, translation, carbohydrate transport, protein modification, stress response, and virulence (Figure S6 in the Supporting Information). Interestingly, the virulence factor ActA was among the 117 novel listerial phosphoproteins identified in the prfA* mutant. ActA is a membrane-anchored cell surface protein that contains a C-terminal transmembrane helix. This protein is necessary for intracellular motility and cell-to-cell spread of the pathogen. It mimics the activity of host cell nucleation-promoting factors of the WASP/WAVE family55 and hence triggers actin polymerization at one pole of the bacterium. Similar to WASP/WAVE proteins, ActA contains two specific regions, designated A (acidic; aa 51−56) and C (central; aa 146−150), which, together with a third region, promote the nucleation of actin polymerization (Figure 2C). The C- and A-regions interact with the ARP2/3 complex, and the third region brings the ARP2/3 complex in contact with Gactin.56,57 Interestingly, studies of L. monocytogenes cells growing inside host cells had revealed that ActA is phosphorylated by the host cell kinase CSNK2B at Ser155 and Ser157 just downstream from the C-region,58,59 which leads to efficient ActA-mediated actin tail formation.59 Here, we demonstrate that ActA phosphorylation also occurs via one or

Figure 2. Venn diagrams with (A) phosphopeptides and (B) phosphoproteins for wild-type and prfA* mutant strains grown in rich medium. (C) Functional sites of ActA: the A and C regions (blue boxes) promote nucleation of actin polymerization. Black letters indicate sites previously reported to be phosphorylated by the host protein kinase CK2 (Ser155 and Ser157); both sites qualify as bona fide CK2 phosphorylation sites (consensus sequence SXXD/E). The vertical black bars indicate four proline-rich repeats (PPPP) in the center of ActA, hypothesized to act as a binding site. Orange letters indicate five phosphorylated serine residues observed in the prfA* mutant grown in rich medium. These phosphorylation sites partly overlap the proline-rich repeats.

more listerial protein kinases at five different sites in its Cterminal domain: Ser356, Ser365, Ser470, Ser482, and Ser546 (Figure 2C). This part of the protein, which exhibits sequence similarity to the hinge region of the cytoskeleton protein vinculin, also contains four proline-rich repeats. Two of the bacterial phosphorylation sites are located between the last two proline-rich repeats, and it is likely that phosphorylation of ActA by the bacterial kinase(s) affects the as-yet-unknown function of these sequence motifs. Our previous analysis of the phosphoproteome of wild-type L. monocytogenes did not detect the phosphorylation of ActA.37 The reason is probably that in the wild type the presence of glucose in the growth medium represses the expression of virulence genes, including actA. The prfA* mutation overcomes the repressive effect of glucose;30,36 indeed, as shown later, the amount of ActA in the prfA* mutant grown in glucosesupplemented CDM was 15-times higher than that in the wildtype strain (Table 1). The lmo1820 gene encodes a eukaryotic-like protein kinase that probably autophosphorylates at Thr290 and Thr308 in the wild-type strain37 and at Thr290, Ser217, and Thr308 in the prfA* mutant (see below). This enzyme exhibits strong similarity to the B. subtilis protein kinase PrkC and is one of the two eukaryotic-like protein kinases present in L. monocytogenes. We therefore tested whether ActA might be phosphorylated in vitro by Lmo1820. After phosphorylation in the presence of γ-[32P]ATP and separation on an SDS/ polyacrylamide gel, we observed not only a strong radioactive 6050



Article

Table 1. Proteins Overproduced in the ΔlysA prfA* Mutant Grown in Chemically Defined Medium (SILAC) protein

gene ontology (GO) term

H/L ratio normalized

AcpP ActAa AlsS FabD FabG GcvPA GcvPB GcvT Hly InlA InlB LmaA Lmo0087 Lmo0163 Lmo0443 Lmo1739 Lmo1740 Lmo1744 Lmo1745 Lmo1967 Lmo2114 Lmo2254 Lmo2487 Mbl PanB PlcA PrfA ProB PrsA2 Pta Pth PurB PurC PurD PurF PurK PurL PurM PurN PurQ RplI

Fatty acid biosynthesis Pathogenesis Metabolic process Fatty acid biosynthesis Fatty acid biosynthesis Oxidation−reduction process Oxidation−reduction process Glycine catabolic process Pathogenesis Pathogenesis Protein binding TP901-1 family phage major tail protein Unknown Unknown Unknown ATP catabolic process Transport Metabolic process Regulation of transcription Unknown ATP catabolic process Transport Unknown Cell morphogenesis Methylation Pathogenesis Pathogenesis Biosynthetic process Protein folding Metabolic process Translation Purine nucleotide biosynthetic process Purine nucleotide biosynthetic process Purine nucleotide biosynthetic process Purine nucleotide biosynthetic process Purine nucleotide biosynthetic process Purine nucleotide biosynthetic process Purine nucleotide biosynthetic process Purine nucleotide biosynthetic process Purine nucleotide biosynthetic process Translation

2.03 15.06 1.96 4.51 4.61 2.22 1.95 1.66 2.29 10.43 4.30 2.15 2.50 1.63 1.59 1.85 1.60 2.71 2.22 1.61 1.91 2.09 1.60 1.66 2.46 4.04 3.80 1.59 2.47 1.54 1.65 2.09 2.03 1.63 1.95 1.90 2.06 1.83 2.05 2.12 1.54

signals or might be catalyzed by other protein kinases of L. monocytogenes. Quantification of the Proteome in the ΔlysA and ΔlysA prfA* Mutants Grown in Chemically Defined Medium

