Rapid and Sensitive Quantification of Anammox Bacteria by Flow

May 23, 2019 - In this study, a feasible and reliable quantification method ... The CARD-FISH protocol with an in-solution hybridization approach that...
0 downloads 0 Views 2MB Size
Download PDF
Article Cite This: Environ. Sci. Technol. 2019, 53, 6895−6905

pubs.acs.org/est

Rapid and Sensitive Quantification of Anammox Bacteria by Flow Cytometric Analysis Based on Catalyzed Reporter Deposition Fluorescence In Situ Hybridization Yijing Zhu, Yayi Wang,* Yuan Yan, and Hao Xue State Key Laboratory of Pollution Control and Resources Reuse, Shanghai Institute of Pollution Control and Ecological Security, College of Environmental Science and Engineering, Tongji University, Siping Road, Shanghai 200092, P. R. China Downloaded via UNIV OF SOUTHERN INDIANA on July 22, 2019 at 06:56:12 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

S Supporting Information *

ABSTRACT: The quantification of anammox bacteria is crucial to manipulation and management of anammox biosystems. In this study, we proposed a protocol specifically optimized for quantification of anammox bacteria abundance in anammox sludge samples using catalyzed reporter deposition-fluorescence in situ hybridization (CARD-FISH) and flow cytometry (FCM) in combination (Flow-CARDFISH). We optimized the pretreatment procedures for FCMcompatibility, as well as the permeabilization, hybridization and staining protocols of the CARD-FISH. The developed method was compared with other methods for specific bacteria quantification (standard FISH, 16S rRNA sequencing and quantitative polymerase chain reaction). Anammox sludge samples could be disaggregated effectively by sonication (specific energy of 90 kJ·L−1 with MLVSS of 3−5 g·L−1) with the mixed ionic and nonionic dispersants Triton X-100 (5%) and sodium pyrophosphate (10 mM). Lysozyme treatment for permeabilizing bacterial cell walls and H2O2 incubation for completely quenching endogenous peroxidase of anammox sludges were essential to fluorescence enhancement and false positive signals control, respectively. Horseradish peroxidase molecules labeling at 20 °C for 12 h and the fluorescent tyramide labeling at 25 °C for 30 min with a fluorescent substrate concentration of 1:50 maintained the balance between increasing the signal and preventing nonspecific binding. Flow-CARD-FISH results showed that anammox bacteria absolute abundance in two different sludge samples were (2.31 ± 0.01) × 107 and (1.20 ± 0.06) × 107 cells·mL−1, respectively, with the relative abundances of 36.7 ± 4.1% and 26.5 ± 3.7%, respectively, comparable with those of qPCR and 16S rRNA sequencing analysis. The enhanced fluorescence signals induced by CARD-FISH combined with the high quantitative fluorescence sensitivity of FCM provide a rapid and sensitive method that yields accurate quantification results that will be valuable in future studies of microbial community determination.

■

INTRODUCTION Anammox bacteria are the most important functional microorganisms in anammox-based processes, which are widely perceived as novel alternatives to the traditional biological nitrogen removal technology.1,2 The quantification of anammox bacteria is essential to manipulation and management of anammox ecosystems. Widely used methods for quantification of anammox bacteria include fluorescence in situ hybridization (FISH), quantitative polymerase chain reaction (qPCR), and 16S rRNA sequencing. The recently popular method, 16S rRNA sequencing technology, could provide accurate information about microbial community structure,3 while the high cost of the next-generation sequencing platform4 (e.g., Illumina MiSeq and Illumina HiSeq2000) could not be avoided. Compared with the former, qPCR technology presented to be more cost-effective, while the presently available primers of anammox bacteria (such as AMX368F-AMX820R) could hardly specifically distinguish different genera of anammox bacteria.5,6 Among these widely © 2019 American Chemical Society

used methods, FISH combined with epifluorescence microscopy has prevailed in anammox bacteria quantification.7−10 This is largely because the oligonucleotide probes used in FISH can be designed to be complementary to species-, group-, or genus-specific target sites,11 which ensures specificity of the method. However, the use of epifluorescence microscopy is greatly limited in its ability to detect bacteria with slow growth rates (e.g., anammox bacteria), and is considered to be labor-intensive and time-consuming.12 The application of flow cytometry (FCM) provides a more rapid and reliable quantification than epifluorescence microscopy, ensuring accuracy and precision in enumeration.13−15 However, previous studies have demonstrated that FISH gives a signal that is too weak for flow-cytometric measurements,16,17 Received: Revised: Accepted: Published: 6895

February 19, 2019 May 14, 2019 May 23, 2019 May 23, 2019 DOI: 10.1021/acs.est.9b01017 Environ. Sci. Technol. 2019, 53, 6895−6905

Article

Environmental Science & Technology

times (1 × PBS), cells were resuspended in ethanol/PBS (1:1, v/v) and then stored at −20 °C. Pretreatments for Homogenization of Sludge Samples. For flow cytometric measurements, nonsuspension cell samples must be disaggregated prior to staining/hybridization. (1) Chemical treatment with different dispersants: Three dispersants were tested separately and in combination at various concentrations, the ionic dispersant sodium pyrophosphate (SP, Sigma-Aldrich), as well as two nonionic surfactants, Triton X-100 (TX, Sigma-Aldrich) and Tween 80 (TW, Sigma-Aldrich) (10 and 20 mM for SP; 1 and 5% v/v for TX and TW). Samples were incubated in dispersants for 20 min in the dark at 25 °C. Each treatment was analyzed in triplicate, with one paired control (dispersant free samples) per replicate. (2) Physical treatment with low and high energy sonication: A total of 10 mL of pelleted sludge was resuspended in 10 mL dispersant and subjected to sonication with different energy inputs. Low energy sonication (LES) was applied by a sonicating water bath (40 kHz) for 5 and 10 min. For high energy sonication (HES) using an ultrasonic probe (20 kHz, power input of 20 W), samples were maintained on ice (working for 1 s with a 3 s interval) for 1, 3, and 5 min. The reference parameter, transferred specific energy Es,27,28 was used to evaluate the HES treatment.

