Quantitative Tetraplex Real-Time Polymerase Chain Reaction Assay

Article pubs.acs.org/JAFC

Quantitative Tetraplex Real-Time Polymerase Chain Reaction Assay with TaqMan Probes Discriminates Cattle, Buffalo, and Porcine Materials in Food Chain M. A. Motalib Hossain,† Md. Eaqub Ali,*,†,‡,§ Sharmin Sultana,† Asing,† Sharmin Quazi Bonny,† Md. Abdul Kader,∥ and M. Aminur Rahman⊥ †

Nanotechnology and Catalysis Research Centre (NANOCAT), Institute of Graduate Studies, University of Malaya, Kuala Lumpur 50603, Malaysia ‡ Institute of Halal Research University Malaya (IHRUM), University of Malaya, 50603 Kuala Lumpur, Malaysia § Centre for Research in Biotechnology for Agriculture (CEBAR), University of Malaya, Kuala Lumpur 50603, Malaysia ∥ School of Fisheries and Aquaculture Sciences, Universiti Malaysia Terengganu, 21030 Kuala Terengganu, Terengganu, Malaysia ⊥ Laboratory of Marine Biotechnology, Institute of Bioscience (IBS), Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia S Supporting Information *

ABSTRACT: Cattle, buffalo, and porcine materials are widely adulterated, and their quantification might safeguard health, religious, economic, and social sanctity. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays have been documented but they are just suitable for identification, cannot quantify adulterations. We described here a quantitative tetraplex real-time PCR assay with TaqMan Probes to quantify contributions from cattle, buffalo, and porcine materials simultaneously. Amplicon-sizes were very short (106-, 90-, and 146-bp for cattle, buffalo, and porcine) because longer targets could be broken down, bringing serious ambiguity in molecular diagnostics. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 27 frankfurters and 27 meatballs reflected 84−115% target recovery at 0.1−10% adulterations. Finally, a test of 36 commercial products revealed 71% beef frankfurters, 100% meatballs, and 85% burgers contained buffalo adulteration, but no porcine was found in beef products. KEYWORDS: quantitative multiplex real-time PCR, TaqMan probe, meat species discrimination, endogenous control, short-length amplicon

■

INTRODUCTION Definitive identification and quantification of animal materials have enormous interest in food, pharmaceutical, and personal care products. Authentication of animal materials limits the spread of zoonotic threats, prevents unfair competition in business settings, boosts up consumer confidence and product sales, and brings long-term benefits in public health, social harmony, economic growth, and biological conservation of endangered species. In this regard, public awareness, regulatory laws, and authentication tools work side by side to achieve these overall objectives. The mixing of undeclared species in meat products is illegal under various food safety regulations across the globe. For instances, the U.S. Federal Meat Inspection Act (FMIA) and the European Parliament Regulation (EC) No. 178/2002 strictly prohibit meat and other animal material adulteration in the food chain.1,2 However, survey reports of various markets reflect the practice is going on in rampant all over the world. For example, 68% meat products in South Africa,3 19.4% in the USA,4 33% in the Gulf countries,5 22% in Turkey,6 and 8% in the U.K.7 were found to be mislabeled, especially beef and mutton frequently substituted by pork, buffalo, and horse meat in various instances.3,8 It has been posing a great threat to © XXXX American Chemical Society

public health because some animal species are potential carriers of multiple infecting agents that can infect humans and bring a regional health emergency.7,9 The U.S. Department of Agriculture (USDA) alerted that approximately 75% of human infections may come from animal products either by direct or indirect contact through different routes.10 Beef, buffalo, and pork are economically important major meats, and their adulterations have direct links to public health, religions, cultures, and economy. Major risks include zoonotic infections, financial loss, and social unrest. With regards to religions and cultures, beef is totally forbidden for the Hindus,11 and pork is prohibited for the Muslim, Jewish, and certain Christian menus.12 Beef and buffalo have also got regional and cultural preferences; for example, there is a huge turnover of buffalo in India, both for domestic consumption and export, but you cannot slaughter a cow and consume or export beef there.13 In contrast, buffalo have got preferential selection and special prices in European and Egyptian cultures. Thus, cattle, Received: Revised: Accepted: Published: A

February 16, 2017 April 25, 2017 April 30, 2017 May 1, 2017 DOI: 10.1021/acs.jafc.7b00730 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

minced beef, buffalo, and pork at a ratio of 1:1:1 and was homogenized by blending. For the preparation of frankfurters and meatballs, raw beef, buffalo, and pork samples were minced and blended separately. Model frankfurters and meatballs of beef, buffalo, and pork were made in a laboratory following Razzak et al.36 (Table 1). Certain amounts of

buffalo, and porcine materials have an enormous importance in health, religions, cultures, and businesses, making it a must to develop a trustworthy method that not only discriminates and identifies but also tells us how much of them are adulterated. As authentication is concerned, DNA based PCR techniques have become the methods of choice because analytical techniques that are based on proteins and lipids cannot provide accurate information because of the modification of protein and lipid biomarkers during processing.14−17 Several DNA based methods such as species-specific PCR,18,19 PCR-restriction fragment length polymorphism (PCR-RFLP),20−22 multiplex PCR,23,24 randomly amplified polymorphic DNA (RAPD),25 real- time PCR,26,27 and DNA barcoding28 systems have been documented. However, real-time PCR techniques are especially promising since they are fast, automated, highly sensitive, and offer both the detection and quantification opportunities of the analyte targets at real-time, eliminating the need of post PCR analysis such as time-consuming electrophoresis.15,29 Multiplex quantitative PCR (mqPCR) might be highly advantageous over the singleplex qPCR methods because it could detect and quantify multiple target oligos in a single assay platform, saving both analytical cost and time.30,31 The TaqMan probe based method is greatly promising since both the probe and primers find their appropriate partners in the template site, offering double checking opportunity that enhances assay specificity and reliability.26 TaqMan probe techniques are also suitable for the development of mqPCR systems because specific probes could be labeled with different reporter dyes that allow the identification of the amplified targets formed by one or multiple primer sets in a single PCR assay tube.32 Literature search revealed that several qPCR methods are available for the identification and quantification of beef and buffalo33 and beef and pork,30,34 but no mqPCR systems have been documented for the simultaneous detection and quantification of cattle, buffalo, and porcine materials in the food chain. Recently, we have documented multiplex PCR35 and PCR-RFLP12 assays for the simultaneous identification of these materials in the food chain, but those methods are just limited to the qualitative detection; they cannot tell how much adulterants are present in the real-world specimens. Thus, the objective of the present study was to develop and validate a short-amplicon length tetraplex qPCR system that would allow both identification and quantification of cattle, buffalo and porcine derived materials in processed foods such as hotdogs, meatballs, and burgers, which are very popular on all continents.