Quantification of the proteome was performed using a gel approach as outlined in Materials and Methods. To quantify proteins from 1D gel electrophoresis, we prepared protein extracts from the ΔlysA and ΔlysA prfA* mutants by following a protocol similar to that described in Misra et al.37 We identified and quantified a total of 770 proteins (Table S2 in the Supporting Information), and 59 of them exhibited significant variation in abundance between the ΔlysA prfA* mutant and the ΔlysA strain; in the ΔlysA prfA* mutant, 41 proteins displayed increased expression, whereas 18 proteins displayed decreased expression compared to the ΔlysA strain (Tables 1 and 2 and Figure 3). These data were also used later for the normalization of off-gel phosphoproteome quantification (see below). Table 2. Proteins Underproduced in the ΔlysA prfA* Mutant Grown in Chemically Defined Medium (SILAC) protein

gene ontology (GO) term

H/L ratio normalized

GbuAa Lmo0241 Lmo0791 Lmo0884 Lmo1079 Lmo1258 Lmo1336 Lmo1959 Lmo2229 Lmo2331 Lmo2637 Lmo2638 Lmo2679 MntA MntB MurC OppA ResD

ATP catabolic process Methylation Unknown Oxidation−reduction process Unknown Unknown Biosynthetic process Unknown Cell wall biogenesis Unknown Transport Oxidation reduction process Signal transduction Transport Transport Cell wall biogenesis Transport Regulation of transcription

0.05 0.47 0.20 0.40 0.42 0.41 0.46 0.37 0.60 0.49 0.40 0.32 0.59 0.50 0.38 0.50 0.56 0.31

a

Bold indicates proteins whose genes have been reported to be underexpressed in a transcriptomic study (Marr et al.35).

Bold indicates proteins whose genes have been reported to be overexpressed in a transcriptomic study (Marr et al.35).

Proteins More Abundant in the ΔlysA prfA* Mutant than in ΔlysA

band that corresponded to autophosphorylated Lmo1820 but also a second band that co-migrated with ActA (Figure S7 in the Supporting Information). The latter band was not present in a control experiment that lacked ActA. ActA phosphorylation was also carried out both in the absence and presence of unlabeled ATP. On SDS/polyacrylamide gels, ActA migrates in accordance with a MW of 100 kDa (Figure S7 in the Supporting Information) and therefore probably forms dimers even on denaturing gels.53 Mass spectrometry of the 100 kDa band and of the band corresponding to Lmo1820 revealed that ActA is phosphorylated in vitro by Lmo1820 at Ser470, whereas Lmo1820 autophosphorylates at Thr290 and Thr308. Phosphorylation of the remaining four phosphorylatable serine residues in the C-terminal half of ActA might require specific

The genes of many of the proteins that were overproduced in the ΔlysA prfA* strain had been reported to be overexpressed in a prfA* mutant grown in glucose-containing CDM during a transcriptome study.35 Specifically, the genes encoding 12 of the 41 proteins overproduced in the ΔlysA prfA* strain were also found to be overexpressed in the prfA* mutant used in that study,35 including prfA as well as the four PrfA-controlled virulence genes, hly, actA, inlA, and inlB (Table 1). Quantitative RT-PCR control experiments with the wild-type strain and the prfA*, ΔlysA, and ΔlysA prfA* mutants revealed that the lysA deletion has no effect on the expression of hly and actA (data not shown). The elevated synthesis of the virulence proteins in the ΔlysA prfA* mutant is therefore due to the increased PrfA activity.30 Therefore, in our study, we compared a presumably saprophytic form of L. monocytogenes (low virulence gene expression) with a mutant exhibiting hypervirulence in animal

a

6051



Article

Figure 3. Interaction network of overproduced proteins detected in cells grown in CDM. Protein mapping was achieved with STRING software analysis based on known and predicted protein−protein interactions (http://string-db.org/) and was performed with medium confidence (score > 0.4). Dark blue lines represent scores with the highest confidence (score > 0.9).

infection models (strong constitutive expression of virulence genes). Overproduction of the virulence factors in the ΔlysA prfA* mutant ranged from 2.3-fold for Hly to 15.1-fold for ActA (Table 1), one of the novel phosphoproteins detected in the prfA* mutant. Virulence proteins that are mostly secreted when overproduced in a prfA* mutant, such as PlcB,36 or integral membrane proteins that usually resist to proteolytic digestion, such as Hpt, were not detected in our study or were found to be only slightly overproduced, although the genes of some of them were reported to be strongly overexpressed in the transcriptome comparison.35 A second set of proteins overproduced in the ΔlysA prfA* mutant is related to purine biosynthesis (Table 1). Of these, the three genes encoding PurB, PurC, and PurQ were also found to be overexpressed in the transcriptome study.35 However, the pur operon contains 9 additional genes, and our proteome analysis revealed that six of its encoded proteins, PurKLFMND, were also overproduced in the prfA* mutant (STRING network, Figure 3). It thus appears that the purine biosynthesis pathway is highly active in the prfA* mutant, a result that correlates with two previous studies, demonstrating the involvement of this pathway in virulence. In the first, three pur genes (purA, purQ, and purS) were reported to belong to a set of 141 listerial genes that contribute to the intracellular replication of L. monocytogenes.60 In the second, purA and purB mutants were shown to be severely impaired in their ability to colonize the gastrointestinal tract, but they still caused systemic infection of other organs.61 Taken together, these results suggest that purine biosynthesis is required for gastrointestinal virulence and intracellular proliferation of L. monocytogenes. The synthesis of the three enzymes FabD, FabG, and AcpP (or Lmo1806), which are involved in the fatty acid biosynthesis pathway, was also found to be elevated in the ΔlysA prfA*