which greatly limits the utilization of FISH for identification of microbes with slow growth rates (e.g., anammox bacteria) or low ribosome contents.18 Catalyzed reporter deposition (CARD)-FISH is a methodical improvement in fluorescence signal enhancement19 that has been applied to the detection and quantification of microorganisms characterized by low ribosome contents or rather low abundance, such as marine microorganisms, biofilms, and benthic detritus.20−22 Briefly, hybridization is followed by catalysis and accumulation of fluorescent tyramides at the horseradish peroxidase (HRP) molecules during tyramide signal amplification (TSA).23 Numerous fluorescent molecules can be introduced at the hybridization site through the reaction of fluorochrome-labeled tyramides with HRP molecules.19 This contributes to greatly enhanced fluorescence signals compared to probes with a single fluorochrome.19,24 The high fluorescent signal intensity of CARD-FISH favors the discrimination of targeted microorganisms from others and the background signals, ensuring high accuracy and sensitivity. In the previous study, the detection rates of coastal North Sea bacterioplankton by CARD-FISH were significantly higher (mean, 94% of total cell counts) than that with a monolabeled probe (mean, 48%).19 Besides, no unspecific staining was observed after CARDFISH.19 The enhanced fluorescence intensities and signal-tobackground ratios make CARD-FISH superior to monolabeled-FISH for the staining of bacteria with low rRNA content. However, previous studies reported that CARD-FISH detected at most 40% of the anammox cells detected by standard FISH.25 A similar phenomenon was also observed by Schönhuber et al., who found that CARD-FISH stained only half of the targeted bacteria that were stained with standard FISH.26 Therefore, the CARD-FISH protocol should be modified for anammox bacteria quantification. In this study, a feasible and reliable quantification method combining CARD-FISH and FCM (Flow-CARD-FISH) is proposed. Specifically, we optimized the preparation and permeabilization procedures, hybridization, and staining protocols of CARD-FISH for quantification of anammox bacteria in anammox sludge. We also compared the developed protocol against other commonly employed quantification methods. The proposed anammox cell quantification method characterized by rapidity, accuracy, and cost-effectiveness can serve to evaluate the performance and provide management guidance for manipulation of anammox biosystems.

Es = P × t /V , kJ·L−1

(1)

transferred power, P; time, t; treated volume,V Es values of 30, 90, and 150 kJ·L−1 (1, 3, and 5 min treatment, which are equivalent to 8 ± 1 kJ·g−1 VSS, 25 ± 5 kJ· g−1 VSS and 42 ± 8 kJ· g−1 VSS, respectively) were used for HES. Each physical treatment was analyzed in triplicate, with one paired control (samples submerged in dispersants) per replicate. Optimization of Cell Wall Permeabilization. Homogenized samples (50 μL) were incubated in 1 mL permeabilization solutions at 25 °C for 1 h. Three reagents for permeabilization were tested at various concentrations: lysozyme (>23,000 U· mg−1; 0.2 and 0.5 mg·mL−1 in 0.1 M Tris-HCl; SigmaAldrich), proteinase K (≥30 units·mg−1; 0.2 and 0.5 mg·mL−1 in 0.1 M Tris-HCl; Merck), sodium dodecyl sulfate (SDS, 10 and 20% v/v in ultrapure water, Sigma-Aldrich). Inactivation of Endogenous Peroxidase and Biotin. (1) Quenching endogenous peroxidase activity: Fixed and permeabilized samples (50 μL) were incubated in 1 mL H2O2 solution (final concentration, 3% in ultrapure water) at 25 °C to quench the endogenous peroxidase activity of bacteria in samples. Incubation time of 30, 60, 90 min was evaluated separately to explore the proper quenching duration for anammox sludge samples. (2) Blocking endogenous biotin: Endogenous biotin in samples was blocked with an Endogenous Biotin-Blocking Kit (Invitrogen, Waltham, MA) to prevent unspecific binding of endogenous biotin and streptavidin molecules. Samples were then subjected to normal blocking with 5% goat serum (Invitrogen) at 25 °C for 60 min. Hybridization In-Solution. The CARD-FISH protocol with an in-solution hybridization approach that was used in this

■

MATERIALS AND METHODS Sample Collection. The proposed method was applied to sludge samples denoted Sludge-J (MLVSS of 4500 mg·L−1) and Sludge-K (MLVSS of 3000 mg·L−1), which were collected from two different anammox bioreactors. Each sample was hybridized in triplicate and analyzed in duplicate by FCM. The results of CARD-FISH obtained by FCM were compared with those other quantification methods; specifically, FISH obtained by FCM, FISH for epifluorescence microscopy, 16S rRNA sequencing analysis and qPCR. Detailed descriptions of the other quantification methods are provided in the Supporting Information and Materials and Methods. All method optimizations were performed using Sludge-J samples. Flow-CARD-FISH (in-solution) Protocol Optimization. Immediately after collection, samples were fixed with a solution of paraformaldehyde (4%, Sigma-Aldrich). After washing three 6896

DOI: 10.1021/acs.est.9b01017 Environ. Sci. Technol. 2019, 53, 6895−6905

Article

Environmental Science & Technology

Figure 1. Effects of chemical dispersants (A) and physical sonication (B) on the dislodgment and homogenization of bacteria from sludge samples. Main bars indicate mean bacteria (DAPI-stained) abundance, while error bars indicate the standard deviation of three replicates. The treatments found to significantly influence total bacteria counts are indicated by asterisks: *, P < 0.05; **, p < 0.01. Chemical dispersants: SP, sodium pyrophosphate; TX, Triton X-100; TW, Tween 80. Physical sonication: LES, low energy sonication, was applied by a sonicating water bath (40 kHz) for 5 and 10 min; HES, high energy sonication, was applied by an ultrasonic probe operating at 20 kHz frequency with a power input of 20 W. The transferred specific energy (Es, eq 1) was used to evaluate HES treatment. Es values of 30, 90, and 150 kJ·L−1 (1, 3, and 5 min) were used for HES.

mL−1, Thermo Scientific, U.S.) at 25 °C for 15 min in the dark. Samples were used for FCM analysis within 2 h after resuspension and counterstaining. Both the CARD-FISH and FISH-labeled samples were analyzed in duplicate using a BD FACSVerse flow cytometer (Becton Dickinson, Franklin Lakes, NJ). Forward scatter (FSC), side scatter (SSC), and fluorescence signals (450 ± 25 nm, DAPI; 660 ± 10 nm, Alexa Fluor 647) were measured in logarithmic amplification mode. Signals of bacteria were separated from the background according to DAPI fluorescence signals, FSC and SSC in the scatter grams of SSC/FSC versus DAPI. Blanks consisting of PBS buffer were processed identically to samples to correct the bacteria counts. The targeted anammox bacteria were distinguished by setting the gate based on their enhanced fluorescence of Alexa Fluor 647 in fluorescence intensity histograms. About 10 000 cells for each sample were counted, and the targeted gates were defined according to negative controls. Subsequent analyses were performed using the FlowJo software (Tree Star Inc., Ashland, OR). The fluorescence intensity was expressed as the mean fluorescence intensity (MFI) and the MFI ratio was calculated as the ratio of the MFI value of the specific-labeled samples to that of negative controls. Detection rates were calculated by the fraction of DAPI-stained cells that were detected with hybridization (anammox bacteria). To calculate the relative proportions of anammox bacteria, the detection rate of positive samples was corrected by the detection rate of the negative control. Statistical Analyses. All statistical analyses were performed using SPSS (Ver. 23.0, SPSS Inc., Chicago, IL) and Origin 2019 (Origin Lab Corporation, Northampton, MA). The effects of the different dispersants and mechanical treatments on sludge homogenization were tested using paired t-tests against the controls. The fluorescence signal enhancements and the results of different quantification methods were tested with two-way analysis of variance (ANOVA) and differences with an adjusted p < 0.05 were considered to be statistically significant.