■

Table 1. Formulation of Model Meatballs and Frankfurters meatball (∼35 g/piece)

frankfurter (∼70 g/piece)

ingredients

beef

buffalo

pork

beef

buffalo

pork

minced meat soy protein starch/breadcrumb chopped onion chopped ginger cumin powder garlic powder black pepper tomato paste butter salt othersb

23a 3 5 1 0.1 0.75 0.5 0.14 1.5 1.5 SAc SAc

23a 3 5 1 0.1 0.75 0.5 0.14 1.5 1.5 SAc SAc

23a 3 5 1 0.1 0.75 0.5 0.14 1.5 1.5 SAc SAc

45a 7.5 6.5 2.5 0.15 0.75 0.5 0.23 2.0 2.5 SAc SAc

45a 7.5 6.5 2.5 0.15 0.75 0.5 0.23 2.0 2.5 SAc SAc

45a 7.5 6.5 2.5 0.15 0.75 0.5 0.23 2.0 2.5 SAc SAc

a

10%, 1%, and 0.1% of beef, buffalo, and pork were mixed with a balanced amount of respective minced meat to prepare the ∼35 g meatball and ∼70 g frankfurter specimens. bFlavoring agents and enhancers. cSA, suitable amounts.

beef, buffalo, and pork were mixed with a balanced amount of buffalo and pork; beef and pork; and beef and buffalo to make 10%, 1%, and 0.1% adulteration for each species. DNA Extraction. Total genomic DNA was extracted from meat and fish tissues as described in our recently published report.12 DNeasy Plant Mini Kit (QIAGEN GmgH, Hilden, Germany) was used to extract DNA from 100 mg of onion (Allium cepa), ginger (Zingiber officinale), wheat (Triticum aestivum), pepper (Capsicum annuum), and garlic (Allium sativum) following the manufacturer’s protocol. To extract DNA from food products (burger, meatball, and frankfurter), 200 mg samples were taken and a NucleoSpin Food DNA kit (Macherey-Nagel GmbH & Co. KG, Duren, Germany) was used.23 Design of Primers and Probes. The oligonucleotide primers and probes used in the present study were designed targeting mitochondrial ND5 gene of cow (Bos taurus and Bos taurus indicus) and cytb gene of buffalo (Bubalus bubalis) and pig (Sus scrofa), respectively (Table 2). The detailed information about primers development could be found in Figure 1SM in the Supporting Information. The beef probe was labeled with Hex at the 5′ end and ZEN/IOWA BLACK FQ at the 3′ end; buffalo was labeled with TAMRA at the 5′ end and TAO-IOWA BLACK RQ at the 3′ end; and the pork probe was labeled with ROX at the 5′ end and TAO-IOWA BLACK RQ at the 3′ end (Table 2). Eukaryotic 18S rRNA specific primers and TaqMan probe (Table 2) were used as endogenous control (IAC) for the normalization and specificity test of the developed tetraplex qPCR assay.37 The IAC probe was labeled with FAM at the 5′ end and ZEN/IOWA BLACK FQ at the 3′ end (Table 2). The designed primers and probes were supplied by Integrated DNA Technologies (IDT), Singapore. Tetraplex Real-Time PCR Conditions. Tetraplex real-time PCR assay of beef, buffalo, pork, and IAC were carried out in a Quant Studio 12K flex real-time PCR system (Applied Biosystems, Foster City, CA) in a 20 μL reaction volume consisting of 1× GoTaq Probe qPCR Master Mix (Promega, Madison), 30 ng of the total DNA template for each target species, and required quantity of nuclease free water. The concentration of primers and probes were listed in Table 2. The amplification was performed using initial denaturation step at 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 20 s, and annealing and extension at 60 °C for 60 s.

MATERIALS AND METHODS

Samples Collection. Authentic muscle tissues of various species, namely, cow (Bos taurus), buffalo (Bubalus bubalis), goat (Capra hiscus), lamb (Ovis aries), chicken (Gallus gallus), duck (Anas platyrhychos), pigeon (Columba livia), quail (Coturnix coturnix), cod (Gadus morhua), salmon (Salmo salar), pangas (Pangasius pangasius), tuna (Thunnus orientalis), tilapia (Oreochromis niloticus), rohu (Labeo rohita), frog (Rana kunyuensis), turtle (Cuora amboinensis), pig (Sus scrofa), dog (Canis lupus familiariz), cat (Felis catus), rat (Rattus rattus), and monkey (Macaca fascicularis) were collected as described in our earlier report.12 Commercial beef and pork frankfurters (7 beef and 5 pork), meatballs (7 beef and 5 pork), and burgers (7 beef and 5 pork) of different brands (such as Ramly, Saudi Gold, Marina, Figo, Ayamadu, Kami, Azmy, Ayam A1, and Sanbanto) were purchased from various outlets across Kuala Lumpur in Malaysia. Preparation of Ternary Admixture and Model Frankfurters and Meatballs. Ternary admixture (100 g) was prepared by mixing B

DOI: 10.1021/acs.jafc.7b00730 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry Table 2. Sequences and Concentration of Primer and Probes Used in This Study species

target gene

cattle (Bos taurus and Bos indicus)

ND5

buffalo (Bubalus bubalis)

Cytb

pork (Sus scrofa)

Cytb

eukaryotic (IACa)

18S rRNA

a

sequence (5′−3′) forward: GGTTTCATTTTAGCAATAGCATGG reverse: GTCCAATCAAGGGTATGTTTGAG probe: Hex-ACAAATCTCAATACCTGAGACCTCCAACAGA-ZEN/IOWA BLACK FQ forward: GGGTTCTAGCCCTAGTTCTCTCT reverse: ATGGCCGGAACATCATACTT probe: TAMRA−AATCCTCATTCTCATGCCCCTGCTACA-TAO-IOWA BLACK RQ forward: TATCCCTTATATCGGAACAGACCTC reverse: GCAGGAATAGGAGATGTACGG probe: ROX-CCTGCCATTCATCATTACCGCCC- TAO-IOWA BLACK RQ forward: GGTAGT GACGAAAAATAACAATACAGGAC reversed: ATACGCTATTGGAGCTGGAATTAC C probe: FAM-AAGTGGACTCATTCCAATTACAGGGCCT- ZEN/IOWA BLACK FQ

amplicon size (bp) 106

90

146

141

final concentration (nM) 500 500 250 300 300 200 300 300 200 200 200 100

ref this study this study this study Ali et al.37

IAC, endogenous control.