mutant. This result is consistent with the transcriptome comparison,35 which had also revealed that the fabD and fabG genes are overexpressed in the prfA* mutant. Interestingly, biosynthesis of the main fatty acid group, the anteisobranched-chain fatty acids, has been shown to promote intracellular growth and survival inside host macrophages.62 Finally, the foldase protein PrsA2, a secreted protein, was also more abundant in the ΔlysA prfA* mutant (2.3-fold), even though it is not directly controlled by PrfA.63 This protein acts as post-translational chaperone and localizes at the interface between the cytoplasmic membrane and the cell wall.63−66 It plays a critical role in L. monocytogenes’ virulence because it promotes the folding, stability, and activity of the secreted virulence proteins LLO (Hly) and PlcB.63,66 Indeed, mutants that lack prsA2 displayed significantly attenuated virulence in a mouse model and exhibited reduced viability when PrfA was activated.65 In addition, PrsA2 is also involved in flagellumbased motility64 and intracellular proliferation.33 Proteins Less Abundant in the ΔlysA prfA* Mutant Than in ΔlysA

We observed that a total of 18 proteins were less abundant in the ΔlysA prfA* mutant than in ΔlysA (Table 2). Of these, six are encoded by genes that had been reported in the transcriptome comparison as being downregulated in the prfA* mutant grown in glucose-containing CDM.35 These included Lmo2638 and Lmo2637, the presumed subunits of a heterodimeric NADH dehydrogenase, as well as the transport proteins MntA and MntB (involved in manganese transport), GbuA (involved in glycine/betaine transport), and OppA (catalyzes oligopeptide uptake). Another protein that was less produced in the ΔlysA prfA* mutant was ResD, which was present in the mutant at an 6052



Article

Figure 4. (A) Histogram of phosphopeptides that exhibit elevated phosphorylation in the ΔlysA prfA* mutant grown in CDM. The phosphorylated amino acid is indicated at the top of each bar. (B) Presentation of the function of the proteins listed in panel A.

abundance 0.3-times that in ΔlysA. This protein is a twocomponent response regulator, which is required for glucosemediated repression of virulence genes. Specifically, ResD is needed for efficient expression of the mptA gene, which encodes the EIIABMan component of the PTS, and therefore for efficient glucose utilization.67 Interestingly, our previous study of the L. monocytogenes phosphoproteome identified the cognate sensor kinase ResE as a phosphoprotein.37

Spectra for all overphosphorylated peptides are presented in Figure S8 in the Supporting Information. The highest H/L ratio (4.6) was detected for Lmo1771 (PurS), a subunit of the phosphoribosylformylglycinamidine synthetase II complex. The elevated phosphorylation of this protein in the ΔlysA prfA* mutant might result in increased enzymatic activity,68 a hypothesis that is consistent with the previously discussed importance of purine biosynthesis for intracellular replication of L. monocytogenes.60 Another protein that exhibited an elevated H/L ratio was Lmo1820, which was 1.55 times more strongly phosphorylated in the prfA* mutant. It is likely that this increased phosphorylation corresponds to increased activity, as a study of the homologous PrkC protein in B. subtilis reported a positive correlation between the activity of this protein and its degree of autophosphorylation. 69 Importantly, of the 21 phosphoproteins that we identified as being more strongly phosphorylated in the ΔlysA prfA* mutant, four of them (CysK, FbaA, Gap, MptA) were identified in a previous study as being targets of Lmo1820.70 Glycolytic enzymes constitute the largest category of upregulated phosphoproteins. In all bacterial phosphoproteome analyses that have been carried out to date, several proteins related to carbon metabolism have been found to be phosphorylated, some even at multiple sites.71,72 L. monocytogenes is no exception to this, as seven glycolytic enzymes and several carbohydrate transporters were reported to be

Effects of the prfA* Mutation on the Phosphoproteome

In order to determine whether the prfA* mutation also causes variations in the phosphoproteome of L. monocytogenes, we performed a quantitative phosphoproteome analysis by carrying out SILAC experiments using ΔlysA and ΔlysA prfA* mutants grown in glucose-containing CDM. To exclude the influence of differences in protein synthesis, we normalized the ratio of each phosphopeptide by dividing its value by the corresponding protein ratio obtained from in-gel quantification (Figure S1 in the Supporting Information). We detected 24 phosphopeptides that were more strongly phosphorylated in the ΔlysA prfA* mutant but, curiously, none that exhibited diminished phosphorylation in ΔlysA prfA* compared to ΔlysA (Figure 4A,B). A detailed description of these 24 phosphopeptides, which correspond to 21 phosphoproteins, is presented in Table S3 in the Supporting Information. Only phosphoproteins that had an H/L ratio higher than 1.5 and that were detected in both strains and in both replicates are listed in the table. 6053



Article

ΔlysA and ΔlysA prfA* strains grown in CDM (in-gel). The calculated Pearson correlation coefficient was 0.89 for technical replicates and 0.84 for biological replicates. Figure S4: Biological (A) and technical (B) reproducibility of quantification of phosphopeptide ratios for the ΔlysA and ΔlysA prfA* strains grown in CDM. The calculated Pearson correlation coefficient was 0.73 for both technical and biological replicates. Figure S5: Phosphopeptide spectra obtained with the prfA* strain grown in rich medium. Figure S6: Information regarding the biological processes and cellular compartments of the phosphoproteins identified after growth in rich medium. Figure S7: Autoradiogram of an SDS/polyacrylamide gel on which ActA and Lmo1820 were separated after phosphorylation with γ -[32P]ATP. Figure S8: Phosphopeptide spectra obtained with the ΔlysA prfA* strain grown in CDM. This material is available free of charge via the Internet at http://pubs.acs.org. The mass spectrometry proteomics data have been deposited at the ProteomeXchange Consortium47 via the PRIDE partner repository with the data set identifier PXD001108 (http:// www.ebi.ac.uk/pride/archive/projects/PXD001108).