study is based on a previously described procedure.19,29,30 The nonsense NON338 probe (ACTCCTACGGGAGGCAGC)31 was used as the negative control probe to test nonspecific probe binding. The negative control probe NON338 and specific probes AMX368 (CCTTTCGGGCATTGCGAA),5 KST1275 (TCGGCTTTATAGGTTTCGCA),32 and JEC152 (ATGGAACCTTTCAGCCCC)33 labeled at the 5′ end with biotin were used for CARD-FISH. Sludge samples were pelleted (8000g, 10 min), then resuspended in 50 μL hybridization buffer (900 mM NaCl, 20 mM Tris-HCl, 0.1% SDS, 30% formamide, 5% goat serum). Next, 20 μL NON338 and specific probe stock solution (concentrations of 5 and 20 μM) were added as negative controls and experimental samples, respectively. After insolution hybridization was performed at 46 °C for 2 h on an orbital shaker, samples were rinsed with prewarmed (48 °C) washing buffer (3 mM NaCl, 5 mM EDTA, 20 mM Tris-HCl, 0.01% SDS) and incubated at 48 °C for 15 min, then rinsed for three times with precooled (4 °C) ultrapure water. TSA Optimization. The TSA process consisted of HRP labeling and fluorescent tyramide labeling. Samples (50 μL) were incubated in diluted HRP conjugation streptavidin solution (1 mL; 1:50 in 1% blocking reagent, Invitrogen) for 12 h at different temperatures (10 °C, 20 °C, 30 °C), then washed three times with 0.1% (v/v) Triton X-100 amended PBS (PBSTx) at 25 °C. For fluorescent tyramide labeling, pelleted samples (50 μL) were incubated in tyramide working solution (50 μL, diluted Alexa Fluor 647-labeled tyramide stock solution with amplification buffer) at 25 °C for 15 or 30 min. After incubation, cells were washed in sequence with PBSTx, ultrapure water and 96% ethanol in the dark. To test whether a higher fluorescent substrate concentration would increase detectability, a concentration series of tyramide-Alexa Fluor 647 was performed at the following dilutions (parts of tyramide-Alexa Fluor 647: parts of amplification buffer): 1:100, 1:50, and 1:25. Flow Cytometric Measurements and Analyses. Samples were dispersed by sonication using an ultrasonic probe for 30 s (20 kHz, 20 W) and diluted with filtered 1 × PBS. Next, 500 μL of diluted suspensions containing about 1010 cells·L−1 were counterstained with 20 μL of DAPI (5 μg· 6897

DOI: 10.1021/acs.est.9b01017 Environ. Sci. Technol. 2019, 53, 6895−6905

Article

Environmental Science & Technology Table 1. Effects of Different Permeabilization Treatments on Monolabeled-FISH/CARD-FISH Analyzed by FCMa detection rated (%, mean ± SD)

MFIb (a.u., mean ± SD)

hybridization CARD-FISH

monolabeledFISH

permeabilization treatment without permeabilization lysozyme-0.2 mg·L−1 lysozyme-0.5 mg·L−1 proteinase K-0.2 mg·L−1 proteinase K-0.5 mg·L−1 SDS-10% SDS-20% without permeabilization lysozyme-0.2 mg·L−1 lysozyme-0.5 mg·L−1

negative

positive

MFI ratioc (a.u., mean ± SD)

2.9 ± 0.1

3.2 ± 0.2

1.1 ± 0.2

0.1 ± 0.1

0.3 ± 0.2

0.2 ± 0.1

50.8 ± 1.4

125.0 ± 9.3

2.5 ± 0.5

25.2 ± 2.2

54.8 ± 8.1

29.6 ± 1.3

12.6 ± 2.1

258.0 ± 15.3

20.5 ± 5.5

25.6 ± 3.7

62.3 ± 7.8

112.3 ± 10.4

472.5 ± 18.2

4.2 ± 1.1

30.3 ± 2.9

74.0 ± 6.2

43.7 ± 3.5

18.3 ± 3.2

82.8 ± 8.6

525.1 ± 11.8

6.3 ± 1.8

18.4 ± 1.7

77.1 ± 5.3

58.7 ± 4.6

19.7 ± 4.8

49.9 ± 6.9 19.0 ± 4.4

365.2 ± 17.5 116.0 ± 9.7

7.3 ± 2.5 6.1 ± 2.4

30.8 ± 3.2 16.8 ± 1.7

55.4 ± 2.1 43.1 ± 1.5

24.6 ± 5.2 26.3 ± 4.7

30.7 ± 3.6 64.5 ± 5.7

19.7 ± 4.5

37.1 ± 7.8

1.9 ± 0.5

0.5 ± 0.2

30.3 ± 4.3

29.8 ± 3.5

20.5 ± 6.1

41.4 ± 9.5

2.0 ± 0.7

0.8 ± 0.3

37.1 ± 6.2

36.3 ± 5.3

9.8 ± 0.5

26.0 ± 11.2

57.3 ± 14.6

2.2 ± 1.8

0.3 ± 0.1

36.0 ± 5.5

35.6 ± 5.0

9.9 ± 2.1

negative

positive

detected percentageof anammox bacteriae (%, mean ± SD)

36.7 ± 4.1

total cellloss ratef (%, mean ± SD)

13.6 ± 1.4 12.1 ± 2.5

The percentage in bold type is the result obtained by the optimized Flow-CARD-FISH method. bMFI, mean fluorescence intensity. cMFI ratio, the ratio between the MFI of the specific-label tested to the MFI of the negative control (hybridized with nonsense NON338 probe). dDetection rate, the fraction of DAPI-stained cells that were detected with FISH or CARD-FISH. eDetected percentage of anammox bacteria, the proportion of anammox cells was corrected by eliminating background fluorescence, which was measured in negative controls prepared using the nonsense NON338 probe. fTotal cell loss rate, the percentage of cell loss caused by permeabilization to the total cell counts in samples without permeabilization based on the DAPI stained total counts. a