Specificity Test. To analyze the specificity, the tetraplex qPCR assay and reference PCR system were carried out simultaneously against the template DNA of 20 nontarget species (goat, lamb, dog, cat, rabbit, monkey, donkey, chicken, duck, pigeon, quail, rat, salmon, tuna, cod, tilapia, rohu, pangas, frog, and turtle) and 5 plant species (wheat, onion, garlic, ginger, and pepper) which are commonly used in food. Limit of Detection. To determine the limit of detection (LOD) of the developed tetraplex qPCR assay, total DNA of the target species (cow, buffalo, and pig) were diluted using 10-fold serial dilutions.29 Initially, a mixture with equal amount (1:1:1) of genomic template DNA extracted from the three target species (cow, buffalo, and pig) were made at 30 ng/μL. Then, it was serially diluted to 3, 0.3, 0.03, and 0.003 ng/μL of total DNA for three species with nuclease free water. Therefore, 3 μL of the each diluted DNA solution was added to 20 μL of multiplex reaction mixture so that each target species were 30, 3, 0.3, 0.03, and 0.003 ng of DNA in the reaction mixture and each diluted template was assayed in 6 replicates. Generation of Standard Curves and Quantification of Target DNA and PCR Efficiency. To construct the standard curves of cow, buffalo, pig, and IAC from the tetraplex qPCR system, DNA was extracted from the ternary admixture (1:1:1) of beef, buffalo, and pork to form a mixed DNA template in 1:1:1. After adjusting the concentration to 30 ng/μL (100%), the extracted DNA was 10-fold serially diluted to 3, 0.3, 0.03, and 0.003 ng/μL of total DNA with nuclease free water; this resulted in mixtures containing 100% to 0.001% of DNA for each species. Therefore, 3 μL of the each diluted DNA solution was added to 20 μL of multiplex reaction mixture as a template, and three closely spaced Ct values of the replicates29,30 were plotted against the logarithmic concentration of DNA for each target.37 The efficiency of the assay was calculated from the slope of the standard curve according to the following equation:38

deliberately adulterated with 10, 1, and 0.1% (w/w) of buffalo and pork, buffalo products were adulterated with 10, 1, and 0.1% (w/w) of beef and pork, and pork products were adulterated with 10, 1, and 0.1% (w/w) of beef and buffalo (Table 1). The DNA was extracted from the meat products, and the concentration was adjusted to 30 ng/ μL using nuclease free deionized water.

■

RESULTS AND DISCUSSION Qualitative and Quantitative Analyses of Extracted DNA. Total genomic DNA was extracted from raw meat, fish muscle tissues, and meat products (burger, meatball, and frankfurter) on three different days. Concentration and purity of the extracted DNA were determined based on the absorbance value at 260 nm and absorbance ratio at 260 and 280 nm, respectively. The absorbance ratio at A260/A280 was between 1.8 and 1.96 for all extracted DNA, suggesting that good quality DNA was extracted from all samples.14,29 Tetraplex Real-Time PCR System. Design of specific primers and probes were the key step in the development of tetraplex qPCR system for cattle, buffalo, and porcine species detection because it was necessary to ensure that all the primers and probes must have the same or very closely related melting temperatures (Tms) so that they can anneal to their specific partner sites in template DNA under the same set of PCR conditions.29 The Tms of three primer sets were (57.8−61.0 °C), which annealed to the primer binding sites at 60 °C and Tms of the probes (68.5−70.70 °C) were 8−10 °C higher than that of the primers to facilitate the preferential binding of the probes prior to the annealing of the primers to the template.32 The multiple amplicons were discriminated in the same reaction tube through three different fluorescent reporter dyes (Table 2). A singleplex qPCR system for each individual species was optimized one by one using the respective primers and probes for each of the three target species and after that additional species (primers and probes) were added sequentially one after another into the reaction mixture to optimize the final tetraplex qPCR system. The Ct values of tetraplex qPCR assay were Ct = 18.74 ± 0.04, 17.75 ± 0.06, 14.80 ± 0.05, and 15.14 ± 0.05 that nicely matched with the qPCR Ct for cow, buffalo, pig, and IAC, respectively, effectively confirming that there were not any significant variation of Ct values when the platforms were changed from single to multiplex (data not shown). Specificity of the Tetraplex Real-Time PCR System. The specificity of the tetraplex qPCR system was evaluated with

E(%) = [10(−1/slope) − 1] × 100 The acceptance range of PCR efficiency was between 90 and 110%, corresponding to a slope of regression between −3.1 and −3.6 and an R2 value of ≥0.98.30 The quantity of beef, buffalo, or pork in an unknown specimen was then determined by extrapolating the Ct value of the unknown sample in the standard curve for reference samples.39 A semilogarithmic correlation was found between the variables, Ct value, and concentration:40 Ct = m log[] + c where m is the slope and c is the intercept. PCR Sensitivity and Validity. To evaluate the sensitivity and suitability of the tetraplex qPCR assay for food product analysis, two different model meat products (frankfurters and meatballs of beef, buffalo, and pork) were prepared in the laboratory. Beef products were C


Article


Figure 1. Multiplex qPCR amplification plot for porcine (red), cattle (blue), and buffalo (green) species along with the endogenous control for eukaryotes (sky blue) against 25 species (below the threshold cycle).

30 ng of DNA extracted from fresh muscle tissues of three target species (cattle, buffalo, and pig) and 25 nontarget species (lamb, goat, cat, dog, pigeon, chicken, quail, duck, rat, monkey, rabbit, donkey, tilapia, tuna, rohu, salmon, cod, pangas, turtle, frog, onion, ginger, wheat, garlic, and pepper) on three different days in triplicate. The amplification profile clearly demonstrated the species specific amplification curves as well as background fluorescence for the relevant species in a 40 cycle PCR assay, confirming the absence of any cross-amplifications (Figure 1). Additionally, the IAC that amplified eukaryotic target from all species reflected that good quality DNA template was present in all tubes (Figure 1). While the amplification signals (Ct values) of the tetraplex qPCR assay for the target species were 18.84 ± 0.06, 17.86 ± 0.03, and 14.83 ± 0.08 for cattle, buffalo, and pig, respectively, the nontarget species did not yield any detectable Ct during the 40 cycle PCR reaction (Table 3). On the other hand, Ct values of IAC for all the target and nontarget species were 15.61−18.50 (Table 3), eliminating the chances of any false positive detection. Limit of Detection. The limit of detection (LOD) of an assay helps determine the minimum quantity of the targets that could be detected in an adulterated or contaminated specimen. In this assay, the LOD of the tetraplex qPCR system was determined using 10-fold serially diluted mixed genomic DNA (30−0.003 ng for each species) of the target species (cow, buffalo, and pig). The amplification plots reflected detectable Ct from all concentrations, starting from 30 ng to 0.003 ng of DNA, suggesting the assay could detect and quantify minimum 0.003 ng of target DNA in a 20 μL of reaction mixture. The Ct values and relative standard deviation (RSD) for all the dilutions are shown in Table 4. RSD for all diluted DNA were less than 1.0 (0.1−0.94). Previously, Cheng et al. reported an mqPCR system for the identification of duck, pig, and chicken, wherein the LOD was 0.15 ng of DNA for each species.29 On the other hand, it was 0.32 ng of DNA for beef, pork, chicken, and turkey as documented by Koppel et al.41 Recently, our laboratory also detected 0.0017 ng of DNA by a duplex SYBR Green PCR for Malayan Box Turtle.15 Thus, LOD might vary