phosphorylated.37 In the ΔlysA prfA* mutant, several of these proteins displayed levels of phosphorylation that were significantly elevated compared to those found in the ΔlysA strain (Figure 4 and Table S3 in the Supporting Information). Two of these proteins, PfkA (6-P-fructokinase) and FbaA (fructose-1, 6-bisphosphate aldolase), are active in the upper part of glycolysis. FbaA is phosphorylated at two sites, both of which exhibited increased phosphorylation in the ΔlysA prfA* mutant. Elevated phosphorylation was also observed for glyceraldehyde-3-P dehydrogenase (Gap) and the PTS components EI (PtsI) and MptA (ManL). The latter forms the EIIAB subunit of the mannose and glucose transporter. 6Phosphofructokinase is a newly discovered listerial phosphoprotein, whereas the other four enzymes have previously been shown to be phosphorylated at Ser or Thr.37 Phosphorylation of enzymes usually inhibits their activity, and the concerted phosphorylation of several glycolytic enzymes in the prfA* mutant is therefore likely to slow carbon metabolism via the Embden−Meyerhof−Parnas pathway.41 Similarly, phosphorylation of EI and EIIABMan probably slows PTS-mediated glucose uptake. This result is consistent with the observation that during intracellular growth that leads to strong expression of virulence genes, L. monocytogenes mainly utilizes carbon sources that are taken up by non-PTS transporters (glycerol, dihydroxyacetone, glucose-6-P).73 Additionally, during intracellular growth, it has been noted that the glycolytic activity of L. monocytogenes is reduced, the gluconeogenic enzymes PEP synthase and fructose-1,6-bisphosphatase are strongly induced, and the pentose phosphate pathway is upregulated.74

■

*E-mail [email protected]. Phone: +33-134652756. Fax: +33-134652163. Present Addresses ○ (S.K.M.) Department of Molecular and Cellular Oncology, University of Texas, MD Anderson Cancer Research, Houston, Texas 77030, United States. ∇ (Z.W.) College of Veterinary Medicine, Nanjing Agricultural University, No. 1 Weigang Road, Nanjing 210095, China. ◆ (C.A.) INRA, AgroParisTech, UMR 1319 Micalis, F-78350 Jouy-en-Josas, France.

■

CONCLUSIONS We characterized the phosphoproteome of the L. monocytogenes prfA* mutant and compared it to the phosphoproteome of the wild-type strain.37 Our results demonstrate that a mutation that renders the virulence gene activator PrfA constitutively active not only affects the phosphorylation level of numerous proteins but also allowed the detection of about 100 novel phosphoproteins, some of which might affect the virulence of this pathogen. As expected, the major virulence factors PrfA, PlcA, Hly (LLO), ActA, InlA, and InlB were overproduced in the prfA* mutant. Most importantly, ActA, the virulence protein responsible for intracellular motility and cell-to-cell spread of the pathogen, was found to be phosphorylated at five different serine residues in the C-terminal half. At least one of these phosphorylation reactions is catalyzed by the bacterial protein kinase Lmo1820. Determining the effects and impact of these bacterial-specific phosphorylation events on listerial virulence represents an interesting area for future research.

■

AUTHOR INFORMATION

Corresponding Author

Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by the National Research Agency (ANR) project no. ANR-09-BLAN-0273-01. S.K.M. and F.M.D.A. were financed by the ANR. T.N.C. received a fellowship from Campus France. We thank Edith Gouin for providing us with purified ActA protein.

■

REFERENCES

(1) Jers, C.; Soufi, B.; Grangeasse, C.; Deutscher, J.; Mijakovic, I. Phosphoproteomics in bacteria: towards a systemic understanding of bacterial phosphorylation networks. Expert Rev. Proteomics 2008, 5, 619−627. (2) Soufi, B.; Jers, C.; Erichsen Hansen, M.; Petranovic, D.; Mijakovic, I. Insights from site-specific phosphoproteomics in bacteria. Biochim. Biophys. Acta 2008, 1784, 186−192. (3) Mijakovic, I.; Macek, B. Impact of phosphoproteomics on studies of bacterial physiology. FEMS Microbiol. Rev. 2012, 36, 877−892. (4) Ge, R.; Shan, W. Bacterial phosphoproteomic analysis reveals the correlation between protein phosphorylation and bacterial pathogenicity. Genomics, Proteomics Bioinf. 2011, 9, 119−127. (5) Ge, R.; Sun, X.; Xiao, C.; Yin, X.; Shan, W.; Chen, Z.; He, Q. Y. Phosphoproteome analysis of the pathogenic bacterium Helicobacter pylori reveals over-representation of tyrosine phosphorylation and multiply phosphorylated proteins. Proteomics 2011, 11, 1449−61. (6) Cossart, P.; Toledo-Arana, A. Listeria monocytogenes, a unique model in infection biology: an overview. Microbes Infect. 2008, 10, 1041−1050.