■

g−1 VSS) had almost no negative effect on the bacterial counts (paired t-test, p < 0.05) (Figure 1B), indicating that the anammox aggregates are more resistant to ultrasound than traditional activated sludge samples. These findings implied that anammox bacteria could endure pretreatment of HES by immersion in dispersants for flow cytometric analysis. Flow cytometry-compatible CARD-FISH processes have been reported previously.19,29,30,39,40 For these analyses, cells must be immobilized on solid supports (e.g., membrane filters), then detached and resuspended for measurements. In the present study, the proposed in-solution CARD-FISH labeled cells directly in suspension, bypassing immobilizing steps, which greatly simplified the labeling process and made sample preparation less laborious. Optimization of CARD-FISH for Anammox Bacteria Quantification. Optimized sample preparation, TSA protocols and FCM analyses can lead to accurate and reproducible microorganism quantification. Specifically, detected anammox bacteria are easily distinguishable from other bacteria and the electronic background noise due to the high signal intensities. Bacterial Cell Wall Permeabilization. The critical step of CARD-FISH is the diffusion of large molecules such as enzymes (HRP) and streptavidin into fixed cells, which requires cell wall permeabilization treatment.41 Moreover, the permeation procedure is often species-dependent,42 and an appropriate permeabilization treatment is essential to anammox bacteria quantification by CARD-FISH, while no appropriate permeation procedure has been developed for anammox bacteria to date. Achromopeptidase has been used to permeabilize anammox bacteria for CARD-FISH identification and localization in marine ecosystems.25 In this study, lysozyme (0.2 and 0.5 mg· mL−1), proteinase K (0.2 and 0.5 mg·mL−1) and SDS (10 and

RESULTS AND DISCUSSION Pretreatment of Sludge Samples for Flow Cytometric Measurements. The application of flow cytometry, a singlecell analysis, requires disintegration of granule or floc sludge samples, which is commonly accomplished using chemical and physical techniques.34−36 The remarkable differences in outcomes of chemical and physical pretreatments in this study emphasizes the importance of the pretreatment procedure. For chemical treatment, the most effective dispersant was the solution of TX (5%) and SP (10 mM) based on the largest increase in bacteria counts identified upon FCM analysis relative to the paired controls. Specifically, the bacteria counts were (5.04 ± 0.04) × 107 bacteria·mL−1 and (5.02 ± 0.01) × 107 bacteria·mL−1 in treated samples and the control (paired t-test, p < 0.05), respectively (Figure 1A). This finding is consistent with the results of the previous study that showed the composite dispersants of ionic and nonionic solutions could successfully disperse bacteria from sand biofilter particles for flow cytometric analysis.37 For physical treatment by sonication, samples were incubated in solutions of TX (5%) and SP (10 mM) for processing. Two pairwise comparisons (5 and 10 min) with unsonicated samples revealed that LES had no significant effects (paired t test, p < 0.05) (Figure 1B). However, HES with the ultrasonic probe treatment led to a significant increase in cell counts. Previous studies showed that the optimal treatment for activated sludge was achieved using an ultrasonication Es value of 80−90 kJ·L−1.27,28,38 In the present study, Es was performed at 30, 90, and 150 kJ·L−1 (HES of 1, 3, and 5 min, that is, 8 ± 1 kJ·g−1 VSS, 25 ± 5 kJ·g−1 VSS and 42 ± 8 kJ· g−1 VSS, respectively), and the most effective treatment was found to be 3 min operation at Es = 90 kJ·L−1 (25 ± 5 kJ· g−1 VSS) (Figure 1B). Moreover, Es at 150 kJ·L−1 (42 ± 8 kJ· 6898

DOI: 10.1021/acs.est.9b01017 Environ. Sci. Technol. 2019, 53, 6895−6905

Article

Environmental Science & Technology

5000 mg·L−1, it is recommended that they be incubated in lysozyme solution of 0.5 mg·L−1 (>23 000 U·mg−1) at a ratio of 1:20 v/v and 25 °C for at least 1 h; therefore, this permeabilization treatment was used in the following CARDFISH protocol. Reduction of Nonspecific or Background Signals. Because discrepancies could result from the presence of false positives in CARD-FISH,44 care should be taken during preparation and hybridization of samples. Endogenous peroxidases inactivation of the anammox sludge in preparations is one of the most important steps, as well as the composition of the hybridization buffer. Signal amplification of CARD-FISH is achieved by dimerization of fluorescence-labeled multiple-tyramide molecules by one HRP molecule and subsequent binding of the intermediates to electron-rich moieties of proteins at or near the site of the peroxidase binding.11 Thus, active endogenous peroxidases could be also labeled with fluorochrome (Alexa Fluor 647 used in this study) by TSA. Without completely quenching the endogenous peroxidase, samples were incubated in H2O2 solution for 30 or 60 min; however, severe false positives in negative controls could not be avoided (SI Figure S2). This result implied a strong endogenous peroxidases activity inside anammox bacteria (SI Figure S2), which has been reported previously.25 For example, incubation in HCl, H2O2, heating and autoclaving were tested for their ability to inactivate endogenous peroxidases in anammox sludge samples, among which H2O2 pretreatment produced the best results.44 Moreover, although the concentration and incubation time are critical, the optimal conditions for anammox sludges varied among studies.20,25 In the present study, the optimal conditions for sludge samples with a high abundance of anammox bacteria (20−30%) and high biomass concentration (MLVSS of 3000 to 5000 mg·L−1) were found to be incubation in 3% H2O2 for at least 90 min at 25 °C (Figure 2). Blocking reagent (goat serum used in this study) must be added to the hybridization buffer to avoid nonspecific binding of biotin molecules with protein in anammox bacteria. The hybridization buffer based on ultrapure water caused severe nonspecific signals (similar to SI Figure S2). Hybridization buffer with 1% blocking reagent has commonly been used in previously conducted studies.19,25,44 In the present study, 5% blocking reagent was found to be the optimum amount for hybridization of anammox bacteria. Blocking reagents help ensure that only specific signals are enhanced while keeping nonspecific or background signals in check. Optimization of Hybridization and TSA. Two forms of CARD-FISH were performed to evaluate the feasibility of the method, including in-solution and embedded in agarose, which was used in previous studies to prepare solid samples compatible with FCM.19,45 In this section, only the in-solution Flow-CARD-FISH was described. As the detection accuracy of CARD-FISH is largely determined by processing conditions of TSA, several key factors were systematically evaluated; namely, HRP labeling temperature, incubation time of fluorescent tyramide labeling and fluorescent substrate concentration. The effects of HRP labeling temperature (20 and 30 °C) and the fluorescent tyramide labeling duration (15 and 30 min) are presented in Figure 2 and SI Figure S3. Generally speaking, higher HRP labeling temperature (30 °C) and longer fluorescence labeling duration (30 min) would cause more intense fluorescence signals with more severe false positives (SI Figure S3C and F). Conversely, lower HRP labeling temper-

