Quantitative Proteome Analysis Reveals RNA Processing Factors As

Article pubs.acs.org/jpr

Quantitative Proteome Analysis Reveals RNA Processing Factors As Modulators of Ionizing Radiation-Induced Apoptosis in the C. elegans Germline. Gisele G. Tomazella,† Henok Kassahun,† Hilde Nilsen, and Bernd Thiede* The Biotechnology Centre of Oslo, University of Oslo, Norway S Supporting Information *

ABSTRACT: The nematode Caenorhabditis elegans is an organism most recognized for forward and reverse genetic and functional genomic approaches. Proteomic analyses of DNA damage-induced apoptosis have not been shown because of a limited number of cells undergoing apoptosis. We applied mass spectrometry-based quantitative proteomics to evaluate protein changes induced by ionizing radiation (IR) in isolated C. elegans germlines. For this purpose, we used isobaric peptide termini labeling (IPTL) combined with the data analysis tool IsobariQ, which utilizes MS/MS spectra for relative quantification of peak pairs formed during fragmentation. Using stringent statistical critera, we identified 48 proteins to be significantly up- or downregulated, most of which are part of a highly interconnected protein−protein interaction network dominated by proteins involved in translational control. RNA-mediated depletion of a selection of the IR-regulated proteins revealed that the conserved CAR-1/ CGH-1/CEY-3 germline RNP complex acts as a novel negative regulator of DNA-damage induced apoptosis. Finally, a central role of nucleolar proteins in orchestrating these responses was confirmed as the H/ACA snRNP protein GAR-1 was required for IR-induced apoptosis in the C. elegans germline. KEYWORDS: apoptosis, C. elegans, germline, IPTL, quantitative proteomics

■

INTRODUCTION Apoptosis is a genetically determined form of programmed cell death and is important for many physiological aspects including embryonic development, maintenance of tissue homeostasis, establishment of immune self-tolerance, and killing by effector cells.1 Defects in the apoptotic machinery are implicated in the etiology of a number of diseases, including cancer, autoimmunity, immune deficiencies, and neurodegenerative disorders.2 A cell lineage study in Caenorhabditis elegans demonstrating that 131 out of the 1090 somatic cells undergo apoptosis during development paved the way for genetic characterization of apoptosis.3,4 A central step in the execution of apoptosis is the activation of caspases. The CED-3 caspase was first identified as an effector of apoptosis in a screen for C. elegans mutants lacking developmental programmed cell death.5 Later, human homologues of CED-3 were identified, and conversely, many human genes that regulate programmed cell death have orthologs in C. elegans.6 Apoptosis may also be induced in response to DNA damage; however, DNA damage-induced apoptosis in C. elegans is restricted to the pachytene region of the adult germline.6 CEP-1, the C. elegans ortholog of p53, is a central transcriptional activator required for DNA-damage induced apoptosis.7 Microarray-based gene expression profiling studies designed to identify novel IR-regulated genes identified two previously known C. elegans p53/CEP-1 targets genes but a limited number of new CEP-1 targets.8,9 This is in line with the © 2012 American Chemical Society

increasing awareness that the DNA damage response (DDR) is rarely regulated on the transcriptomic level. Instead, translational control or post-translational modifications (PTMs) are involved under conditions of cellular stress because they allow immediate and selective changes in protein levels and protein species, respectively.8 Mass spectrometry (MS)-based proteomics10 has been used to characterize different organisms, ranging in complexity from bacteria to yeast and mammalian cell lines. The recent progress in liquid chromatography and mass spectrometry and the development of quantitative techniques have resulted in several comprehensive functional proteomic studies dissecting the molecular mechanisms that regulate signal transduction pathways.11 Although several quantitative proteomic studies of C. elegans have been performed,12−15 none was previously carried out for the analysis of apoptosis. An important factor contributing to this is the technical difficulty of obtaining sufficient amounts of material, as only a small number of cells undergo apoptosis at any time in adult tissues. Notably, since DNA damage-induced apoptosis is restricted to relatively few germline cells in the adult worm, a large scale study of IRinduced apoptosis using whole worm extracts is less likely to identify apoptosis-specific changes. A targeted approach to Received: April 24, 2012 Published: July 3, 2012 4277

dx.doi.org/10.1021/pr300386z | J. Proteome Res. 2012, 11, 4277−4288

Journal of Proteome Research

Article

and CTGGCATACGTCTTGAATCC; tbg-1 AAGATCTATTGTTCTACCAGGC and CTTGAACTTCTTGTCCTTGAC.

identify proteomic-level changes in response to IR in isolated germlines is therefore required. Here, we present the first proteome analysis of apoptotic vs nonapoptotic C. elegans germline using isobaric peptide termini labeling (IPTL)16 combined with the software tool IsobariQ.17 Using stringent criteria, we identified 839 germline proteins, of which 48 were differentially expressed upon IR, and verifying some proteins not previously related to apoptosis in any organism.

■

Protein Extraction and Separation

For extraction of total protein from C. elegans germlines, young gravid worms were dissected from control and irradiated worms after 24 h of recovery. Approximately 300 germlines were dissected on poly- L-lysine coated slides in egg buffer supplemented with 0.1% Tween 20 and 0.2 mM levamisol. Isolated germlines were lysed in 1% Triton X-100, 25 mM TrisHCl, 50 mM KCl, 3 mM EDTA, and 5 mM β-mercaptoethanol, pH 7.1 supplemented with protease (3 mM benzamidine, 10 mM leupeptin and 1 mM PMSF) and phosphatase inhibitors (30 mM NaF, 1 mM Na3VO4, 20 mM Na4P2O7). The lysates were submitted to freeze−thaw cycles and subsequently clarified by centrifugation at 15 000g and 4 °C. Supernatants were stored at −80 °C until use. Four independent experiments were performed for each condition. For whole worm protein extracts, worms were resuspended in worm lysis buffer (40 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.05%, NP-40, 2 mM EDTA, and protease inhibitor cocktail, Roche) along with 1.0 mm zirconia/silica beads (BioSpec product) and subjected to bead beating three times at maximum speed for 30 s with 1 min pause between cycles. The extracts were spun at 14 000 rpm for 30 min at 4 °C. The collected supernatant was quantified using the Bio-Rad Protein Assay (Bio-Rad Oslo, Norway). Equal amounts of protein extracts were separated by SDS-PAGE with 4% stacking gel and 10% separation gel using a Mini-Protean 3 cell (Bio-Rad, Oslo, Norway). Gels were stained with Coomassie Brilliant Blue G250 (Serva, Heidelberg, Germany) employing the blue silver staining technique19 with modifications as previously described.20

EXPERIMENTAL PROCEDURES

C. elegans Strains, Culture Conditions, and Apoptosis Induction

The reference strain Bristol N2 and MD701 (Plim‑7ced-1::gf p) were obtained from the Caenorhabditis Genetics Center (University of Minnesota, USA). The worms were cultured and maintained at 20 °C using standard procedures with E. coli OP50 as food source. For assessment of DNA damage induced apoptosis in the germline, synchronized L4 hermaphrodites were irradiated with 125 Gy of IR in M9 buffer in a MDS Nordion Gammacell 3000 Elan. Apoptotic corpses were visualized under differential interference contrast (DIC) microscopy using a Zeiss Axiovert 200 M inverted microscope with x100 Plan-Apochromat 1.45 NA objective. For functional validation, the CED-1::GFP reporter strain was grown for 1−3 generations on E. coli HT115(DE3) expressing the empty vector control RNAi (L4440) or the RNAi directed against the indicated genes on NGM plates containing 2 mM IPTG. C. elegans Immunofluorescence