ASSOCIATED CONTENT

S Supporting Information *

Table S1: List of phosphopeptides identified in the prfA* mutant grown in rich medium (MaxQuant table). Table S2: Variation in protein abundances in CDM (MaxQuant Table) from 1D SDS polyacrylamide gel. Table S3: Description of the 24 phosphopeptides overproduced in the ΔlysA prfA* mutant grown in CDM. Figure S1: Experimental pipeline. SILAC quantification for proteins and phosphoproteins in ΔlysA and ΔlysA prfA* strains grown in CDM. Figure S2: Efficiency of heavy lysine incorporation. Shown are the histograms of log2 (H/L) ratios. Figure S3: Biological (A) and technical (B) reproducibility of the quantification of protein ratios for the 6054



Article

monocytogenes, can be present but inactive. Infect. Immun. 1997, 65, 1515−1518. (26) Herro, R.; Poncet, S.; Cossart, P.; Buchrieser, C.; Gouin, E.; Glaser, P.; Deutscher, J. How seryl-phosphorylated HPr inhibits PrfA, a transcription activator of Listeria monocytogenes virulence genes. J. Mol. Microbiol. Biotechnol. 2005, 9, 224−234. (27) Renzoni, A.; Cossart, P.; Dramsi, S. PrfA, the transcriptional activator of virulence genes, is upregulated during interaction of Listeria monocytogenes with mammalian cells and in eukaryotic cell extracts. Mol. Microbiol. 1999, 34, 552−561. (28) Moors, M. A.; Levitt, B.; Youngman, P.; Portnoy, D. A. Expression of listeriolysin O and ActA by intracellular and extracellular Listeria monocytogenes. Infect. Immun. 1999, 67, 131−139. (29) Ripio, M. T.; Dominguez-Bernal, G.; Suarez, M.; Brehm, K.; Berche, P.; Vazquez-Boland, J. A. Transcriptional activation of virulence genes in wild-type strains of Listeria monocytogenes in response to a change in the extracellular medium composition. Res. Microbiol. 1996, 147, 371−384. (30) Ripio, M. T.; Dominguez-Bernal, G.; Lara, M.; Suarez, M.; Vazquez-Boland, J. A. A Gly145Ser substitution in the transcriptional activator PrfA causes constitutive overexpression of virulence factors in Listeria monocytogenes. J. Bacteriol. 1997, 179, 1533−1540. (31) Shetron-Rama, L. M.; Mueller, K.; Bravo, J. M.; Bouwer, H. G.; Way, S. S.; Freitag, N. E. Isolation of Listeria monocytogenes mutants with high-level in vitro expression of host cytosol-induced gene products. Mol. Microbiol. 2003, 48, 1537−1551. (32) Bruno, J. C.; Freitag, N. E. Constitutive activation of PrfA tilts the balance of Listeria monocytogenes fitness towards life within the host versus environmental survival. PLoS One 2010, 5, e15138. (33) Chatterjee, S. S.; Hossain, H.; Otten, S.; Kuenne, C.; Kuchmina, K.; Machata, S.; Domann, E.; Chakraborty, T.; Hain, T. Intracellular gene expression profile of Listeria monocytogenes. Infect. Immun. 2006, 74, 1323−1338. (34) Milohanic, E.; Glaser, P.; Coppee, J. Y.; Frangeul, L.; Vega, Y.; Vazquez- Boland, J. A.; Kunst, F.; Cossart, P.; Buchrieser, C. Transcriptome analysis of Listeria monocytogenes identifies three groups of genes differently regulated by PrfA. Mol. Microbiol. 2003, 47, 1613−1625. (35) Marr, A. K.; Joseph, B.; Mertins, S.; Ecke, R.; Müller-Altrock, S.; Goebel, W. Overexpression of PrfA leads to growth inhibition of Listeria monocytogenes in glucose-containing culture media by interfering with glucose uptake. J. Bacteriol. 2006, 188, 3887−3901. (36) Port, G. C.; Freitag, N. E. Identification of novel Listeria monocytogenes secreted virulence factors following mutational activation of the central virulence regulator, PrfA. Infect. Immun. 2007, 75, 5886−5897. (37) Misra, S. K.; Milohanic, E.; Aké, F. M. D.; Mijakovic, I.; Deutscher, J.; Monnet, V.; Henry, C. Analysis of the serine/threonine/ tyrosine phosphoproteome of the pathogenic bacterium Listeria monocytogenes reveals phosphorylated proteins related to virulence. Proteomics 2011, 11, 4155−4165. (38) Eiting, M.; Hagelüken, G.; Schubert, W. D.; Heinz, D. W. The mutation G145S in PrfA, a key virulence regulator of Listeria monocytogenes, increases DNA-binding affinity by stabilizing the HTH motif. Mol. Microbiol. 2005, 56, 433−46. (39) Bécavin, C.; Bouchier, C.; Lechat, P.; Archambaud, C.; Creno, S.; Gouin, E.; Wu, Z.; Kuhbacher, A.; Brisse, S.; Pucciarelli, M. G.; Gracia-del Portillo, F.; Hain, T.; Portnoy, D. A.; Chakraborty, T.; Lecuit, M.; Pizarro-Cerda, J.; Moszer, I.; Bierne, H.; Cossart, P. Comparison of widely used Listeria monocytogenes strains EGD, 10403S and EGD-e highlights genomic divergence underlying differences in pathogenicity. mBio 2014, 5, e00969-14. (40) Ong, S. E.; Blagoev, B.; Kratchmarova, I.; Kristensen, D. B.; Steen, H.; Pandey, A.; Mann, M. Stable isotope labeling by amino acids in cell culture, SILAC, as a simple and accurate approach to expression proteomics. Mol. Cell. Proteomics 2002, 1, 376−386. (41) Soufi, B.; Kumar, C.; Gnad, F.; Mann, M.; Mijakovic, I.; Macek, B. Stable isotope labeling by amino acids in cell culture (SILAC)