20% v/v) treatments for permeabilization of anammox bacteria were investigated. The fluorescent signal intensity of Alexa Fluor 647 in samples with permeabilization was at least 30-fold greater than that of samples without permeabilization (Table 1), indicating that the permeabilization process is essential to CARD-FISH of anammox sludge samples. The fluorescence intensities of samples with different permeabilizations were compared by histograms of FCM, in which the discrimination of targeted anammox bacteria and untargeted bacteria was achieved by gating events based on fluorescence signal and light scattering properties in samples labeled with specific probes in conjunction with negative controls labeled with nonspecific probes (SI Figure S1). The obvious bimodal distribution that was observed helped distinguish of anammox bacteria from other bacteria in the tested samples, which presented in histograms of samples treated with lysozyme or SDS (SI Figure S1), representing a high intensity fluorescence of targeted anammox bacteria. However, it was difficult to choose the threshold value of the specific gates with indistinctly bimodal distributions of histograms, as occurred for samples treated with proteinase K (SI Figure S1). Moreover, severe biomass loss, which should be avoided, was caused by SDS treatment, with 30.7 ± 3.6% and 64.5 ± 5.7% loss occurring in response to treatment with 10% and 20% SDS, respectively (Table 1). Thus, lysozyme treatment showed the best results with respect to the fluorescence intensity and moderate total cell loss. When compared to the effects of 0.2 mg·L−1 lysozyme, a higher detection rate of anammox bacteria was observed for samples treated with 0.5 mg·L−1 lysozyme (54.8 ± 8.1% in 0.2 mg·L−1 and 62.3 ± 7.8% in 0.5 mg·L−1), concomitantly with comparable false positive detection rates for the negative controls (25.2 ± 2.2% in 0.2 mg·L−1 and 25.6 ± 3.7% in 0.5 mg·L−1) (Table 1 and SI Figure S1). Moreover, the highest MFI ratio of 20.5 ± 5.5 was obtained when samples were treated with lysozyme at 0.5 mg·L−1 (Table 1). In a previous study, lysozyme also showed the best results with respect to detection rate among different chemicals and enzymes.19 It should also be noted that it is usually necessary to select a carefully controlled permeabilization step, balancing permeability with cellular integrity and cell loss.43 In this study, samples permeabilized by SDS had comparably high signal intensities when compared to samples treated with lysozyme (SI Figure S1 and Table 1); however, the high cell loss rate of 30.7−64.5% caused by SDS treatment reduced the detection efficiency and feasibility (Table 1). Another cell wallpermeabilizing reagent, proteinase K, exerted adverse effects on cellular integrity. Anammox bacteria, which should be stained with Alexa Fluor 647 fluorophore, could not be distinguished from other bacteria in the histograms (SI Figure S1). This result implied that the severe damage to the cellular integrity caused by proteinase K treatment resulted in nucleic acids of anammox bacteria mixing with or adhering to other bacteria. Indeed, the protease treatment (4.8, 48, 480 U·mL−1) for CARD-FISH often resulted in a severe loss of biomass during hybridization, and the final optimal enzymatic permeabilization protocol was based on lysozyme (40 000 and 400 000 U·mL−1) treatment for 20 min at 37 °C.44 Based on the fluorescence intensity, detection rate, cellular integrity and the cell loss, the lysozyme treatment was optimized to favor the penetration of probes and large molecules (e.g., HRP) into bacteria, especially anammox bacteria. For sludge samples with MLVSS values of 3000− 6899

DOI: 10.1021/acs.est.9b01017 Environ. Sci. Technol. 2019, 53, 6895−6905

Article

Environmental Science & Technology

treatments produced histograms that had an indistinctly bimodal distribution; therefore, the targeted anammox bacteria could not be distinguished from other bacteria well. The results obtained using HRP labeling at 30 °C and fluorescence labeling for 15 min were comparable to those obtained using HRP labeling at 20 °C and fluorescence labeling for 30 min when the fluorescent substrate concentration was 1:100, while the former induced severe false positives with a higher fluorescent substrate concentration of 1:50. Overall, the optimized treatment of HRP labeling at 20 °C and fluorescent tyramide labeling for 30 min was selected based on the obviously enhanced fluorescence intensity, with the controlled false positives in negative controls (Figure 2). It has been reported that a higher fluorescent substrate concentration would increase detectability.19 In this study, after the fluorescent substrate concentration increased from 1:100 to 1:50 (based on the optimized labeling treatment described in the above paragraph), fluorescence signals (MFI values) of targeted anammox bacteria increased by 1.5 times from 95.0 ± 12.2 to 258.0 ± 15.3 (Figure 2 and Figure 3A). Moreover, the MFI ratio of samples with substrate concentrations of 1:50 (20.2 ± 5.5) were higher than those of 1:100 (17.2 ± 4.3) (Figure 3A), which would favor distinguishing the targeted anammox bacteria from background signals and other untargeted bacteria. The detected anammox bacteria percentages of 68.3 ± 6.2% in samples with substrate concentrations of 1:100 were obviously overestimated because of the less evidently bimodal distribution in histograms (Figure 2 and Figure 3B). Similar results were obtained with different concentrations of probe (5 and 20 μM) in hybridization, and the presented results of in-solution CARD-FISH were based on use of 5 μM probe. Based on an overall consideration of the various factors, the optimized TSA process of the HRP labeling of 12 h at 20 °C and for fluorescent tyramide labeling of 30 min at 25 °C with fluorescent substrate concentrations of 1:50 and 5 μM oligonucleotide probe were adopted for in-solution FlowCARD-FISH. Moreover, the selection of fluorescence substrate concentrations should be based on the biomass concentration of the tested samples. At a MLVSS of 3000−5000 mg·L−1 in the tyramide working solution, a substrate concentration of 1:25 to 1:50 is recommended. A higher biomass concentration requires a higher substrate concentration and vice versa. Two Forms of Flow-CARD-FISH: In-Solution and Embedded in Agarose. Several forms of CARD-FISH have been developed to couple with flow cytometry. In most studies, samples were immobilized on filters for subsequent processes, then further detached from filters and resuspended for FCM measurements.19,29,39 In the present study, two forms of CARD-FISH, in-solution and embedded in agarose, were compared, paying special attention to the fluorescence signal intensity, detection rate and the cell loss (Figure 2, SI Figures S4 and S5). As shown in Figure 2 and SI Figure S4, the in-solution CARD-FISH is more feasible and efficient than that embedded in agarose. Specifically, although a higher concentration of probes and fluorescence substrate was used in CARD-FISH embedded in agarose (20 μM, 1:25) (SI Figure S4) than for insolution CARD-FISH (5 μM, 1:50) (Figure 2), a lower detection rate of anammox bacteria in CARD-FISH was obtained for the former (25.9 ± 3.0%) than for the in-solution form (36.8 ± 4.1%) (Figure 3). These results suggest that embedding in agarose hampered the penetration of reagents