Germline immunostaining was carried out as previously described.9 Primary antibodies were used at the following dilutions: 1:200 rabbit anti-RAD-51, rat 1:200 anti-RPA-1 (both kindly donated by Anton Gartner from the University of Dundee), 1:400 antirabbit histone H3 (pSer-10) (Santa Cruz Biotechnology Inc., Santa Cruz, USA), and 1:100 rabbit antiCDK1 (pTyr-15) (VWR, Oslo, Norway). The following secondary antibodies were used for detection: Cy3 conjugated antirabbit (Sigma-Aldrich, St. Louis, USA), at 1:10 000 and 1:1000 for detection of RAD-51 and CDK-1, respectively, and 1:1000 Alexa 488 conjugated antirat (Invitrogen, Carlsbad, USA). The slides were imaged using a Zeiss LSM-510 confocal microscope with ×63 Plan-Apochromat 1.4 NA objective.

Lys-C Digestion and Isobaric Peptide Termini Labeling (IPTL)

Each SDS-PAGE gel lane was cut into 12 fractions for in-gel digestion with 0.06 μg of Lys-C (Sigma-Aldrich, Oslo, Norway) in 25 mM Tris, 1 mM EDTA, and pH 8 for 16 h at 37 °C. For each band, the Lys-C-produced peptides were purified with μC18 ZipTips (Millipore, Billerica, MA) and dried using a Speed Vac concentrator (Savant, Holbrook, USA). IPTL was performed according to Koehler et al. 2011.16 Briefly, purified and dried Lys-C peptide digests were suspended in 20 mM succinic anhydride (Sigma-Aldrich, Oslo, Norway) for control samples and in tetradeuterated succinic anhydride-d4 (Larodan Fine Chemicals AB, Malmö, Sweden) for apoptotic samples in 50 mM sodium acetate. To the N-terminal succinylated peptides, 200 mM triethylammonium bicarbonate was directly mixed, followed by 4% formaldehyde (control) and dideuterated formaldehyde-d2 (apoptotic samples only) in water, and 600 mM sodium cyanoborohydride in both control and apoptotic samples. Subsequently, 8 μL of 1% ammonium hydroxide was added and incubated for one minute, followed by adding 4 μL of 5% formic acid to quench the dimethylation. In parallel, 1 pmol BSA was used as a control in both N-terminal peptide succinylation and dimethylation of lysine residues. Labeled peptides were purified with μ-C18 ZipTips (Millipore, Billerica, MA) and dried using a Speed Vac concentrator (Savant, Holbrook, USA).

Quantitative Real-Time RT-PCR

Transcriptional activation of C. elegans ced-13 and egl-1 was measured in synchronized L4 hermaphrodites both before and after irradiation. RNA was isolated as previously described18 for each condition after disrupting the worms in TRIZOL with 0.7 mm zirconia/silica beads (Biospec Products, Bartlesville, USA) using a Mini-Beadbeater 8 (Biospec Products, Bartlesville, USA) at maximum speed for 30 s. cDNA synthesis was performed using iScript cDNA synthesis kit (Bio-Rad, Hercules, USA) according to the manufacturer’s instructions. Quantitative PCR (qPCR) was performed with SYBR Green supermix (Bio-Rad, Hercules, USA) starting at 95 °C for 30 s followed by 50 cycles at 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s. ced-13 and egl-1 transcript levels were normalized to an internal tubulin (tbg-1) control. Primers (MedProbe, Oslo, Norway) with the following sequences (5′ to 3′ direction) were used for amplification: egl-1 CCTCAACCTCTTCGGATCTT′ and TGCTGATCTCAGAGTCATCAA; ced-13 GCTCCCTGTTTATCACTTCTC 4278



Article

Figure 1. DNA damage-induced apoptosis. Hermaphrodites were irradiated for 30 min and left to recover on OP50-seeded plates for 24 h. Apoptosis was confirmed by (A) DIC of the loop area in the pachytene region in nonirradiated control (left panel) and after irradiation indicated by arrows (right panel), (B) appearance of CED-1::GFP positive apoptotic corpses, (C) confocal images of germlines (scale bars, 20 μm) stained with antibodies detecting RPA-1 and RAD-51 in the mitotic region, and (D) phosphorylated (Ser10) histone 3 (PH3, upper panel) and phosphorylated (Tyr15) CDK-1 (lower panel), showing that G2/M phase cell cycle is executed after irradiation. DNA was stained with 4′,6-diamidino-2phenylindole (DAPI). (E) Trancriptional activation of the CEP-1 responsive genes ced-13 and egl-1 expression in response to IR measured by qRTPCR. Relative mRNA levels of ced-13 and egl-1 transcript levels were normalized to an internal tubulin (tbg-1) control.

Mass Spectrometry

Database Searches and Analysis

The dried peptides were dissolved in 1% formic acid, 5% acetonitrile in water, mixed in a 1:1 ratio (control:apoptotic) and injected into an Ultimate 3000 nanoLC system (Dionex, Sunnyvale CA, USA) connected to an LTQ Orbitrap XL mass spectrometer (ThermoScientific, Bremen, Germany). Column dimensions, LC buffer and gradient, and other instrument parameters were as previously described.21 An Ultraflex II (Bruker Daltonics, Bremen, Germany) matrixassisted laser desorption ionization tandem time-of-flight (MALDI-TOF/TOF) mass spectrometer was used after external calibration as previously described22 to follow the reactions of BSA control samples.

Raw LTQ Orbitrap XL data were processed using DtaSuperCharge version 1.37 to generate peak lists in *.mgf format. A database search was performed using an in-house Mascot search engine tool version 2.2.1 to search from Wormpep 221 [www.wormbase.org], containing 194 666 sequences from 24 890 proteins. Lys-C was set as enzyme, no missed cleavage site, a tolerance of 10 ppm for the precursor ion and 0.6 Da for the MS/MS fragments, methionine oxidation and N-terminal protein acetylation as variable modifications were selected. The two corresponding modifications N-terminal succinylation/lysine dimethylation-d4 or N-terminal succinylation-d4/ lysine dimethylation, respectively, were set as variable 4279