Table 3. Specificity/Cross-Reactivity Tests of Multiplex qPCR and Endogenous Systema multiplex real-time PCR system

endogenous PCR system

animal species tested

increase of fluorescence signal

mean Ct value

increase of fluorescence signal

cow buffalo pig sheep goat cat dog pigeon chicken quail duck rat monkey rabbit donkey tilapia tuna rohu salmon cod pangas turtle frog onion ginger wheat garlic pepper

+ + + − − − − − − − − − − − − − − − − − − − − − − − − −

18.84 ± 0.06 17.86 ± 0.03 14.83 ± 0.08 − − − − − − − − − − − − − − − − − − − − − − − − −

+ + + + + + + + + + + + + + + + + + + + + + + + + + + +

mean Ct value 16.53 15.80 16.33 17.30 17.51 18.06 17.82 15.92 17.50 17.81 18.43 16.94 15.66 15.78 18.07 17.45 17.16 16.59 16.43 17.61 18.46 16.69 17.72 18.07 16.03 17.33 17.75 15.37

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.13 0.15 0.07 0.04 0.13 0.10 0.08 0.11 0.11 0.06 0.09 0.08 0.13 0.08 0.04 0.13 0.10 0.12 0.09 0.06 0.13 0.15 0.11 0.14 0.05 0.08 0.14 0.12

“+” is positive PCR result (Ct value < 40), and “−” is no increase of the fluorescence signal within 40 cycles.

a

D


Article


Table 4. Ct Values of Each Target Species Obtained from the Amplification Plot with a 10-Fold Serially Diluted DNA of Each Target Species for the Determination of LODa cow DNA concentration (ng) 10

1

0.1

0.01

0.001

a

Ct value 18.244 18.267 18.454 21.781 21.752 21.756 25.243 25.289 25.364 28.155 28.158 28.155 29.215 29.182 29.287

buffalo

mean Ct value

SD

RSD (%)

18.32

0.115

0.63

21.76

0.015

0.07

25.30

0.061

0.24

28.16

0.002

0.01

29.23

0.054

0.18

Ct value 17.419 17.391 17.415 20.554 20.533 20.578 23.970 24.053 23.999 27.150 27.116 27.184 30.153 30.303 30.428

pig

mean Ct value

SD

RSD (%)

17.41

0.015

0.09

20.56

0.022

0.11

24.01

0.042

0.18

27.15

0.034

0.13

30.29

0.137

0.45

Ct value 14.375 14.334 14.354 17.886 17.867 17.781 21.769 21.688 21.781 25.068 25.192 25.208 27.957 28.264 28.488

mean Ct value

SD

RSD (%)

14.35

0.020

0.14

17.84

0.055

0.31

21.75

0.050

0.23

25.16

0.076

0.30

28.24

2.66

0.94

SD, standard deviation; RSD, relative standard deviation.

constantly yielded a mean Ct between 15.63 ± 0.11 and 16.83 ± 0.21 for all level of adulterations, reflecting that the endogenous target did not change significantly with a variation in adulterations because all adulterants were eukaryotic. The inter day relative standard deviations (RSDs) were calculated from the mean Ct values of the different spiked level model meat products and were found between 0.06 and 1.2%. Only seven samples produced RSDs ≥ 1.0%, but the other 47 out of the 54 samples yielded RSDs < 1.0% (Table 5). These clearly demonstrated that the developed tetraplex qPCR system was very sensitive, specific, and robust and can reliably detect all the three targets from 0.1% contaminated specimens. The tetraplex qPCR system was further validated for the analyses of processed meat products (frankfurters and meatballs). The analysis results (Table 6) of the three target species revealed that the target recoveries from 10% to 0.1% spiked level were 85.90−115.3% along with a systematic error between −14.10 and +15.3% and RSD 0.61−19.40%. Thus, the maximum recovery was 115.3% for the 10% spiked pork in buffalo meatball and minimum was 85.90% for the 10% spiked beef in pork meatball product, respectively. On the other hand, maximum RSD was found in buffalo frankfurter containing 0.1% pork adulteration and minimum RSD was found in 1% adulterated pork frankfurter. When a graph was generated by plotting the recovered values (y-axis) (Table 6) against the reference (actual) values (x-axis) for each target, a very high correlation coefficient (R2 = 0.9999) was attained (Figure 3), confirming that the experimental values were fairly close to their actual values. Druml et al.40 found 40.9% systematic error and 12.9% RSD for 2% adulteration, and Asing et al.15 found 23.10% systematic error and 1.69% RSD and for 0.1% contamination. Thus, the systematic error between −14.10 and +15.30% and RSD 0.61 and 19.40% of this assay was within the acceptable limits of the published reports. Residual Analysis. Residuals are differences between the actual or predicted and the measured values from a set of variables. They determine the experimental errors by subtracting the experimental value from the predicted value.26 Therefore, the graph of residual versus fitted recovery values of variables for both frankfurters and meatballs of three target

from species to species and samples to samples, but 0.003 ng detectable limit of the present assay made it highly sensitive for the adulteration authentication. Quantification and Efficiency of the Tetraplex Quantitative PCR System. The quantitative detection was performed by generating separate standard curves for each of three species and IAC by plotting the Ct values against the logarithmic value of each DNA concentration (30 ng/μL that came from total genomic DNA extracted from the ternary admixture of beef, buffalo, and pork mixed in a ratio of 1:1:1). The standard curve for cow was in the range from 30 ng to 0.03 ng whereas that of buffalo, pig, and IAC were from 30 ng to 0.003 ng (Figure 2e−h). Four point dilutions (30−0.03 ng) were used for the cattle quantification because a five point dilutions (30−0.003 ng) did not comply with the recommended PCR efficiency (90−110%).26 In all standard curves, a good linear regression were found for all measurements, wherein the regression coefficient (R2) was 0.9847, 0.9996, 0.9999, and 0.9978 for cow, buffalo, pig, and IAC, respectively, and the corresponding slopes were −3.1289, −3.1477, −3.4562, and −3.2288. The PCR efficiencies (E) were calculated using the formula described in methodology and were 108.73%, 107.82%, 94.68%, and 104.03% for cow, buffalo, pig, and IAC, respectively. These values were within the recommended values (90−110%),26 and thus, the generated standard curves and tetraplex qPCR systems were suitable for the quantitative determination of the target species contribution from mixed meat samples. The findings were supported by Cheng et al.29 in which the mqPCR efficiencies were 104.38, 91.75, and 97.46% for chicken, duck, and pig species, respectively. Similarly, Iwobi et al.30 found the efficiencies of their mqPCR system for beef and pork at 101.1% and 91.6%, respectively. Sensitivity and Validity of the Tetraplex qPCR Assay under Ternary and Commercial Matrixes. The sensitivity of the developed tetraplex qPCR assay was tested to detect the level of beef, buffalo, and pork in deliberately adulterated model ternary meat admixtures and all the species were detected until 0.1% adulteration in the ternary admixes. The Ct values of lower detectable quantity (0.1%) were 25.19 ± 0.23 to 27.68 ± 1.47 for all the three target species (Table 5), but the IAC E