Figure 2. Effects of fluorescent substrate (Alexa Fluor 647 fluorophore) concentration on in-solution CARD-FISH. Cytograms of (A), (B), (E), and (F), and fluorescence intensity histograms of (C), (D), (G), and (H) analyzed by FCM. Events inside the gate of histograms were detected as probe-labeled anammox bacteria (generally corresponding to the gate of Q2 in cytograms). (A)− (D): Fluorescence tyramide labeling with fluorescent substrate concentration of 1:100. (E)−(H): Fluorescence tyramide labeling with fluorescent substrate concentration of 1:50. All samples presented were processed by the optimized TSA process of HRP labeling for 12 h at 20 °C and fluorescent tyramide labeling for 30 min at 25 °C with 5 μM oligonucleotide probe.

ature (20 °C) and shorter fluorescence labeling duration (15 min) would result in less intense signals with well-controlled false positives (SI Figure S3A and D). In the present study, HRP labeling at 30 °C and fluorescence labeling for 30 min induced severe false positive signals (SI Figure S3C and F), which would cause overestimation of anammox bacteria abundance. Moreover, HRP labeling at 20 °C and fluorescence labeling for 15 min led to almost no enhancement of the fluorescence signals (SI Figure S3A and D), and these 6900

DOI: 10.1021/acs.est.9b01017 Environ. Sci. Technol. 2019, 53, 6895−6905

Article

Environmental Science & Technology

solution CARD-FISH makes it promising method for quantification of anammox bacteria. Flow-CARD-FISH vs Flow-Monolabeled FISH: Enhanced Signals. FISH with probes directly monolabeled with a fluorochrome (i.e., monolabeled probes) has been widely used to enumerate bacteria by epifluorescence microscopy.46 The application of FCM to standard monolabeled FISH (flow-monolabeled FISH) could overcome the time-consuming aspect of microscopy, which takes ∼10 to 20 min per sample.12 However, for quantification of specific bacteria, the relatively low fluorescence signals in Flowmonolabeled FISH would blur the distinction between the targeted bacteria and other bacteria. It has been reported that the monolabeled FISH detection of weak fluorescence signals of cells with slow growth rates (e.g., anammox bacteria) or low ribosome contents is limited by the FCM sensitivity.29 The application of CARD-FISH successfully increases the fluorescence signal intensity. For example, cells hybridized by CARD-FISH showed 10- to 20-fold signal amplifications relative to monolabeled probes.26,47 Moreover, the fluorescence signal intensity increased by 2.7 fold through TSA when detecting Escherichia coli by CARD-FISH.48 In this study, the fluorescence intensity of samples processed by the optimized in-solution CARD-FISH protocol was 5-fold greater than those processed by Flow-monolabeled FISH (Table 1, Figure 3A, and SI Figure S6). Although the detected percentages of anammox bacteria in Flow-monolabeled FISH (36.3 ± 5.3%) were comparable to those detected by the optimized Flow-CARD-FISH (36.7 ± 4.1%) (Table 1), the blurred boundary between the targeted anammox bacteria and other cells in the scatter cytograms of monolabeled FISH samples prevents accurate quantification using this method (SI Figure S5). The targeted cells hybridized with specific probes by the optimized CARD-FISH displayed fluorescent signals 21 times more intense than the negative control (MFI ratio), which is sufficient for accurate quantification (Table 1). These results are consistent with those of a previous study that showed a specific-to-nonspecific fluorescence ratio of 17 is sufficient to clearly distinguish positive from negative signals in FCM analysis.39 Because of fluorescent signal amplification by TSA, the proposed Flow-CARD-FISH method is well suited to detect microorganisms with a low rRNA content or slow growth rate. This is of advantage for the rapid detection of anammox bacteria in complex environments, such as the activated sludge of wastewater treatment plants and environmental soil or air samples. Crucial Steps of Flow-CARD-FISH for Anammox Bacteria Quantification. The optimized in-solution FlowCARD-FISH was considered as a final modified method for anammox bacteria quantification, and its protocol with critical notes is schematically summarized in Figure 4 and SI Figure S7. To avoid nonspecific tyramide substrate precipitation, endogenous peroxidase activity should be completely quenched (incubate samples in H2O2 solution with final concentration of 3% at 25 °C, for at least 90 min), which is especially important for anammox bacteria. Additionally, when hybridizing samples with probes labeled with biotin, blocking reagent (5% goat serum used in this study) must be added to the hybridization buffer to prevent nonspecific false positive signals. For the TSA process, the HRP labeling temperature is important to enhancing the fluorescence signals and was optimized at 20 °C herein. Moreover, determination of an

Figure 3. FCM results for standard monolabeled-FISH and two forms of CARD-FISH (in-solution and embedded in agarose). (A) MFI values and MFI ratios (the ratio between the MFI value of the specific-labeled samples to the MFI value of the negative control) of monolabeled-FISH and two forms of CARD-FISH with different fluorescent substrate concentrations. (B) Detection rates of negative controls and positive samples, percentage of anammox bacteria calculated by the detection rates of positive samples amended by the detection rates of corresponding negative controls, the total cell loss rate of monolabeled-FISH and CARD-FISH. Error bars indicate the standard deviation of three replicates. All samples presented were pretreated with 0.5 mg·L−1 lysozyme for permeabilization before hybridization.

and probes into the cells and therefore severely decreased the hybridization efficiency. Moreover, the cell loss rate of CARDFISH embedded in agarose (49.9 ± 3.7%) was four times higher than that of the in-solution form (12.1 ± 0.7%) (Figure 3B), which would adversely affect the feasibility of the method. Previous studies reported that, for cells concentrated on membrane filters with low biomass, for example, planktonic bacteria in natural water samples, embedding cells in agarose effectively prevented significant cell loss during permeabilization.19 However, in this study, for cells suspended in solution with high biomass (3000−5000 mg VSS·L−1), severe cell loss could be avoided by proper washing and centrifugation. Moreover, a substantial increase in background fluorescence was observed in agarose-embedded samples (SI Figures S4 and S5), which could disturb the separation of targeted cells from other signals. Taken together, the high hybridization and detection efficiency with an acceptable cell loss of the in6901

DOI: 10.1021/acs.est.9b01017 Environ. Sci. Technol. 2019, 53, 6895−6905

Article

Environmental Science & Technology

Figure 4. Schematic diagram of the experimental setup of Flow-CARD-FISH.

Table 2. Relative Proportions (Percentages) Of Anammox Bacteria in Sludge Samples Analyzed Using Different Quantification Methods Sludge-J methods Flow-CARD-FISH (in solution) standard FISH with epifluorescence microscopy 16S rRNA sequencing analysis qPCR

Sludge-K

total anammox bacteria (%)

Candidatus Jettenia (%)

Candidatus Kuenenia (%)

total anammox bacteria (%)

Candidatus Jettenia (%)

Candidatus Kuenenia (%)

36.7 ± 4.1 57.2 ± 6.4

35.5 ± 1.4 45.3 ± 5.2

0.2 ± 0.1 3.4 ± 2.6

26.5 ± 3.7 65.2 ± 9.2

0.2 ± 0.1 2.6 ± 9.5

26.0 ± 2.3 57.3 ± 8.9

30.2 ± 0.6 35.0 ± 2.9

30.4 ± 0.6

0.2 ± 0.1

22.7 ± 1.2 25.1 ± 3.8

0.1 ± 0.1

21.9 ± 1.9

appropriate fluorophores labeling time in TSA is a very important step to maintaining the balance between increasing the signal and preventing nonspecific binding. The time for this step was 30 min in the present study. It should be also noted that adequate rinsing between steps was necessary throughout the protocol.