Article

cell engulfment marker CED-1 in fusion with GFP to visualize apoptotic corpses, we measured the kinetics of apoptotic cell death following IR. As expected, the peak of CED-1-positive apoptotic corpse formation was reached after a recovery period of 24 h (Figure 1B). Hence, all subsequent analyses were performed at this time point. To confirm activation of the IRinduced checkpoint as expected under these conditions, the germlines were immunostained with known markers of DNA damage response activation. RPA-1, used to visualize the formation of the long stretches of single stranded DNA that is a requirement for checkpoint activation, and RAD-51, a marker for DNA double stranded breaks, were both recruited to chromatin after IR (Figure 1C). Moreover, staining with antihistone H3 (phosphoserine 10) and anti-CDK-1 (phosphotyrosine 15) antibodies, showed that G2/M phase cell cycle arrest was activated (Figure 1D). The appearance of markers of DNA damage checkpoint activation is expected to lead to activation of the C. elegans p53 ortholog CEP-1. CEP-1 is responsible for the transcriptional activation of the BH3-only domain proteins EGL-1 and CED-13, which leads to the activation of the core apoptotic machinery by inhibiting the function of CED-9 (Bcl-2 homologue) and thereby activating CED-3/caspase.29 Transcriptional up-regulation of ced-13 and egl-1 determined by qRT-PCR confirmed IR-induced CEP-1 activation (Figure 1E). Hence, the irradiated germlines, but not the control germlines, contained excessive numbers of apoptotic cells at the time of harvest.

modifications including neutral loss as satellite of 4.028204 Da (2H(2)) for N-terminal succinylation-d4 and lysine dimethylation-d4 and neutral loss as satellite of −4.028204 Da (2H(−2)) for N-terminal succinylation and lysine dimethylation. Protein identification and validation was performed using the IsobariQ software17 including the force-find algorithm16 to mine the spectra where Mascot failed to identify opposite sequences. No sequence suggestion below a Mascot ion score of 10 was allowed. Proteins were loaded if a minimum of two peptides and the significance of p < 0.05 were achieved. The minimal number of ratios for force-find hits was set to 4. The data were quantified with the following options: Protein scoring was set to MudPit and the MS/MS tolerance to 0.6 Da. Bold peptides (Mascot option) were required for the quantification, and unique and razor peptides were used. The “normalize rawfiles independently” checkbox was checked, and the data were quantified using VSN normalization.23 Western Analysis

Equal amounts of protein extracts were separated by NuPAGE 4−12% Bis-Tris Gel in MES (2(N-morpholino)ethanesulfonic acid) buffer (Invitrogen, Carlsbad, USA) and transferred onto PVDF membranes (Immobilon P, Millipore, Oslo, Norway) using a Mini Trans-Blot cell (Bio-Rad, Munich, Germany). Primary antibodies for Western blot analysis were used as follows: rabbit anti-GLH-1 (kindly donated by Karen L. Bennett, University of Columbia, USA), rabbit anti-CGH-1 (kindly donated by Keith Blackwell, Harvard Medical School, USA), rabbit anti-D2096.8 (kindly donated by John R. Yates III, The Scripps Research Institute, USA), rabbit-anti PHB-1 (Santa Cruz Biotechnology Inc., Santa Cruz, USA), and rabbit anti-α-actin (Abcam, Cambridge, UK). As secondary antibody, HRP-conjugated antirabbit IgG (Sigma-Aldrich, St. Louis, USA) was used. Membranes were developed by SuperSignal West Pico Chemiluminescence (VWR, Oslo, Norway).

Quantitative Proteomic Analysis Using IPTL and LC−MS/MS

The outline of the proteomic approach is shown in Figure 2. Manually dissected germlines from about 300 control and apoptotic worms in each of four biological replicates were isolated. The extracted proteins were separated by SDS-PAGE, the lanes sliced into 12 fractions, and the proteins were subsequently in-gel digested with endoproteinase Lys-C. Applying the IPTL approach, peptides derived from two different samples are crosswise labeled at the N-terminus and at the C-terminus with isotopically labeled reagents that have identical mass differences. Consequently, the IPTL approach permits relative quantification using quantification points distributed throughout the whole MS/MS spectrum. After mixing the corresponding samples at a 1:1 ratio, they were analyzed by reversed-phase C18 nanoflow liquid chromatography coupled to high resolution mass spectrometry. Isobaric masses from the pooled double-labeled peptides resulted in single peaks in MS acquisition mode. The relative quantitative abundance of the peptides were detected by the ion intensities of peptide fragment ions pairs with mass shifts corresponding to tetradeuterium (4.0 Da) in the MS/MS spectrum. To determine the ratios of the relative peptide quantity, the software tool IsobariQ was used after automatic decoy database searches performed with Mascot. False discovery rates for peptide matches above an identity threshold were 3.08, 3.38, 3.33, and 3.35%, respectively, for the four replicates. Using the IsobariQ software for quantification analysis, the reproducibility of the results between the replicates were evaluated by the distribution of normalized protein ratios (apoptotic/control) (Figure 3A) and by the distribution of quantification point intensities (Figure 3B), i.e., the relationship between the IPTL fragment ratios between apoptotic and control, where the 1:1 regulation is shown by a black line. The average number of quantification points per protein was 33,

Conservation and Gene Ontology (GO) Analysis

To derive homologous proteins between C. elegans and humans, we used BLASTP24 to convert the WormBase entries to Swiss-Prot human entries, and the resulting Swiss-Prot accession number or Swiss-Prot gene name was searched in the ApoptoProteomics database,25 which is available at http:// apoptoproteomics.uio.no. Functional classification of the differential proteins or genes was performed using Cytoscape26 version 2.7.0 with the plug-in BiNGO27 version 2.42 (available at http://www.psb.ugent.be/ cbd/papers/BiNGO) for visualization of GO overrepresentation analysis. BiNGO analysis was performed using GO_Biological _Processes as ontology file, the up- and down-regulated proteins identified in the present study as reference set for annotation, and C. elegans was selected as organism. Protein−protein interactions were predicted using STRING28 version 9.0 (available at http://string-db.org). Direct associations (no interactors) of the differential proteins, in addition to CEP-1/p53, were visualized with medium confidence (0.400), and C. elegans was set as organism.

■

RESULTS

DNA Damage Responses After IR

IR leads to induction of apoptosis in the C. elegans germline. Dying cells are readily distinguishable by their characteristic disk-shaped morphology as shown by DIC microscopy (Figure 1A). Using a transgenic marker strain expressing an apoptotic 4280



Article

CED-3 targets.31 As CED-3 is the only effector caspase in C. elegans, it is possible that novel caspase targets were identified (Table 1). The statistical analysis for the whole data set, such as replicate standard deviation, z-score and significance, can be found in Supporting Information Table S1. The comprehensive analysis of the identified peptides and proteins from the whole data set is available in Supporting Information Tables S2 and S3, containing information such as sequences, length, mass and charge of the peptides, protein group to which a peptide belongs, and normalized ratios. Validation of Protein Regulation

To validate our proteomic data, we analyzed the protein content of the control and apoptotic germlines by Western blotting of proteins for which antibodies were available (Figure 4B). Confirming the findings from the proteomic analysis, the Western blot analysis of the germline revealed that the C. elegans apoptosis-related protein CGH-1, which is known to negatively regulate physiological apoptosis in the germline,32 and GLH-1, a P-granule component associated with germ cell proliferation, were down-regulated after IR treatment. In addition, the C. elegans homologue of human prohibitin, PHB-1, which has been related to apoptosis in human cells, but not in C. elegans, and D2096.8, a protein homologue to human nucleosome assembly protein 1-like 1 were up-regulated. It is important to note that similar changes were not reproduced in whole-worm extracts where only D2096.8 showed expression change relative to the α-actin loading control (Figure 4B and 4C). This illustrates the importance of using germline rather than whole worm extracts for proteome studies of apoptosis in C. elegans.