Article


Figure 2. Amplification plots (a−d) and standard curves (e−h) of tetraplex qPCR products obtained from 10-fold serially diluted mixed DNA of three target species. Amplification plots and standard curves of (a and e) for beef, (b and f) for buffalo, (c and g) for pork, and (d and h) for endogenous control (IAC) specific qPCR systems, respectively.

species (cattle, buffalo, and porcine) were generated (Figure 4a−f). The random distribution of all variables were very low (within +2.0 to −2.0 from zero line) for frankfurter, whereas they were relatively higher (within +3.0 to −2.0 from zero line) for meatball products. These distributions of residuals indicated a good precision and accuracy of the developed tetraplex qPCR system for the measurement of 0.1−10% adulteration of the three target species in meat products.26 Analyses of Commercial Meat Products. Moral deterioration and companies’ profit first policies are probably the greatest factors for the replacement of an expensive meat item by its inferior and cheaper counterpart; therefore, most of the adulteration practices are skillfully done in processed meat

products where morphological features and other physical attributes are totally destroyed. Hotdogs, meatballs, and burgers are very popular meat products and very widely consumed all over the world. Therefore, 12 frankfurters (7 beef and 5 pork), 12 meatballs (7 beef and 5 pork), and 12 burgers (7 beef and 5 pork) were procured from various Malaysian outlets and were analyzed using the tetraplex qPCR assay (Table 7). The experimental results demonstrated that 71% of beef frankfurter, 100% of beef meatballs, and 85% of beef burgers were adulterated with buffalo meat, but no porcine DNA was found in beef products. Surprisingly no meat products were found to contain 100% buffalo, but all adulterated samples were found to contain both beef and buffalo, strongly suggesting that these F


Article

Journal of Agricultural and Food Chemistry Table 5. Mean Ct Values and Inter Day RSD of Different Model Meat Productsa mean Ct value products beef frankfurter

spike level (%) 10

1

0.1

buffalo frankfurter

10

1

0.1

pork frankfurter

10

1

0.1

beef meatball

10

1

0.1

buffalo meatball

10

1

0.1

pork meatball

10

1

0.1

a

species

day 1

day 2

day 3

SD

RSD (%)

beef buffalo pork beef buffalo pork beef buffalo pork buffalo beef pork buffalo beef pork buffalo beef pork pork beef buffalo pork beef buffalo pork beef buffalo beef buffalo pork beef buffalo pork beef buffalo pork buffalo beef pork buffalo beef pork buffalo beef pork pork beef buffalo pork beef buffalo pork beef buffalo

19.443 20.805 18.318 19.180 24.548 21.546 19.184 27.583 25.396 18.291 22.357 17.856 17.977 25.536 21.470 17.926 28.245 24.947 15.036 22.096 21.325 14.800 25.210 24.114 14.737 28.474 27.092 19.403 21.092 18.311 19.190 23.957 21.702 19.167 27.070 25.227 18.177 22.159 17.991 17.939 25.113 21.857 17.903 28.486 25.161 15.021 22.626 20.807 14.784 25.342 24.309 14.762 28.715 27.227

19.372 20.992 18.170 19.152 24.435 21.705 19.083 27.240 25.362 18.221 21.964 18.242 18.018 25.207 21.788 17.988 28.289 25.469 15.120 22.407 21.193 14.806 25.579 24.293 14.811 28.611 27.180 19.483 21.199 18.080 19.202 24.416 21.539 19.203 27.595 25.379 18.203 22.588 17.807 18.015 25.479 21.553 18.014 28.780 24.698 15.063 22.404 21.060 14.712 25.658 24.092 14.679 28.214 27.595

19.507 21.142 17.952 19.124 24.092 21.736 19.167 27.315 25.258 18.285 22.129 18.135 18.022 25.116 21.989 17.946 28.749 25.379 15.002 22.425 20.929 14.788 25.257 24.495 14.793 28.796 27.491 19.476 21.303 18.398 19.090 24.111 21.688 19.179 27.214 25.148 18.314 22.516 18.198 17.971 25.207 21.760 18.003 28.686 24.881 15.154 22.407 21.231 14.701 25.548 24.290 14.778 28.314 27.136

0.067 0.168 0.184 0.028 0.237 0.101 0.054 0.180 0.071 0.038 0.197 0.199 0.024 0.221 0.261 0.031 0.279 0.279 0.060 0.185 0.201 0.009 0.200 0.190 0.038 0.161 0.209 0.044 0.105 0.164 0.061 0.233 0.090 0.018 0.271 0.117 0.072 0.229 0.195 0.038 0.190 0.155 0.061 0.150 0.233 0.068 0.127 0.213 0.045 0.160 0.120 0.053 0.265 0.243

0.35 0.80 1.01 0.15 0.97 0.47 0.28 0.66 0.28 0.21 0.89 1.10 0.14 0.87 1.20 0.18 0.98 1.10 0.40 0.83 0.95 0.06 0.79 0.78 0.26 0.56 0.77 0.23 0.50 0.90 0.32 0.97 0.42 0.10 0.99 0.46 0.40 1.02 1.09 0.21 0.75 0.71 0.34 0.52 0.94 0.45 0.57 1.01 0.31 0.63 0.50 0.36 0.93 0.89

SD, standard deviation; RSD, relative standard deviation.

reflected that buffalo substitution in beef products are very rampant in Malaysia, and it is mainly done for economic gain since buffalo is cheaper than beef in Malaysian Markets but

adulterations were for the purpose of economic gain. On the other hand, all pork products were found to contain only pork and no contamination with beef and buffalo. These clearly G


Article

Journal of Agricultural and Food Chemistry Table 6. Reproducibility and Recovery of the Target Species in Model Meat Productsa content of target determined (%) products beef frankfurter

spike level (%) 10

1

0.1

buffalo frankfurter

10

1

0.1

pork frankfurter

10

1

0.1

beef meatball

10

1

0.1

buffalo meatball

10

1

0.1

pork meatball

10

1

0.1

a

species

day 1

day 2

day 3

mean

RSD (%)

recovery (%)

systematic error (%)

beef buffalo pork beef buffalo pork beef buffalo pork buffalo beef pork buffalo beef pork buffalo beef pork pork beef buffalo pork beef buffalo pork beef buffalo beef buffalo pork beef buffalo pork beef buffalo pork buffalo beef pork buffalo beef pork buffalo beef pork pork beef buffalo pork beef buffalo pork beef buffalo