Detection of Anammox Sludge by Different Quantitative Methods. Total anammox bacteria, Candidatus Jettenia, and Candidatus Kuenenia were quantified in two anammox sludges (Sludge-J and Sludge-K) by Flow-CARDFISH, and the results were compared with those obtained using other molecular quantification techniques (Table 2). The modified protocol of Flow-CARD-FISH could quantify 6902

DOI: 10.1021/acs.est.9b01017 Environ. Sci. Technol. 2019, 53, 6895−6905

Article

Environmental Science & Technology

can be designed to be complementary to species-, group-, or genus-specific target sites.11 For this reason, CARD-FISH has great flexibility for targeting specific microorganisms at different phylogenic levels. Application of the proposed Flow-CARD-FISH protocol as described in Figure 4 resulted in enhanced fluorescence intensity for accurate quantification with well-controlled false positives (Figure 2G and H). Negative controls without probes or with probe NON338 consistently yielded very few or no fluorescently labeled cells with detection rates of less than 2% of the total DAPI-stained cells. These findings, combined with its high resolution and quantitative and reliable flow cytometric data analysis show that Flow-CARD-FISH is a feasible and powerful tool to obtain reliable results during anammox bacteria quantification. Sensitivity. The fluorescence detection limits of FCM (less than 100 molecules per cell) ensure high sensitivity of quantification.50 Our results are consistent with those of previous studies that demonstrated FISH provides too weak of a signal for flow-cytometric measurements16,17 and that CARD-FISH is a methodical improvement for fluorescence enhancement.19 The fluorescence intensities of cells and the signal-to-background ratios were much greater for samples hybridized by CARD-FISH than by standard FISH (Table 1 and Figure 3). The combination of the enhanced fluorescence signals induced by CARD-FISH and the high quantitative sensitivity of FCM provided a feasible method for anammox bacteria quantification. In summary, a rapid, sensitive, and cost-effective quantification method of Flow-CARD-FISH was modified for anammox bacteria in this study. The quantification results were comparable to those obtained by qPCR and 16S rRNA sequencing. This technique is well suited for routine detection and quantification of anammox bacteria in anammox bioreactors to evaluate their performance and provide management guidance for manipulation. The proposed pretreatment of permeabilization for anammox bacteria in this study could also provide helpful information for improvement of CARD-FISH quantification of Planctomycetes because they have a similar cell wall as the organisms investigated herein. Besides, it is possible for the proposed Flow-CARD-FISH to be applied in other microorganisms’ detection and quantification, including pathogenic bacteria, heterotrophic bacteria, and even archaea. Diverse structures and chemical compositions of cell walls are presented in microorganisms, which calls for different permeabilization treatments for CARD-FISH.39,51 Although a detailed CARD-FISH optimization methodology has been proposed herein, samples of conventional activated sludge and other complex samples might require different specific treatments to ensure their specificity and efficiency. The HRP labeling temperature and fluorophores labeling time in TSA should be adjusted according to sample types. Appropriate labeling temperature and duration may be various in different samples, which should be tested and optimized. Therefore, we recommend that additional experiments be performed to check the reproducibility of the protocol and its efficacy for samples with characteristics that differ from those investigated in the present study.

anammox bacteria in anammox sludge samples satisfactorily and effectively. Flow-CARD-FISH estimates of the total anammox bacteria abundances were comparable with those given by qPCR (ANOVA, p < 0.05) (Table 2). The total anammox bacteria relative abundances were found to be 36.7 ± 4.1% in Sludge-J and 26.5 ± 3.7% in Sludge-K by Flow-CARD-FISH, while they were found to be 35.0 ± 2.9% and 25.1 ± 3.8% by qPCR, respectively (Table 2 and SI Table S2). The absolute abundance of the total anammox bacteria could also be analyzed by Flow-CARD-FISH, which presented to be (2.31 ± 0.01) × 107 and (1.20 ± 0.06) × 107 cells·mL−1 in Sludge-J and Sludge-K, respectively (SI Table S3). The relative abundances of the total anammox bacteria, Candidatus Jettenia and Candidatus Kuenenia, found by Flow-CARD-FISH were always slightly, but not significantly, higher than those detected by 16S rRNA sequencing analysis (ANOVA, p < 0.05) (SI Figure S8), by an average factor of 1.11 ± 0.16 (Table 2). In contrast, monolabeled-FISH with epifluorescence microscopy produced values approximately two times higher than those detected by other quantification methods (ANOVA, p < 0.05) (Table 2 and SI Figure S9), suggesting an obvious overestimation of the relative abundance of anammox bacteria. 16S rRNA sequencing technology is popular and accurate in analyzing microbial community structures,3 while the nextgeneration sequencing platform (e.g., Illumina MiSeq and Illumina HiSeq2000) is rather expensive,4 leading to an increased detection cost. In comparison, qPCR technology is more cost-effective than 16S rRNA sequencing, while unfortunately the presently available primers of anammox bacteria (such as AMX368F-AMX820R used in this study) could hardly distinguish different anammox bacteria on genus level.5,6 Conversely, probes used in FISH could specifically distinguish different genera of anammox bacteria, such as probes of JEC152 (ATGGAACCTTTCAGCCCC)33 and KST1275 (TCGGCTTTATAGGTTTCGCA),32 which specifically hybridize with Candidatus Jettenia and Candidatus Kuenenia, respectively. Generally speaking, Flow-CARD-FISH could provide deeper insights into anammox bacteria quantification than qPCR, and more cost-effective than16S rRNA sequencing technology. While it should be noted that, the pretreatments and processes of Flow-CARD-FISH call for cautious operations as are mentioned above. Otherwise, severe false positive signals and high cell loss rate will be caused. Rapidity, Specificity and Sensitivity of the Modified Flow-CARD-FISH. Rapidity. The major advantages of FCM over labor-intensive microscopic analyses are high throughput and reproducibility.49 FCM allows the rapid analysis of large populations of cells. Typical analytical throughput is 5000 cells per second, which means that even rare cell populations (i.e., less than 1 cell in 10 000) can be detected in statistically significant numbers in a reasonable period of time.50 The application of FCM allows the investigation of large numbers of samples and therefore results in statistically reliable specific bacteria counts and abundance.50 Although CARD-FISH is more time-consuming than standard FISH, this limitation could be offset by its high acquisition rate of FCM, which greatly improves the statistical reliability. Additionally, when compared with 16S rRNA sequencing, Flow-CARD-FISH is more cost-effective because it removes the need for expensive high-throughput sequencing. Specificity. FISH is commonly used to investigate the taxonomic composition of bacterial communities, and probes 6903