Figure 2. Quantitative proteome analysis using IPTL. Four replicates of control and apoptotic C. elegans germline protein extracts were independently fractionated by SDS-PAGE, digested with Lys-C, and peptides were crosswise labeled using the IPTL approach. Resulting peptide mixtures were combined 1:1 before submission to LC−MS/ MS and quantitatively analyzed by the software tool IsobariQ.

Comparison of Proteomics Data with Transcriptomics and GO Term Overrepresentation

sufficiently high to infer an accurate and robust estimate of the protein ratio. As an example, an MS/MS spectrum of a selected peptide labeled with IPTL is shown (Figure 3C). The Mascot search engine identified this spectrum as the peptide VHMVAIDIFTTK, present in the protein T05G5.10 (eukaryotic translation initiation factor 5A-1). Besides the N-terminal succinylated/lysine dimethylated-d4 and N-terminal succinylated-d4/lysine dimethylated pairs, Figure 3C also illustrates the fragmentation pattern, the identification of b- and y-series of the sequence and seven quantification points. In total, we were able to identify 839 proteins, which correspond to about 18% of the genes known to be expressed in the C. elegans germline.30 After stringent statistical analysis, a protein was considered differentially expressed if it was quantified in at least two replicates and if its ratio varied 40% or less (coefficient of variation (CV) ≤ 40) between the replicates. Figure 4A shows the protein fold change (apoptotic/ control) plotted against the coefficient of variation (CV) in the analysis. From the quantified proteins, we identified 48 proteins to be significantly up- or down-regulated with a 1.5 fold change as threshold for protein differentiation. Because of the high homology between C. elegans and humans, we compared the regulated proteins with the ApoptoProteomics database (http://apoptoproteomics.uio.no), which compiles data linked to proteome analyses of apoptosis in human, mouse, and rat. We found that 28 out of 48 homologous proteins were also reported in previous apoptosis-induced proteomic studies in mammals (Table 1). Probably because of the technical difficulty of isolating the apoptotic cells in C. elegans, only three of them (TCP-1, CRT-1, and NAP-1) were previously reported as

Previous studies have measured IR-induced gene expression in C. elegans at the mRNA level.9,33 Greiss et al. examined the C. elegans expression profiles using whole genome Affymetrix GeneChip arrays upon IR but found a surprisingly small number of genes regulated by CEP-1. Many studies using comparative genomic and proteomic profiling of cells have documented a lack of correlation between the mRNA and protein levels.34−36 It was therefore not unexpected that we failed to demonstrate a correlation between the regulated genes and proteins (R2 = 0.5659) when comparing our proteomic analysis with the genome-wide gene expression analysis9 (Supporting Information Figure S2A). This is consistent with the fact that DDR is mostly regulated on the levels of translation or by PTMs rather than at the transcriptome level. When specifically searching for the differential proteins identified by proteomics in the transcriptomics data set, we observed that they had ratio levels of around 1:1, which confirmed that these proteins acting in the DDR are primarily regulated on the protein level. As transcriptomics failed to identify 48% of the proteins identified by the proteomic approach, however, the methodologies likely complement each other (Supporting Information, Figure S2B). A GO term overrepresentation analysis was performed to further analyze the data set of regulated proteins (Supporting Information, Figure S1A). As expected, proteins annotated as participating in antiapoptotic processes were down-regulated (CRT-1, CGH-1, and GLH-1). Other biological processes enriched among the regulated proteins included development, growth, metabolism, and biosynthesis. However, these 4281



Article

Figure 3. IsobariQ output of quantitative proteome data. (A) Distribution of normalized protein ratios (apoptotic/control), with the number of quantified proteins in each replicate are shown. (B) The distribution of intensities of quantification points is displayed. The black line represents 1:1 ratios, with the number of quantification points in each replicate. (C) N-terminal succinylated/lysine dimethylated-d4 (orange) and N-terminal succinylated-d4/lysine dimethylated (blue) pairs (ratios input) from the MS/MS spectrum of a selected IPTL labeled peptide are depicted, which was identified by Mascot as VHMVAIDIFTTK (inset with the detected b- and y-series ions represented), present in the protein T05G5.10, the eukaryotic translation initiation factor 5A-1.

tional complex negatively regulates physiological germline apoptosis and is likely to be involved in translational control.32 CEY-3 directly couples this RNP complex to proteasomal and ribosomal subunits, possibly suggesting that CEY-3 could contribute to coordinate these different cellular processes in response to IR.

processes were mainly represented by down-regulation of 20S proteasome core particle components (PAS-1, PAS-5, PAS-6, and PBS-7), mitochondrial proteins (F45H10.2, H14A12.2, PHB-1, TUFM-1, and Y22D7AL.10), and ribosomal proteins (K07C5.4, RPL-16, RPL-18, RPL-20, RPL-21, RPL-22, RPL-23, RPL-36, RPS-0, RPS-1, and RPS-9). The regulation of proteasomal and ribosomal proteins might reflect regulation of translation in response to IR, which is corroborated by changes in the levels of direct regulators of translation initiation (EGL-45, IFF-1) and elongation (EEF-1B.1 and TUFM-1). In light of the emerging connections between RNA biology and the DNA damage response,37 it is interesting to note that proteins with known or predicted functions in RNA biology were well represented among the regulated proteins (CGH-1, GAR-1, GLH-1, K01G5.5, K07C5.4, NOL-1, T07A9.9, and Y66H1.A).

RNA Processing Factors Modulate IR-Induced Germline Apoptosis

To test whether any of the regulated proteins identified here affected apoptosis, we assessed whether IR-induced apoptotic corpse formation was influenced by depleting selected proteins by RNAi. Only regulated proteins whose depletion did not severely affect germline development were analyzed (Supporting Information, Figure S3). Mitochondria are key components of apoptosis, and among the up-regulated proteins identified was prohibitin-1 (PHB-1), the homologue of human prohibitin, which is a mitochondrial protein involved in regulation of protein homeostasis. Controversy exists with respect to a possible function of prohibitin in apoptosis.38 Because depletion of PHB-1 did not lead to increased apoptotic corpse formation, a direct role of PHB-1 in regulation of apoptosis could not be validated (Figure 6A). In contrast, depletion of F45H10.2, a mitochondrial complex II (succinate/ubiquinone oxidoreductase) component,39 suppressed apoptosis induction (Figure 6A). Strikingly, three known components of a germline ribonucleoprotein complex containing CAR-1, CGH-1, and CEY-3 were identified as differentially expressed upon IR in our

Identification of a Highly Interconnected C. elegans Protein−Protein Interaction Network of Regulated Proteins during IR-Induced Germline Apoptosis

Further analysis of known or predicted interactions between the observed proteins identified during IR-induced germline apoptosis using the STRING protein−protein interaction database revealed a highly interconnected network that included 39 of the 48 regulated proteins (Figure 5). This C. elegans germline protein−protein interaction network consisted of three distinct nodes involving ribosomal proteins, proteasomal proteins, and the germline ribonucleoprotein (RNP) complex CGH-1, CAR-1, and CEY-3. This multifunc4282



Article

Figure 4. Protein distribution and validation. (A) A Volcano plot of protein fold change (apoptotic/control) as a function of coefficient of variation as indicated for control (orange) and apoptotic germline (violet) is presented. Proteins with fold change >1.5 were considered differentially expressed if they in addition showed low CV between replicates (CV ≤ 40%). Proteins with fold changes 40% are shown in gray. Values are mean normalized ratios of four separate preparation and MS experiments, and a protein was considered successfully quantified if it was quantified in at least two replicates. (B) Equal amounts of protein samples from control and apoptotic C. elegans germlines and control and apoptotic whole worms were subjected to SDS-PAGE and analyzed by Western blotting to further validate the proteomic analysis using primary antibodies against GLH-1, CGH-1, D2096.8 and PHB-1. (C) Comparison of protein regulation of GLH-1, CGH-1, D2096.8 and PHB-1 using either IPTL or Western blotting (WB) of both germlines and whole worms.