80.01 12.51 9.27 97.09 0.809 1.079 96.81 0.088 0.083 78.69 9.37 12.61 99.00 0.903 1.135 102.8 0.123 0.112 82.53 11.36 8.55 96.58 1.148 1.112 100.7 0.104 0.126 82.40 10.14 9.311 96.39 1.247 0.973 98.03 0.128 0.093 85.53 10.84 11.52 101.8 1.233 0.877 104.5 0.103 0.097 83.36 7.690 12.49 97.62 1.042 0.964 99.06 0.087 0.114

84.31 10.91 10.23 99.12 0.879 0.971 104.3 0.113 0.085 82.82 12.52 9.750 96.08 1.151 0.918 98.21 0.119 0.079 78.04 9.03 9.42 96.20 0.875 0.975 95.88 0.094 0.118 77.69 9.38 10.86 95.54 0.891 1.084 95.47 0.087 0.084 83.92 7.91 13.03 96.29 0.942 1.074 96.36 0.083 0.132 81.06 9.054 10.38 102.4 0.826 1.129 104.7 0.126 0.087

76.33 9.76 11.83 101.2 1.129 0.951 98.03 0.107 0.091 79.03 11.09 10.47 95.80 1.231 0.803 101.3 0.085 0.084 84.42 8.92 11.42 97.36 1.109 0.841 97.03 0.082 0.094 78.09 8.69 8.788 103.75 1.114 0.982 97.17 0.115 0.098 77.37 8.33 10.04 99.44 1.151 0.936 97.14 0.089 0.117 76.29 9.034 9.159 103.2 0.895 0.977 98.00 0.117 0.122

80.21 11.06 10.44 99.13 0.939 1.00 99.71 0.103 0.086 80.18 10.99 10.94 96.96 1.095 0.952 100.77 0.109 0.092 81.66 9.77 9.79 96.71 1.04 0.976 97.87 0.093 0.113 79.39 9.40 9.65 98.56 1.08 1.013 96.89 0.11 0.092 82.27 9.03 11.53 99.17 1.11 0.962 99.33 0.092 0.115 80.23 8.59 10.67 101.07 0.92 1.02 100.58 0.110 0.108

4.98 12.49 12.38 2.07 17.92 6.88 4.03 12.71 4.82 2.86 14.35 13.59 1.83 15.62 17.71 2.32 19.16 19.40 4.01 14.11 15.02 0.61 14.14 13.88 2.57 11.80 14.78 3.29 7.71 11.16 4.58 16.59 6.09 1.34 19.05 7.74 5.25 17.55 12.97 2.79 13.53 10.51 4.52 11.20 15.22 4.49 9.10 15.78 2.99 11.98 8.96 3.58 18.56 17.03

100.26 110.60 104.40 101.15 93.90 100.00 99.90 103.00 91.00 100.22 109.90 109.40 98.93 109.50 95.20 100.97 109.00 92.00 102.07 97.70 97.90 98.68 104.00 97.60 98.06 93.00 113.00 99.23 94.00 96.50 100.57 108.00 101.30 97.08 110.00 92.00 102.83 90.30 115.30 101.19 111.00 96.20 99.52 92.00 115.00 100.28 85.90 106.70 103.13 92.00 102.00 100.78 110.00 108.00

0.26 10.60 4.40 1.15 −6.10 0.00 −0.10 3.00 −9.00 0.22 9.90 9.40 −1.07 9.50 −4.80 0.97 9.00 −8.00 2.07 −2.30 −2.10 −1.32 4.00 −2.40 −1.94 −7.00 13.00 −0.77 −6.00 −3.50 0.57 8.00 1.30 −2.92 10.00 −8.00 2.83 −9.70 15.30 1.19 11.0 3.80 −0.48 −8.00 15.00 0.28 −14.10 6.70 3.13 −8.00 2.00 0.78 10.00 8.00

RSD, relative standard deviation.

Cattle, buffalo, and porcine adulterations in food chains are threatening to public health, religions, cultures, and the economy. A reliable and low-cost analytical test that can detect

found stores are not mixing any porcine in halal products because of the strict monitoring of halal status by the Malaysian government. H


Article


and quantify all the three species in a single assay platform would definitely help with better market monitoring that might either prevent or reduce food falsification or mislabeling practices to a great extent. The short amplicon-length TaqMan Probe qPCR assay that was documented here is greatly reliable for the quantitative determination of cattle, buffalo, and porcine materials under any matrixes because specific targets were detected first by species-specific primers and second by the TaqMan probes, conforming to a double checking requirement. Third, the shorter length of the targets offered additional stability even under the state of decomposition, and fourth, the use of an internal positive control effectively eliminated the chances of any false negative detection. Species specificity of all targets was confirmed by cross-checking all the primers and probes against 25 nontarget species. The assay was sensitive enough to detect all the cattle, buffalo, and porcine targets in pure, admixed, and processed frankfurter and meatball samples having just 0.1% adulteration. Furthermore, the screening of the

Figure 3. Relationship between the experimental and reference values of the tetraplex qPCR system. The experimental quantity (mean value) obtained from the tetraplex qPCR assay for adulterated (0.1, 1, and 10%) model frankfurter and meatball of three target species plotted against the reference values that were used in their laboratory preparation.

Figure 4. Graph of residual versus fitted recovery values of the tetraplex qPCR assays the variablely adulterated (0.1, 1, and 10%) frankfurters and meatballs of beef (a and b), buffalo (c and d), and pork (e and f), respectively. I



■

Table 7. Screening of Model and Commercial Meat Products Using the Developed Tetraplex qPCR Assaya adulteration

sample

species

Model Frankfurter beef buffalo and pig beef buffalo and pig beef buffalo and pig buffalo cow and pig buffalo cow and pig buffalo cow and pig pork cow and buffalo pork cow and buffalo pork cow and buffalo Model Meatball beef buffalo and pig beef buffalo and pig beef buffalo and pig buffalo cow and pig buffalo cow and pig buffalo cow and pig pork cow and buffalo pork cow and buffalo pork cow and buffalo Commercial Products beef frankfurter pork frankfurter beef meatball pork meatball beef burger pork burger

%

cattle

buffalo

pig

10.0

3/3

3/3

3/3

100

1.0

3/3

3/3

3/3

100

0.1

3/3

3/3

3/3

100

10.0 1.0 0.1 10.0

3/3 3/3 3/3 3/3

3/3 3/3 3/3 3/3

3/3 3/3 3/3 3/3

100 100 100 100

1.0

3/3

3/3

3/3

100

0.1

3/3

3/3

3/3

100

10.0

3/3

3/3

3/3

100

1.0

3/3

3/3

3/3

100

0.1

3/3

3/3

3/3

100

10.0 1.0 0.1 10.0

3/3 3/3 3/3 3/3

3/3 3/3 3/3 3/3

3/3 3/3 3/3 3/3

100 100 100 100

1.0

3/3

3/3

3/3

100

0.1

3/3

3/3

3/3

100

7/7

5/7

0/7

100

0/5

0/5

5/5

100

7/7

7/7

0/7

100

0/5

0/5

5/5

100

7/7 0/5

6/7 0/5

0/7 5/5

100 100

*E-mail: [email protected], [email protected]. Phone: +603-7967-6959. Fax: +603-7967-6956. ORCID

Md. Eaqub Ali: 0000-0002-7384-3936 Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS The authors acknowledged the University of Malaya Research Grant No. PG288-2016A awarded to M. E. Ali for this work. The authors also thank Wildlife Malaysia and Dewan Bandaraya, Kuala Lumpur (DBKL), for donating monkey, dog, and cat meat samples for this study.