(7) Cossart, P. Illuminating the landscape of host−pathogen interactions with the bacterium Listeria monocytogenes. Proc. Natl. Acad. Sci. U.S.A. 2011, 108, 19484−19491. (8) Gray, M. J.; Freitag, N. E.; Boor, K. J. How the bacterial pathogen Listeria monocytogenes mediates the switch from environmental Dr. Jekyll to pathogenic Mr. Hyde. Infect. Immun. 2006, 74, 2505−2512. (9) Freitag, N. E.; Port, G. C.; Miner, M. D. Listeria monocytogenes from saprophyte to intracellular pathogen. Nat. Rev. Microbiol. 2009, 7, 623−628. (10) Dussurget, O. New insights into determinants of Listeria monocytogenes virulence. Int. Rev. Cell. Mol. Biol. 2008, 270, 1−38. (11) Glaser, P.; Frangeul, L.; Buchrieser, C.; Rusniok, C.; Amend, A.; Baquero, F.; Berche, P.; Bloecker, H.; Brandt, P.; Chakraborty, T.; Charbit, A.; Chetouani, F.; Couve, E.; de Daruvar, A.; Dehoux, P.; Domann, E.; Dominguez-Bernal, G.; Duchaud, E.; Durant, L.; Dussurget, O.; Entian, K. D.; Fsihi, H.; Garcia-del Portillo, F.; Garrido, P.; Gautier, L.; Goebel, W.; Gomez-Lopez, N.; Hain, T.; Hauf, J.; Jackson, D. Comparative genomics of Listeria species. Science 2001, 294, 849−852. (12) Deutscher, J.; Aké, F. M. D.; Zébré, A. C.; Cao, T. N.; Kentache, T.; Monniot, C.; Ma Pham, Q. M.; Mokhtari, A.; Joyet, J.; Milohanic, E. Carbohydrate utilization by Listeria monocytogenes and its influence on virulence gene expression. In Listeria monocytogenes: Food Sources, Prevalence and Management Strategies; Hambrick, E. C., Ed.; Nova Science Publishers: New York, 2014; pp 49−76. (13) Camejo, A.; Carvalho, F.; Reis, O.; Leitão, E.; Sousa, S.; Cabanes, D. The arsenal of virulence factors deployed by Listeria monocytogenes to promote its cell infection cycle. Virulence 2011, 2, 379−394. (14) Kreft, J.; Vázquez-Boland, J. A. Regulation of virulence genes in Listeria. Int. J. Med. Microbiol. 2001, 291, 145−157. (15) Dussurget, O.; Pizarro-Cerda, J.; Cossart, P. Molecular determinants of Listeria monocytogenes virulence. Annu. Rev. Microbiol. 2004, 58, 587−610. (16) Vazquez-Boland, J. A.; Kuhn, M.; Berche, P.; Chakraborty, T.; Dominguez-Bernal, G.; Goebel, W.; Gonzalez-Zorn, B.; Wehland, J.; Kreft, J. Listeria pathogenesis and molecular virulence determinants. Clin. Microbiol. Rev. 2001, 14, 584−640. (17) Leimeister-Wächter, M.; Haffner, C.; Domann, E.; Goebel, W.; Chakraborty, T. Identification of a gene that positively regulates expression of listeriolysin, the major virulence factor of Listeria monocytogenes. Proc. Natl. Acad. Sci. U.S.A. 1990, 87, 8336−8340. (18) Chakraborty, T.; Leimeister-Wächter, M.; Domann, E.; Hartl, M.; Goebel, W.; Nichterlein, T.; Notermans, S. Coordinate regulation of virulence genes in Listeria monocytogenes requires the product of the prfA gene. J. Bacteriol. 1992, 174, 568−574. (19) Mengaud, J.; Dramsi, S.; Gouin, E.; Vazquez-Boland, J. A.; Milon, G.; Cossart, P. Pleiotropic control of Listeria monocytogenes virulence factors by a gene that is autoregulated. Mol. Microbiol. 1991, 5, 2273−2283. (20) de las Heras, A.; Cain, R. J.; Bielecka, M.; Vázquez-Boland, J. A. Regulation of Listeria virulence: PrfA master and commander. Curr. Opin. Microbiol. 2011, 14, 118−127. (21) Scortti, M.; Monzo, H. J.; Lacharme-Lora, L.; Lewis, D. A.; Vazquez-Boland, J. A. The PrfA virulence regulon. Microbes Infect. 2007, 9, 1196−1207. (22) Dramsi, S.; Lebrun, M.; Cossart, P. Molecular and genetic determinants involved in invasion of mammalian cells by Listeria monocytogenes. Cur. Top. Microbiol. Immunol. 1996, 209, 61−77. (23) Park, S. F.; Stewart, G. S.; Kroll, R. G. The use of bacterial luciferase for monitoring the environmental regulation of expression of genes encoding virulence factors in Listeria monocytogenes. J. Gen. Microbiol. 1992, 138, 2619−2627. (24) Milenbachs, A. A.; Brown, D. P.; Moors, M.; Youngman, P. Carbon-source regulation of virulence gene expression in Listeria monocytogenes. Mol. Microbiol. 1997, 23, 1075−1085. (25) Renzoni, A.; Klarsfeld, A.; Dramsi, S.; Cossart, P. Evidence that PrfA, the pleiotropic activator of virulence genes in Listeria 6055