■

DISCUSSION Mass spectrometry-based proteomics has been significantly improved during the past decade because of the development of nanoflow-liquid chromatography and an increase of speed, sensitivity and accuracy of mass spectrometers. Furthermore, stable isotopic and isobaric labeling techniques enabled relative quantification as a major application in proteomics, and many strategies have been developed to achieve a robust and fast quantification of protein samples. In the present study, we used the IPTL approach combined with data analysis using IsobariQ to uncover specific changes in protein levels upon IR-induced apoptosis in the C. elegans germline. IPTL is the only relative quantification method that produces several quantification points for each peptide, and thus it is likely to increase robustness of the quantification procedure. Although several proteome analyses have been performed using C. elegans, none of them were performed to analyze apoptosis. Notably, we have shown here that the C. elegans germline is required to study apoptosis in this organism as the proteins identified that were validated to affect the number of apoptotic cells when depleted by RNAi only showed changes in protein levels in germline and not in the whole-worm extracts. The C. elegans germline also has the advantage that it may reflect tissue responses to IR, where responses in the cells undergoing apoptosis are shaped by the neighboring cells. Hence, this model would recapitulate the IR responses in a therapeutic setting. Overall, our data support an emerging understanding of apoptosis as part of a program of tissue responses that coordinate biochemical and morphological responses to various

data set (Table 1). Depletion of CAR-1, CGH-1, or CEY-3 all led to an increased number of CED-1::GFP positive apoptotic corpses in response to IR (Figure 6B), a strong indication that this complex negatively regulates IR-induced apoptosis. In accordance with their described role as negative regulators of physiological apoptosis,32 depletion of CGH-1 and CAR-1 also increased the number of apoptotic cells in the untreated germlines. Interestingly, knock-down of CEY-3 did not significantly stimulate basal apoptosis but revealed a specific stimulation of IR-induced corpse formation. Depletion of Y66H1A.4, a homologue of human GAR1, a component of the H/ACA small nucleolar ribonucleoprotein (H/ACA snoRNP) complex involved in processing of rRNA and the telomerase RNA component, suppressed apoptosis induction to the same extent as CEP-1 depletion (Figure 6B). This function was not shared by another member of the H/ ACA snoRNP complex found to be regulated in our data set, K01G5.5, a dyskerin homologue. As Y66H1A.4, but not K01G5.5, was previously identified in a screen for genes offering protection against IR,40 this observation points to a specific function for Y66H1A.4 within the H/ACA snoRNP complex in the IR-induced DNA damage response. In summary, the quantitative proteomic identification of proteins regulated by IR in the C. elegans germline revealed the conserved germline RNP complex CAR-1, CGH-1, and CEY-3 as a negative regulator of IR-induced apoptosis. The H/ACA snRNP component Y66H1A.4 and the mitochondrial complex II protein F45H10.2 were found to be required for IR-induced apoptosis. 4283



Article

Table 1. Differential Proteins Identified Using IPTLa WB gene name SQD-1 CAR-1 PHB-1 EGL-45 D2096.8 HIS-22 IMB-3 Y66H1A.4 TUFM-1 RPS-9 RPL-36 CYP-1 C56C10.10 RPL-23 RPA-0 RPL-22 Y22D7AL.10 F53F4.11 T07A9.9 K01G5.5

protein description Homologous to drosophila sqd (Squid) protein 1, isoform a Protein Y18D10A.17 Mitochondrial prohibitin complex protein 1 Eukaryotic translation initiation factor 3 subunit A Putative uncharacterized protein D2096.8 Histone H2B 2 Importin beta family protein 3 Probable H/ACA ribonucleoprotein complex subunit 1-like protein Tu elongation factor (Ef-tu), mitochondrial protein 1 40S ribosomal protein S9 60S ribosomal protein L36 Peptidyl-prolyl cis−trans isomerase 1 Putative uncharacterized protein 60S ribosomal protein L23 60S acidic ribosomal protein P0 60S ribosomal protein L22 Putative uncharacterized protein Y22D7AL.10 Protein F53F4.11

mean norm ratio

CV [%]

UniProt gene name

2.8

34

HNRDL_HUMAN

RNA-binding protein squid

2.8 2.1 2.1

35 4 39

LS14B_HUMAN PHB_HUMAN EIF3G_HUMAN

2.0 1.7 1.7 1.7

32 34 39 4

NP1L1_HUMAN H2B2F_HUMAN IPO5_HUMAN GAR1_HUMAN

1.7

24

EFTU_HUMAN

1.7 1.7 1.7 1.6 1.6 1.6 1.6 1.6

17 30 31 36 29 40 36 8

RS9_HUMAN RL36_HUMAN PPIA_HUMAN AIP_HUMAN RL23_HUMAN RLA0_HUMAN RL22_HUMAN CH10_HUMAN

1.6

33

RL1D1_HUMAN

Protein LSM14 homologue B Prohibitin Eukaryotic translation initiation factor 3 subunit G Nucleosome assembly protein 1-like 1 Histone H2B type 2-F isoform b Importin-5 Isoform 1 of H/ACA ribonucleoprotein complex subunit 1 Tu translation elongation factor, mitochondrial precursor 40S ribosomal protein S9 60S ribosomal protein L36 Peptidyl-prolyl cis−trans isomerase A AH receptor-interacting protein 60S ribosomal protein L23 60S acidic ribosomal protein P0 60S ribosomal protein L22 10 kDa heat shock protein, mitochondrial Ribosomal L1 domain-containing protein 1 Nucleolar GTP-binding protein 1 H/ACA ribonucleoprotein complex subunit 4 40S ribosomal protein S3a 40S ribosomal protein SA

BLASTP protein description

1.6 1.5

7 38

NOG1_HUMAN DKC1_HUMAN

RPS-1 RPS-0

Probable nucleolar GTP-binding protein 1 Putative H/ACA ribonucleoprotein complex subunit 4 40S ribosomal protein S3a 40S ribosomal protein SA

1.5 1.5

7 30

RS3A_HUMAN RSSA_HUMAN

CEY-3

Y-box protein 3

1.5

38

YBOX1_HUMAN

W08E12.7 RPL-20 RPL-18 K07C5.4

1.5 1.5 −1.5 −1.5

21 8 37 36

PA2G4_HUMAN RL18A_HUMAN RL18_HUMAN NOP56_HUMAN

CGH-1

Putative uncharacterized protein 60S ribosomal protein L18a 60S ribosomal protein L18 Uncharacterized NOP5 family protein K07C5.4 ATP-dependent RNA helicase cgh-1