■

ABBREVIATIONS USED Cytb, cytochrome b; DNA, deoxyribonucleic acid; PCR, polymerase chain reaction; mqPCR, multiplex quantitative PCR; bp, base pair; IAC, endogenous control; LOD, limit of detection

■

REFERENCES

(1) Regulation (EC) No. 178/2002 of the European Parliament and of the Council, Official Journal of the European Communities, 2002; eur-lex.europa.eu/LexUriServ/LexUriServ.do?uri= OJ:L:2002:031:0001:0024:en:PDF (accessed June 23, 2016). (2) United States Department of Agriculture, Food Safety and Inspection Service. Inspection Requirements; Adulteration & Misbranding, Federal Meat Inspection Act, 2016; http://www.fsis.usda. gov/wps/portal/fsis/topics/rulemaking/federal-meat-inspection-act (accessed June 23, 2016). (3) Cawthorn, D. M.; Steinman, H. A.; Hoffman, L. C. A high incidence of species substitution and mislabelling detected in meat products sold in South Africa. Food Control 2013, 32, 440−449. (4) Hsieh, Y.-H. P.; Woodward, B. B.; Ho, S.-H. Detection of species substitution in raw and cooked meats using immunoassays. J. Food Prot. 1995, 58, 555−559. (5) Bourguiba-Hachemi, S.; Fathallah, M. D. DNA testing of meat foods raises issues beyond adulteration. Sky J. Food Sci. 2016, 5, 001− 007. (6) Ayaz, Y.; Ayaz, N. D.; Erol, I. Detection of species in meat and meat products using enzyme-linked immunosorbent assay. J. Muscle Foods 2006, 17, 214−220. (7) Ali, M. E.; Razzak, M. A.; Hamid, S. B. A. Multiplex PCR in Species Authentication: Probability and ProspectsA Review. Food Anal. Methods 2014, 7, 1933−1949. (8) Ali, M. E.; Asing; Hamid, S. B. A.; Razzak, M. A.; Rashid, N. R. A.; Amin, M. A.; Mustafa, S. A suitable method to detect potential fraud of bringing Malayan box turtle (Cuora amboinensis) meat into the food chain. Food Addit. Contam., Part A 2015, 32, 1223−1233. (9) Herrero, B.; Vieites, J. M.; Espiñeira, M. Fast real-time PCR for the detection of crustacean allergen in foods. J. Agric. Food Chem. 2012, 60, 1893−1897. (10) United States Department of Agriculture. Zoonotic Diseases of Sheep and Goats, 2015; https://www.aphis.usda.gov/aphis/ourfocus/ animalhealth/animal-disease-information/sheep-and-goat-health/ national-scrapie-eradication-program/ct_zoonotic_disease (accessed June 23, 2016). (11) Bottero, M. T.; Dalmasso, A. Animal species identification in food products: Evolution of biomolecular methods. Vet. J. 2011, 190, 34−38. (12) Hossain, M. M.; Ali, M. E.; Abd Hamid, S. B.; Mustafa, S.; Mohd Desa, M. N.; Zaidul, I. Double Gene Targeting Multiplex Polymerase Chain Reaction−Restriction Fragment Length Polymorphism Assay

a

The numerator and denominator of each fraction denote the number of positive detection and total number of samples analyzed using the multiplex real-time PCR assay.

commercial food samples reflected that the assay could be applied for the analysis of real-world samples. Thus, the novel quantitative PCR assay described here provided convincing evidence that it could be used by regulatory bodies for the quantitative discrimination of cattle, buffalo, and porcine materials in any food sample even under degraded conditions.

■

AUTHOR INFORMATION

Corresponding Author

detected species PCR accuracy (%)

Article

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.jafc.7b00730. Comparison of nucleotide sequences Bos Taurus, Bos Taurus indicus, and Bubalus bubalis ND5 genes as aligned by MEGA5 (PDF) J