Article

applied to quantitative proteomics of Bacillus subtilis. J. Proteome Res. 2010, 9, 3638−3646. (42) Premaratne, R. J.; Lin, W. J.; Johnson, E. A. Development of an improved chemically defined minimal medium for Listeria monocytogenes. Appl. Environ. Microbiol. 1991, 57, 3046−3048. (43) Arnaud, M.; Chastanet, A.; Débarbouillé, M. New vector for efficient allelic replacement in naturally nontransformable, low-GCcontent, Gram-positive bacteria. Appl. Environ. Microbiol. 2004, 70, 6887−6891. (44) Macek, B.; Gnad, F.; Soufi, B.; Kumar, C.; Olsen, J. V.; Mijakovic, I.; Mann, M. Phosphoproteome analysis of E. coli reveals evolutionary conservation of bacterial Ser/Thr/Tyr phosphorylation. Mol. Cell. Proteomics 2007, 7, 299−307. (45) Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248−254. (46) Shevchenko, A.; Tomas, H.; Havlis, J.; Olsen, J. V.; Mann, M. In-gel digestion for mass spectrometric characterization of proteins and proteomes. Nat. Protoc. 2006, 1, 2856−2860. (47) Vizcaíno, J. A.; Deutsch, E. W.; Wang, R.; Csordas, A.; Reisinger, F.; Ríos, D.; Dianes, J. A.; Sun, Z.; Farrah, T.; Bandeira, N.; Binz, P. A.; Xenarios, I.; Eisenacher, M.; Mayer, G.; Gatto, L.; Campos, A.; Chalkley, R. J.; Kraus, H. J.; Albar, J. P.; Martinez-Bartolomé, S.; Apweiler, R.; Omenn, G. S.; Martens, L.; Jones, A. R.; Hermjakob, H. ProteomeXchange provides globally co-ordinated proteomics data submission and dissemination. Nat. Biotechnol. 2014, 30, 223−226. (48) Cox, J.; Mann, M. MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nat. Biotechnol. 2008, 26, 1367−1372. (49) Cox, J.; Neuhauser, N.; Michalski, A.; Scheltema, R. A.; Olsen, J. V.; Mann, M. Andromeda: a peptide search engine integrated into the MaxQuant environment. J. Proteome Res. 2011, 10, 1794−1805. (50) Schreiber, T. B.; Mäusbacher, N.; Soroka, J.; Wandinger, S. K.; Buchner, J.; Daub, H. Global analysis of phosphoproteome regulation by the Ser/Thr phosphatase Ppt1 in Saccharomyces cerevisiae. J. Proteome Res. 2012, 11, 2397−2408. (51) Yu, N. Y.; Wagner, J. R.; Laird, M. R.; Melli, G.; Rey, S.; Lo, R.; Dao, P.; Sahinalp, S. C.; Ester, M.; Foster, L. J.; Brinkman, F. S. L. PSORTb 3.0: improved protein subcellular localization prediction with refined localization subcategories and predictive capabilities for all prokaryotes. Bioinformatics 2010, 26, 1608−1615. (52) Szklarczyk, D.; Franceschini, A.; Kuhn, M.; Simonovic, M.; Roth, A.; Minguez, P.; Doerks, T.; Stark, M.; Muller, J.; Bork, P.; Jensen, L. J.; von Mering, C. The STRING database in 2011: functional interaction networks of proteins, globally integrated and scored. Nucleic Acids Res. 2011, 39, D561−D568. (53) Welch, M. D.; Rosenblatt, J.; Skoble, J.; Portnoy, D. A.; Mitchison, T. J. Interaction of human Arp2/3 complex and the Listeria monocytogenes ActA protein in actin filament nucleation. Science 1998, 281, 105−108. (54) Galinier, A.; Haiech, J.; Kilhoffer, M. C.; Jaquinod, M.; Stülke, J.; Deutscher, J.; Martin-Verstraete, I. The Bacillus subtilis crh gene encodes a HPr-like protein involved in carbon catabolite repression. Proc. Natl. Acad. Sci. U.S.A. 1997, 94, 8439−8444. (55) Takenawa, T.; Suetsugu, S. The WASP−WAVE protein network: connecting the membrane to the cytoskeleton. Nat. Rev. Mol. Cell. Biol. 2007, 8, 37−48. (56) Marchand, J. B.; Kaiser, D. A.; Pollard, T. D.; Higgs, H. N. Interaction of WASP/Scar proteins with actin and vertebrate Arp2/3 complex. Nat. Cell Biol. 2001, 3, 76−82. (57) Rohatgi, R.; Ma, L.; Miki, H.; Lopez, M.; Kirchhausen, T.; Takenawa, T.; Kirschner, M. W. The interaction between N-WASP and the Arp2/3 complex links Cdc42-dependent signals to actin assembly. Cell 1999, 97, 221−231. (58) Brundage, R. A.; Smith, G. A.; Camilli, A.; Theriot, J. A.; Portnoy, D. A. Expression and phosphorylation of the Listeria monocytogenes ActA protein in mammalian cells. Proc. Natl. Acad. Sci. U.S.A. 1993, 90, 11890−11894.