−1.5

18

DDX6_HUMAN

RPL-21 NOL-1

60S ribosomal protein L21 Putative uncharacterized protein W07E6.1

−1.5 −1.5

40 31

RL21_HUMAN NOP2_HUMAN

F45H10.2 RPL-14 PBS-7 RPL-16 PAS-5 IFF-1

Protein F45H10.2 Ribosomal Protein, Large subunit Protein F39H11.5 60S ribosomal protein L13a Proteasome subunit alpha type-5 Eukaryotic translation initiation factor 5A-1

−1.5 −1.6 −1.6 −1.6 −1.6 −1.6

16 29 11 8 13 23

QCR7_HUMAN RL14_HUMAN PSB4_HUMAN RL13A_HUMAN PSA5_HUMAN IF5A1_HUMAN

UCR-1

−1.6

37

MPPB_HUMAN

FUM-1 PAS-6 CRT-1 GLH-1

Cytochrome b-c1 complex subunit 1, mitochondrial Probable fumarate hydratase, mitochondrial Proteasome subunit alpha type-1 Calreticulin ATP-dependent RNA helicase glh-1

−1.7 −1.7 −1.8 −1.8

3 32 8 38

FUMH_HUMAN PSA1_HUMAN CALR_HUMAN DDX4_HUMAN

TCP-1 FKB-2 AHCY-1 RPL-17 F54H12.6

T-complex protein 1 subunit alpha Rotamase Adenosylhomocysteinase 60S ribosomal protein L17 Probable elongation factor 1-beta/1-delta 1

−1.8 −1.9 −1.9 −1.9 −1.9

8 5 6 31 21

TCPA_HUMAN FKB1A_HUMAN SAHH_HUMAN RL17_HUMAN EF1B_HUMAN

Probable ATP-dependent RNA helicase DDX6 60S ribosomal protein L21 Isoform 2 of Putative rRNA methyltransferase NOP2 Cytochrome b-c1 complex subunit 8 Ribosomal protein L14 variant Proteasome subunit beta type-4 60S ribosomal protein L13a Proteasome subunit alpha type-5 Isoform 2 of Eukaryotic translation initiation factor 5A-1 Mitochondrial-processing peptidase subunit beta Fumarate hydratase, mitochondrial Proteasome subunit alpha type-1 Calreticulin Probable ATP-dependent RNA helicase DDX4 isoform 3 T-complex protein 1 subunit alpha FKBP1A protein Adenosylhomocysteinase 60S ribosomal protein L17 Elongation factor 1-beta

UNC-60 PAS-1

Actin-depolymerizing factor 1, isoforms a/b Proteasome subunit alpha type-6

−1.9 −2.0

37 33

COF2_HUMAN PSA6_HUMAN

Cofilin-2 Proteasome subunit alpha type-6

4284

Nuclease-sensitive element-binding protein 1 Proliferation-associated protein 2G4 60S ribosomal protein L18a 60S ribosomal protein L18 Nucleolar protein 56

APdb down

down/up down/up, CasSb CasSb up down

down/up down/up

down/up up

up CasSb up down/up, CasSb CasSb down/up up down/up

up

down down/up down/up

up up

down/up up down/up, CasSb up



Article

Table 1. continued a

The ratios of the most significantly changed proteins obtained by quantitative proteome analysis of IR-induced apoptosis vs. control are displayed as mean norm ratio. Human homologues of the identified C. elegans proteins are shown as UniProt gene names. In addition, following abbreviations were used: APdb, Apoptoproteomics database (http://apoptoproteomics.uio.no); CasSb, Caspase substrate.

Figure 5. Protein−protein interaction network. Direct associations of the C. elegans IR-induced identified regulated proteins and CEP-1/p53 identified by a web-based search of the STRING database Version 9.0 (http://string-db.org/), showing a tightly interconnected network.

stressors.41 Evidence for activation of stress responses in our data set are represented by the 1.8-fold down regulation of the nuclear chaperonin complex TCP-1/CCT-1 in irradiated germlines, as reduced expression of TCP-1/CCT-1 was previously shown to activate SKN-1,42 the C. elegans ortholog of the mammalian NFR2 transcription factor that controls transcriptional responses to oxidative stress.43 Similarly, reduced levels of the proteasomal subunits PAS-5, PAS-6, and PBS-7, which levels were suppressed by IR, were previously shown to activate SKN-1.42 In addition, GLH-1, a DEAD box family RNA helicase known to be degraded by the Jun Nterminal kinase (JNK) MAPK kinase KGB-1, was downregulated, which is consistent with activation of a compensatory stress response. Our observation that RNAi-mediated depletion of GLH-1 did not lead to changes in apoptotic corpse formation (Supporting Information, Figure S3) strengthens the interpretation that GLH-1 degradation is a consequence of stress response activation.

Considering the important role of CEP-1 in IR-induced apoptosis and CEP-1 activation under our experimental conditions (Figure 1A), the absence of CEP-1 regulated proteins in our data set is striking. Moreover, CEP-1 could not be placed into the C. elegans protein−protein interaction network obtained by the regulated proteins, even when allowing inclusion of indirect (2-step) interactors in the algorithm used. This observation may reflect the fact that CEP-1 has few known targets,9 but it also suggests that the global protein level changes in the apoptotic program are not dominated by CEP-1 activation. Nevertheless, our data is consistent with CEP-1 activation through stress-induced signaling pathways, as it was recently shown that the Ras/ MAPK kinase MPK-1 contributed to CEP-1 regulation in response to IR.44 The C. elegans IR-induced protein−protein interaction network that emerged between 39 of the 48 regulated proteins suggested a tightly interconnected apoptotic program (Figure 5). Interestingly, the observed changes in all the three nodes in 4285



Article

Figure 6. Identification of novel modulators of IR-induced apoptosis. Apoptotic cell corpses were quantified in the transgenic Pced‑1ced-1::gf p strain grown on E. coli HT115(DE3) expressing control RNAi (pL4440) or clones expressing RNAi targeting the indicated genes involved in mitochondria (A) or RNA biology (B). Corpses were quantified 24 h after exposure to 125 Gy of ionizing radiation. The number of apoptotic corpses per gonad arm was scored in a minimum of 15 germlines in three independent experiments and are given as an average ± SEM. Statistical difference between the indicated groups were evaluated using Student’s t-test (*** indicates p < 0.001).