Article

Journal of Agricultural and Food Chemistry Discriminates Beef, Buffalo, and Pork Substitution in Frankfurter Products. J. Agric. Food Chem. 2016, 64, 6343−6354. (13) Girish, P. S.; Haunshi, S.; Vaithiyanathan, S.; Rajitha, R.; Ramakrishna, C. A rapid method for authentication of Buffalo (Bubalus bubalis) meat by Alkaline Lysis method of DNA extraction and species specific polymerase chain reaction. J. Food Sci. Technol. 2013, 50 (1), 141−146. (14) Nejad, F. P.; Tafvizi, F.; Ebrahimi, M. T.; Hosseni, S. E. Optimization of multiplex PCR for the identification of animal species using mitochondrial genes in sausages. Eur. Food Res. Technol. 2014, 239, 533−541. (15) Asing; Ali, E.; Hamid, S. B. A.; Hossain, M.; Ahamad, M. N. U.; Hossain, S. M. A.; Naquiah, N.; Zaidul, I. S. M. Duplex real time PCR assay using SYBR Green detect and quantify Malayan Box Turtle (Cuora amboinensis) materials in meatballs, burgers, frankfurters and traditional Chinese herbal jelly powder. Food Addit. Contam., Part A 2016, 33, 1643. (16) Focke, F.; Haase, I.; Fischer, M. DNA-based identification of spices: DNA isolation, whole genome amplification, and polymerase chain reaction. J. Agric. Food Chem. 2011, 59, 513−520. (17) Lopez, I.; Pardo, M. A. Application of relative quantification TaqMan real-time polymerase chain reaction technology for the identification and quantification of Thunnus alalunga and Thunnus albacares. J. Agric. Food Chem. 2005, 53, 4554−4560. (18) Ali, M. E.; Al Amin, M.; Razzak, M. A.; Hamid, S. B. A.; Rahman, M. M.; Rashid, N. A. Short Amplicon-Length PCR Assay Targeting Mitochondrial Cytochrome b Gene for the Detection of Feline Meats in Burger Formulation. Food Anal. Methods 2016, 9, 571−581. (19) Rahman, M. M.; Ali, M. E.; Hamid, S. B. A.; Mustafa, S.; Hashim, U.; Hanapi, U. K. Polymerase chain reaction assay targeting cytochrome b gene for the detection of dog meat adulteration in meatball formulation. Meat Sci. 2014, 97 (4), 404−409. (20) Fajardo, V.; González, I.; López-Calleja, I.; Martín, I.; Hernández, P. E.; García, T.; Martín, R. PCR-RFLP authentication of meats from red deer (Cervus elaphus), fallow deer (Dama dama), roe deer (Capreolus capreolus), cattle (Bos taurus), sheep (Ovis aries), and goat (Capra hircus). J. Agric. Food Chem. 2006, 54, 1144− 1150. (21) Quinteiro, J.; Vidal, R.; Izquierdo, M.; Sotelo, C. G.; Chapela, M. J.; Pérez-Martín, R. I.; Rehbein, H.; Hold, G. L.; Russell, V. J.; Pryde, S. E. Identification of hake species (Merluccius genus) using sequencing and PCR−RFLP analysis of mitochondrial DNA control region sequences. J. Agric. Food Chem. 2001, 49, 5108−5114. (22) Fernández-Tajes, J.; Méndez, J. Identification of the razor clam species Ensis arcuatus, E. siliqua, E. directus, E. macha, and Solen marginatus using PCR-RFLP analysis of the 5S rDNA region. J. Agric. Food Chem. 2007, 55, 7278−7282. (23) Hossain, M. M.; Ali, M. E.; Hamid, S. B. A.; Mustafa, S.; Desa, M. N. M.; Zaidul, I. Targeting double genes in multiplex PCR for discriminating cattle, buffalo and porcine materials in food chain. Food Control 2017, 73, 175. (24) Giusti, A.; Castigliego, L.; Rubino, R.; Gianfaldoni, D.; Guidi, A.; Armani, A. A Conventional Multiplex PCR assay for the detection of toxic Gemfish species (Ruvettus pretiosus and Lepidocybium flavobrunneum): a simple method to combat health frauds. J. Agric. Food Chem. 2016, 64, 960−968. (25) Saez, R.; Sanz, Y.; Toldra, F. PCR-based fingerprinting techniques for rapid detection of animal species in meat products. Meat Sci. 2004, 66, 659−665. (26) Ali, M. E.; Hashim, U.; Mustafa, S.; Man, Y. C.; Dhahi, T. S.; Kashif, M.; Uddin, M. K.; Hamid, S. B. A. Analysis of pork adulteration in commercial meatballs targeting porcine-specific mitochondrial cytochrome b gene by TaqMan probe real-time polymerase chain reaction. Meat Sci. 2012, 91 (4), 454−459. (27) Ramos-Gómez, S.; López-Enriíquez, L.; Caminero, C.; Hernández, M. Pea detection in food and feed samples by a realtime PCR method based on a specific legumin gene that allows diversity analysis. J. Agric. Food Chem. 2008, 56 (23), 11098−11104.

(28) Di Pinto, A.; Di Pinto, P.; Terio, V.; Bozzo, G.; Bonerba, E.; Ceci, E.; Tantillo, G. DNA barcoding for detecting market substitution in salted cod fillets and battered cod chunks. Food Chem. 2013, 141 (3), 1757−1762. (29) Cheng, X.; He, W.; Huang, F.; Huang, M.; Zhou, G. Multiplex real-time PCR for the identification and quantification of DNA from duck, pig and chicken in Chinese blood curds. Food Res. Int. 2014, 60, 30−37. (30) Iwobi, A.; Sebah, D.; Kraemer, I.; Losher, C.; Fischer, G.; Busch, U.; Huber, I. A multiplex real-time PCR method for the quantification of beef and pork fractions in minced meat. Food Chem. 2015, 169, 305−313. (31) Ali, M. E.; Razzak, M. A.; Hamid, S. B. A.; Rahman, M. M.; Amin, M. A.; Rashid, N. R. A.; Asing. Multiplex PCR assay for the detection of five meat species forbidden in Islamic foods. Food Chem. 2015, 177, 214−224. (32) Arya, M.; Shergill, I. S.; Williamson, M.; Gommersall, L.; Arya, N.; Patel, H. R. Basic principles of real-time quantitative PCR. Expert Rev. Mol. Diagn. 2005, 5, 209−219. (33) Lopparelli, R. M.; Cardazzo, B.; Balzan, S.; Giaccone, V.; Novelli, E. Real-Time TaqMan Polymerase Chain Reaction Detection and Quantification of Cow DNA in Pure Water Buffalo Mozzarella Cheese: Method Validation and Its Application on Commercial Samples. J. Agric. Food Chem. 2007, 55, 3429−3434. (34) Köppel, R.; Ruf, J.; Rentsch, J. Multiplex real-time PCR for the detection and quantification of DNA from beef, pork, horse and sheep. Eur. Food Res. Technol. 2011, 232, 151−155. (35) Hossain, M. M.; Ali, M. E.; Hamid, S. B. A.; Hossain, S. A.; Nizar, N. N. A.; Uddin, M. N.; Ali, L.; Asaduzzaman, M.; Akanda, M. J. H. Tetraplex PCR assay involving double gene-sites discriminates beef and buffalo in Malaysian meat curry and burger products. Food Chem. 2017, 224, 97−104. (36) Razzak, M. A.; Hamid, S. B. A.; Ali, M. E. A lab-on-a-chip-based multiplex platform to detect potential fraud of introducing pig, dog, cat, rat and monkey meat into the food chain. Food Addit. Contam., Part A 2015, 32, 1902−1913. (37) Ali, M. E.; Hashim, U.; Dhahi, T. S.; Mustafa, S.; Man, Y. B. C.; Latif, M. A. Analysis of Pork Adulteration in Commercial Burgers Targeting Porcine-Specific Mitochondrial Cytochrome B Gene by TaqMan Probe Real-Time Polymerase Chain Reaction. Food Anal. Methods 2012, 5, 784−794. (38) Druml, B.; Mayer, W.; Cichna-Markl, M.; Hochegger, R. Development and validation of a TaqMan real-time PCR assay for the identification and quantification of roe deer (Capreolus capreolus) in food to detect food adulteration. Food Chem. 2015, 178, 319−326. (39) López-Calleja, I. M.; de la Cruz, S.; González, I.; García, T.; Martín, R. Duplex real-time PCR using TaqMan® for the detection of sunflower (Helianthus annuus) and poppy (Papaver rhoeas) in commercial food products. LWT-Food Sci. Technol. 2016, 65, 999− 1007. (40) Rojas, M.; González, I.; Pavón, M. Á .; Pegels, N.; Lago, A.; Hernández, P. E.; García, T.; Martín, R. Novel TaqMan real-time polymerase chain reaction assay for verifying the authenticity of meat and commercial meat products from game birds. Food Addit. Contam., Part A 2010, 27, 749−763. (41) Köppel, R.; Ruf, J.; Zimmerli, F.; Breitenmoser, A. Multiplex real-time PCR for the detection and quantification of DNA from beef, pork, chicken and turkey. Eur. Food Res. Technol. 2008, 227, 1199− 1203.

K


Quantitative Tetraplex Real-Time Polymerase Chain Reaction Assay

Recommend Documents