(59) Chong, R.; Swiss, R.; Briones, G.; Stone, K. L.; Gulcicek, E. E.; Agaisse, H. Regulatory mimicry in Listeria monocytogenes actin-based motility. Cell Host Microbe 2009, 6, 268−278. (60) Schauer, K.; Geginat, G.; Liang, C.; Goebel, W.; Dandekar, T.; Fuchs, T. M. Deciphering the intracellular metabolism of Listeria monocytogenes by mutant screening and modelling. BMC Genomics 2010, 11, 573. (61) Faith, N. G.; Kim, J.-W.; Azizoglu, R.; Kathariou, S.; Czuprynski, C. Purine biosynthesis mutants (purA and purB) of serotype 4b Listeria monocytogenes are severely attenuated for systemic infection in intragastrically inoculated A/J mice. Foodborne Pathog. Dis. 2012, 9, 480−486. (62) Sun, Y.; O’Riordan, M. X. D. Branched-chain fatty acids promote Listeria monocytogenes intracellular infection and virulence. Infect. Immun. 2010, 78, 4667−4673. (63) Alonzo, F.; Port, G. C.; Cao, M.; Freitag, N. The posttranslocation chaperone PrsA2 contributes to multiple facets of Listeria monocytogenes pathogenesis. Infect. Immun. 2009, 77, 2612− 2623. (64) Zemansky, J.; Kline, B. C.; Woodward, J.; Leber, J. H.; Marquis, N.; Portnoy, D. A. Development of a mariner-based transposon and identification of Listeria monocytogenes determinants, including the peptidyl-prolyl isomerase PrsA2, that contribute to its hemolytic phenotype. J. Bacteriol. 2009, 191, 3950−3964. (65) Alonzo, F.; Freitag, N. Listeria monocytogenes PrsA2 is required for virulence factor secretion and bacterial viability within the host cell cytosol. Infect. Immun. 2010, 78, 4944−4957. (66) Forster, B. M.; Zemansky, J.; Portnoy, D. A.; Marquis, H. Posttranslocation chaperone PrsA2 regulates the maturation and secretion of Listeria monocytogenes proprotein virulence factors. J. Bacteriol. 2011, 193, 5961−5970. (67) Larsen, M. H.; Kallipolitis, B. H.; Christiansen, J. K.; Olsen, J. E.; Ingmar, H. The response regulator ResD modulates virulence gene expression in response to carbohydrates in Listeria monocytogenes. Mol. Microbiol. 2006, 61, 1622−1635. (68) Mathews, I. I.; Krishna, S. S.; Schwarzenbacher, R.; McMullan, D.; Jaroszewski, L.; Miller, M. D.; Abdubek, P.; Agarwalla, S.; Ambing, E.; Axelrod, H. L.; Canaves, J. M.; Carlton, D.; Chiu, H. J.; Clayton, T.; DiDonato, M.; Duan, L.; Elsliger, M. A.; Grzechnik, S. K.; Hale, J.; Hampton, E.; Haugen, J.; Jin, K. K.; Klock, H. E.; Koesema, E.; Kovarik, J. S.; Kreusch, A.; Kuhn, P.; Levin, I.; Morse, A. T.; Nigoghossian, E.; Okach, L.; Oommachen, S.; Paulsen, J.; Quijano, K.; Reyes, R.; Rife, C. L.; Spraggon, G.; Stevens, R. C.; Van den Bedem, H.; White, A.; Wolf, G.; Xu, Q.; Hodgson, K. O.; Wooley, J.; Deacon, A. M.; Godzik, A.; Lesley, S. A.; Wilson, I. A. Crystal structure of phosphoribosylformyl-glycinamidine synthase II, PurS subunit (TM1244) from Thermotoga maritima at 1.90 Å resolution. Proteins 2006, 65, 249−254. (69) Madec, E.; Stensballe, A.; Kjellstrom, S.; Cladiere, L.; Obuchowski, M.; Jensen, O. N.; Séror, S. J. Mass spectrometry and site-directed mutagenesis identify several autophosphorylated residues required for the activity of PrkC, a Ser/Thr kinase from Bacillus subtilis. J. Mol. Biol. 2003, 330, 459−472. (70) Lima, A.; Durán, R.; Schujman, G.; Marchissio, M. J.; Portela, M. M.; Obal, G.; Pritsch, O.; Mendoza, D. G.; Cerveñansky, C. Serine/ threonine protein kinase PrkA of the human pathogen Listeria monocytogenes: biochemical characterization and identification of interacting partners through proteomic approaches. J. Proteomics 2011, 74, 1720−1734. (71) Macek, B.; Mijakovic, I.; Olsen, J. V.; Gnad, F.; Kumar, C.; Jensen, P. R.; Mann, M. The serine/threonine/tyrosine phosphoproteome of the model bacterium Bacillus subtilis. Mol. Cell. Proteomics 2007, 6, 697−707. (72) Soufi, B.; Gnad, F.; Jensen, P. R.; Petranovic, D.; Mann, M.; Mijakovic, I.; Macek, B. The Ser/Thr/Tyr phosphoproteome of Lactococcus lactis IL1403 reveals multiply phosphorylated proteins. Proteomics 2008, 8, 3486−3493. 6056



Article

(73) Eylert, E.; Schär, J.; Mertins, S.; Stoll, R.; Bacher, A.; Goebel, W.; Eisenreich, W. Carbon metabolism of Listeria monocytogenes growing inside macrophages. Mol. Microbiol. 2008, 69, 1008−1017. (74) Eisenreich, W.; Dandekar, T.; Heesemann, J.; Goebel, W. Carbon metabolism of intracellular bacterial pathogens and possible links to virulence. Nat. Rev. Microbiol. 2010, 8, 401−412.

6057


Quantitative Proteome Analyses Identify PrfA-Responsive Proteins

Recommend Documents