■

the interconnected network of the IR responsive proteins identified in our study, involving proteins known to affect translational control, proteasome function, and ribosome biogenesis, can be understood in light of nucleolar stress. The nucleolus coordinates rRNA transcription and ribosome biogenesis, but nucleolar stress has also been proposed to be a major cellular sensor of DNA damage.45 The regulation of a high number of nucleolar proteins (K01G5.5, K07C5.4, NOL1, T07A9.9, Y66H1A.4) in our data set is striking and might reflect IR-induced nucleolar stress. Nucleolar disruption has in itself been shown to activate cellular stress response pathways partially dependent on CEP-1.46 Moreover, nucleolar disruption following depletion of two ribosomal proteins identified as down-regulated in our data set, RPS-1 and RPS9, was previously shown to lead to transcriptional activation of CEP-1 targets.47 Hence, most germline IR-induced changes seen in the quantitative proteomic study may be expected in a situation of nucleolar stress. In conclusion, the first quantitative proteome analysis of apoptosis in C. elegans revealed a highly interconnected IRinduced protein−protein interaction network dominated by proteins involved in translational control, proteasomal and ribosomal proteins. The germline CAR-1/CGH-1/CEY-3 RNP complex was found as a novel negative regulator of DNAdamage induced apoptosis. Finally, a central role of the nucleolus in orchestrating these responses was experimentally confirmed as the nucleolar H/ACA snRNP protein Y66H1A.4 (GAR1 homologue) was found to be required for IR-induced apoptosis in the C. elegans germline.

■

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. Phone: (++47) 22840533. Fax: (++47) 22840501. Author Contributions †

Equally contributing first authors.

Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS

The authors acknowledge the following researchers for the kind donation of specific antibodies: Anton Gartner, University of Dundee, U.K. (RAD-51 and RPA-1), Karen L. Bennett, University of Columbia, USA (GLH-1), Keith Blackwell, Harvard Medical School, USA (CGH-1), and John R. Yates III, The Scripps Research Institute, USA (D2096.8). The authors also acknowledge the technical assistance of Christian Koehler for peptide labelling, Magnus Ø. Arntzen for data analysis, and Gro Størvold and Margarita Strozynski for Western blot experiments. This work was supported by group leader grant from the University of Oslo to HN and BT. HK was the recipient of a short-term scientific mission fellowship from the COST action (BM0703) Cancer Control and Genomic Integrity. Additional funding was obtained from the Functional Genomics program of the Research Council of Norway (HN).

■

ABBREVIATIONS CGH-1, ATP-dependent RNA helicase cgh-1; DDR, DNA damage response; DIC, differential interference contrast; GFP, green fluorescent protein; GLH-1, ATP-dependent RNA helicase glh-1; GO, gene ontology; IPTL, isobaric peptide termini labeling; IR, ionizing radiation; MS, mass spectrometry; NAP1, nucleosome assembly protein 1-like 1; PHB, prohibitin; PTM, post-translational modification

ASSOCIATED CONTENT

S Supporting Information *

Table S1: Statistic analysis of the quantified proteins. Table S2: List of identified proteins. Table S3: List of identified peptides. Figures S1−S3. This material is available free of charge via the Internet at http://pubs.acs.org 4286



■

Article

caries related isolates by MALDI-MS. Proteomics 2009, 9 (7), 1994− 2003. (23) Karp, N. A.; Huber, W.; Sadowski, P. G.; Charles, P. D.; Hester, S. V.; Lilley, K. S. Addressing accuracy and precision issues in iTRAQ quantitation. Mol. Cell. Proteomics 2010, 9 (9), 1885−97. (24) Altschul, S. F.; Gish, W.; Miller, W.; Myers, E. W.; Lipman, D. J. Basic local alignment search tool. J. Mol. Biol. 1990, 215 (3), 403−10. (25) Arntzen, M. O.; Thiede, B. ApoptoProteomics, an integrated database for analysis of proteomics data obtained from apoptotic cells. Mol. Cell. Proteomics 2012, 11 (2), M111010447. (26) Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N. S.; Wang, J. T.; Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Res. 2003, 13 (11), 2498−504. (27) Maere, S.; Heymans, K.; Kuiper, M. BiNGO: a Cytoscape plugin to assess overrepresentation of gene ontology categories in biological networks. Bioinformatics 2005, 21 (16), 3448−9. (28) Szklarczyk, D.; Franceschini, A.; Kuhn, M.; Simonovic, M.; Roth, A.; Minguez, P.; Doerks, T.; Stark, M.; Muller, J.; Bork, P.; Jensen, L. J.; von Mering, C. The STRING database in 2011: functional interaction networks of proteins, globally integrated and scored. Nucleic Acids Res. 2011, 39 (Database issue), D561−8. (29) Gartner, A.; Boag, P. R.; Blackwell, T. K. Germline survival and apoptosis. WormBook 2008, 1−20. (30) Wang, X.; Zhao, Y.; Wong, K.; Ehlers, P.; Kohara, Y.; Jones, S. J.; Marra, M. A.; Holt, R. A.; Moerman, D. G.; Hansen, D. Identification of genes expressed in the hermaphrodite germ line of C. elegans using SAGE. BMC Genomics 2009, 10, 213. (31) Taylor, R. C.; Brumatti, G.; Ito, S.; Hengartner, M. O.; Derry, W. B.; Martin, S. J. Establishing a blueprint for CED-3-dependent killing through identification of multiple substrates for this protease. J. Biol. Chem. 2007, 282 (20), 15011−21. (32) Boag, P. R.; Nakamura, A.; Blackwell, T. K. A conserved RNAprotein complex component involved in physiological germline apoptosis regulation in C. elegans. Development 2005, 132 (22), 4975−86. (33) Boulton, S. J.; Gartner, A.; Reboul, J.; Vaglio, P.; Dyson, N.; Hill, D. E.; Vidal, M. Combined functional genomic maps of the C. elegans DNA damage response. Science 2002, 295 (5552), 127−31. (34) Gygi, S. P.; Rochon, Y.; Franza, B. R.; Aebersold, R. Correlation between protein and mRNA abundance in yeast. Mol. Cell. Biol. 1999, 19 (3), 1720−30. (35) Hanash, S. M.; Bobek, M. P.; Rickman, D. S.; Williams, T.; Rouillard, J. M.; Kuick, R.; Puravs, E. Integrating cancer genomics and proteomics in the post-genome era. Proteomics 2002, 2 (1), 69−75. (36) Lundberg, E.; Fagerberg, L.; Klevebring, D.; Matic, I.; Geiger, T.; Cox, J.; Algenas, C.; Lundeberg, J.; Mann, M.; Uhlen, M. Defining the transcriptome and proteome in three functionally different human cell lines. Mol. Syst. Biol. 2010, 6, 450. (37) Beli, P.; Lukashchuk, N.; Wagner, S. A.; Weinert, B. T.; Olsen, J. V.; Baskcomb, L.; Mann, M.; Jackson, S. P.; Choudhary, C. Proteomic investigations reveal a role for RNA processing factor THRAP3 in the DNA damage response. Mol. Cell 2012, 46 (2), 212−25. (38) Ross, J. A.; Nagy, Z. S.; Kirken, R. A. The PHB1/2 phosphocomplex is required for mitochondrial homeostasis and survival of human T cells. J. Biol. Chem. 2008, 283 (8), 4699−713. (39) Zuryn, S.; Kuang, J.; Ebert, P. Mitochondrial modulation of phosphine toxicity and resistance in Caenorhabditis elegans. Toxicol. Sci. 2008, 102 (1), 179−86. (40) van Haaften, G.; Romeijn, R.; Pothof, J.; Koole, W.; Mullenders, L. H.; Pastink, A.; Plasterk, R. H.; Tijsterman, M. Identification of conserved pathways of DNA-damage response and radiation protection by genome-wide RNAi. Curr. Biol. 2006, 16 (13), 1344−50. (41) Pereira, W. O.; Amarante-Mendes, G. P. Apoptosis: a programme of cell death or cell disposal? Scand. J. Immunol. 2011, 73 (5), 401−7. (42) Kahn, N. W.; Rea, S. L.; Moyle, S.; Kell, A.; Johnson, T. E. Proteasomal dysfunction activates the transcription factor SKN-1 and

REFERENCES

(1) Raff, M. C. Social controls on cell survival and cell death. Nature 1992, 356 (6368), 397−400. (2) Opferman, J. T. Apoptosis in the development of the immune system. Cell Death Differ. 2008, 15 (2), 234−42. (3) Sulston, J. E.; Horvitz, H. R. Post-embryonic cell lineages of the nematode, Caenorhabditis elegans. Dev. Biol. 1977, 56 (1), 110−56. (4) Ellis, H. M.; Horvitz, H. R. Genetic control of programmed cell death in the nematode C. elegans. Cell 1986, 44 (6), 817−29. (5) Yuan, J.; Shaham, S.; Ledoux, S.; Ellis, H. M.; Horvitz, H. R. The C. elegans cell death gene ced-3 encodes a protein similar to mammalian interleukin-1 beta-converting enzyme. Cell 1993, 75 (4), 641−52. (6) Gumienny, T. L.; Lambie, E.; Hartwieg, E.; Horvitz, H. R.; Hengartner, M. O. Genetic control of programmed cell death in the Caenorhabditis elegans hermaphrodite germline. Development 1999, 126 (5), 1011−22. (7) Schumacher, B.; Hofmann, K.; Boulton, S.; Gartner, A. The C. elegans homolog of the p53 tumor suppressor is required for DNA damage-induced apoptosis. Curr. Biol. 2001, 11 (21), 1722−7. (8) Holcik, M.; Sonenberg, N. Translational control in stress and apoptosis. Nat. Rev. Mol. Cell Biol. 2005, 6 (4), 318−27. (9) Greiss, S.; Schumacher, B.; Grandien, K.; Rothblatt, J.; Gartner, A. Transcriptional profiling in C. elegans suggests DNA damage dependent apoptosis as an ancient function of the p53 family. BMC Genomics 2008, 9, 334. (10) Aebersold, R.; Mann, M. Mass spectrometry-based proteomics. Nature 2003, 422 (6928), 198−207. (11) Mann, M.; Kelleher, N. L. Precision proteomics: the case for high resolution and high mass accuracy. Proc. Natl. Acad. Sci. U. S. A. 2008, 105 (47), 18132−8. (12) Schrimpf, S. P.; Hengartner, M. O. A worm rich in protein: Quantitative, differential, and global proteomics in Caenorhabditis elegans. J. Proteomics 2010, 73 (11), 2186−97. (13) Shim, Y. H.; Paik, Y. K. Caenorhabditis elegans proteomics comes of age. Proteomics 2010, 10 (4), 846−57. (14) Fredens, J.; Engholm-Keller, K.; Giessing, A.; Pultz, D.; Larsen, M. R.; Hojrup, P.; Moller-Jensen, J.; Faergeman, N. J. Quantitative proteomics by amino acid labeling in C. elegans. Nat. Methods 2011, 8 (10), 845−7. (15) Larance, M.; Bailly, A. P.; Pourkarimi, E.; Hay, R. T.; Buchanan, G.; Coulthurst, S.; Xirodimas, D. P.; Gartner, A.; Lamond, A. I. Stableisotope labeling with amino acids in nematodes. Nat. Methods 2011, 8 (10), 849−51. (16) Koehler, C. J.; Arntzen, M. O.; Strozynski, M.; Treumann, A.; Thiede, B. Isobaric peptide termini labeling utilizing site-specific Nterminal succinylation. Anal. Chem. 2011, 83 (12), 4775−81. (17) Arntzen, M. O.; Koehler, C. J.; Barsnes, H.; Berven, F. S.; Treumann, A.; Thiede, B. IsobariQ: software for isobaric quantitative proteomics using IPTL, iTRAQ, and TMT. J. Proteome Res. 2011, 10 (2), 913−20. (18) Arczewska, K. D.; Baumeier, C.; Kassahun, H.; Sengupta, T.; Bjoras, M.; Kusmierek, J. T.; Nilsen, H. Caenorhabditis elegans NDX-4 is a MutT-type enzyme that contributes to genomic stability. DNA Repair 2011, 10 (2), 176−87. (19) Candiano, G.; Bruschi, M.; Musante, L.; Santucci, L.; Ghiggeri, G. M.; Carnemolla, B.; Orecchia, P.; Zardi, L.; Righetti, P. G. Blue silver: a very sensitive colloidal Coomassie G-250 staining for proteome analysis. Electrophoresis 2004, 25 (9), 1327−33. (20) Koehler, C. J.; Strozynski, M.; Kozielski, F.; Treumann, A.; Thiede, B. Isobaric peptide termini labeling for MS/MS-based quantitative proteomics. J. Proteome Res. 2009, 8 (9), 4333−41. (21) Solstad, T.; Bjorgo, E.; Koehler, C. J.; Strozynski, M.; Torgersen, K. M.; Tasken, K.; Thiede, B. Quantitative proteome analysis of detergent-resistant membranes identifies the differential regulation of protein kinase C isoforms in apoptotic T cells. Proteomics 2010, 10 (15), 2758−68. (22) Schmidt, F.; Fiege, T.; Hustoft, H. K.; Kneist, S.; Thiede, B. Shotgun mass mapping of Lactobacillus species and subspecies from 4287



Article

produces a selective oxidative-stress response in Caenorhabditis elegans. Biochem. J. 2008, 409 (1), 205−13. (43) Kwak, M. K.; Wakabayashi, N.; Itoh, K.; Motohashi, H.; Yamamoto, M.; Kensler, T. W. Modulation of gene expression by cancer chemopreventive dithiolethiones through the Keap1-Nrf2 pathway. Identification of novel gene clusters for cell survival. J. Biol. Chem. 2003, 278 (10), 8135−45. (44) Rutkowski, R.; Dickinson, R.; Stewart, G.; Craig, A.; Schimpl, M.; Keyse, S. M.; Gartner, A. Regulation of Caenorhabditis elegans p53/ CEP-1-dependent germ cell apoptosis by Ras/MAPK signaling. PLoS Genet. 2011, 7 (8), e1002238. (45) Boisvert, F. M.; van Koningsbruggen, S.; Navascues, J.; Lamond, A. I. The multifunctional nucleolus. Nat. Rev. Mol. Cell Biol. 2007, 8 (7), 574−85. (46) Leung, C. K.; Empinado, H.; Choe, K. P. Depletion of a nucleolar protein activates xenobiotic detoxification genes in Caenorhabditis elegans via Nrf /SKN-1 and p53/CEP-1. Free Radical Biol. Med. 2011, 52 (5), 937−950. (47) Fuhrman, L. E.; Goel, A. K.; Smith, J.; Shianna, K. V.; Aballay, A. Nucleolar proteins suppress Caenorhabditis elegans innate immunity by inhibiting p53/CEP-1. PLoS Genet. 2009, 5 (9), e1000657.

4288


Quantitative Proteome Analysis Reveals RNA Processing Factors As

Recommend Documents