DOI: 10.1021/acs.est.9b01017 Environ. Sci. Technol. 2019, 53, 6895−6905

Article

Environmental Science & Technology

■

ammonium oxidizing bacteria. Syst. Appl. Microbiol. 2003, 26 (4), 529−538. (6) Schmid, M.; Twachtmann, U.; Klein, M.; Strous, M.; Juretschko, S.; Jetten, M.; Metzger, J. W.; Schleifer, K.-H.; Wagner, M. Molecular evidence for genus level diversity of bacteria capable of catalyzing anaerobic ammonium oxidation. Syst. Appl. Microbiol. 2000, 23 (1), 93−106. (7) Third, K. A.; Sliekers, A. O.; Kuenen, J. G.; Jetten, M. S. M. The CANON system (completely autotrophic nitrogen-removal over nitrite) under ammonium limitation: interaction and competition between three groups of bacteria. Syst. Appl. Microbiol. 2001, 24 (4), 588−596. (8) Wang, Y.; Ma, X.; Zhou, S.; Lin, X.; Ma, B.; Park, H.-D.; Yan, Y. Expression of the nirS, hzsA, and hdh genes in response to nitrite shock and recovery in Candidatus Kuenenia stuttgartiensis. Environ. Sci. Technol. 2016, 50 (13), 6940−6947. (9) Kindaichi, T.; Tsushima, I.; Ogasawara, Y.; Shimokawa, M.; Ozaki, N.; Satoh, H.; Okabe, S. In situ activity and spatial organization of anaerobic ammonium-oxidizing (anammox) bacteria in biofilms. Appl. Environ. Microbiol. 2007, 73 (15), 4931−4939. (10) Vlaeminck, S. E.; Terada, A.; Smets, B. F.; Linden, D. Van der; Boon, N.; Verstraete, W.; Carballa, M. Nitrogen removal from digested black water by one-stage partial nitritation and anammox. Environ. Sci. Technol. 2009, 43 (13), 5035−5041. (11) Amann, R.; Fuchs, B. M. Single-cell identification in microbial communities by improved fluorescence in situ hybridization techniques. Nat. Rev. Microbiol. 2008, 6 (5), 339−348. (12) Hartmann, H.; Stender, H.; Schäfer, A.; Autenrieth, I. B.; Kempf, V. A. Rapid identification of Staphylococcus aureus in blood cultures by a combination of fluorescence in situ hybridization using peptide nucleic acid probes and flow cytometry. J. Clin Microbiol 2005, 43 (9), 4855−4857. (13) Porter, J.; Deere, D.; Hardman, M.; Edwards, C.; Pickup, R. Go with the flow - use of flow cytometry in environmental microbiology. FEMS Microbiol. Ecol. 1997, 24 (2), 93−101. (14) Steen, H. B. Flow cytometry of bacteria: glimpses from the past with a view to the future. J. Microbiol. Methods 2000, 42 (1), 65−74. (15) Safford, H. R.; Bischel, H. N. Flow cytometry applications in water treatment, distribution, and reuse: A review. Water Res. 2019, 151, 110−133. (16) Töbe, K.; Eller, G.; Medlin, L. K. Automated detection and enumeration for toxic algae by solid-phase cytometry and the introduction of a new probe for Prymnesium parvum (Haptophyta: Prymnesiophyceae). J. Plankton Res. 2006, 28 (7), 643−657. (17) Lepeuple, A. S.; Delabre, K.; Gilouppe, S.; Intertaglia, L.; de Roubin, M. R. Laser scanning detection of FISH-labelled Escherichia coli from water samples. Water Sci. Technol. 2003, 47 (3), 123−129. (18) Wagner, M.; Horn, M.; Daims, H. Fluorescence in situ hybridisation for the identification and characterisation of prokaryotes. Curr. Opin. Microbiol. 2003, 6 (3), 302−309. (19) Pernthaler, A.; Pernthaler, J.; Amann, R. Fluorescence in situ hybridization and catalyzed reporter deposition for the identification of marine bacteria fluorescence in situ hybridization and catalyzed reporter deposition for the identification of marine bacteria. Appl. Environ. Microbiol. 2002, 68 (6), 3094−3101. (20) Ishii, K.; Mußmann, M.; MacGregor, B. J.; Amann, R. An improved fluorescence in situ hybridization protocol for the identification of bacteria and archaea in marine sediments. FEMS Microbiol. Ecol. 2004, 50 (3), 203−212. (21) Fazi, S.; Amalfitano, S.; Pernthaler, J.; Puddu, A. Bacterial communities associated with benthic organic matter in headwater stream microhabitats. Environ. Microbiol. 2005, 7 (10), 1633−1640. (22) Tujula, N. A.; Holmström, C.; Mußmann, M.; Amann, R.; Kjelleberg, S.; Crocetti, G. R. A CARD-FISH protocol for the identification and enumeration of epiphytic bacteria on marine algae. J. Microbiol. Methods 2006, 65 (3), 604−607. (23) Zaitsu, K.; Ohkura, Y. New fluorogenic substrates for horseradish peroxidase: Rapid and sensitive assays for hydrogen peroxide and the peroxidase. Anal. Biochem. 1980, 109 (1), 109−113.

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.est.9b01017. Primers and thermal cycling conditions for qPCR (Table S1); results of qPCR of anammox sludge samples (Table S2); absolute abundance of anammox bacteria in sludge samples analyzed by Flow-CARD-FISH (Table S3); fluorescence intensity histograms of annamox sludge samples presenting effects of different chemicals and enzymes on the permeabilization of bacterial cell walls (Figure S1); false positives in negative controls caused by the endogenous peroxidase activity (Figure S2); effects of HRP labeling temperature, fluorescent tyramide labeling duration and fluorescent substrate concentration on in-solution CARD-FISH (Figure S3); effects of fluorescent substrate concentration on CARDFISH embedded in agarose (Figure S4); results of CARD-FISH embedded in agarose by adopting the optimized treatment used in the in-solution CARDFISH (Figure S5); cytograms of samples hybridized by standard FISH with monolabeled probes (Flow-monolabeled-FISH) (Figure S6); optimized protocol and critical notes for anammox bacteria quantification by Flow-CARD-FISH (Figure S7); taxonomic distributions of the anammox sludge sample microbial communities at the genus level by 16S rRNA sequencing (Figure S8); representative standard FISH-CLSM digital images illustrating the abundance of anammox bacteria in two anammox sludge samples (Figure S9); supplementary references (PDF)

■

AUTHOR INFORMATION

Corresponding Author

*Phone: +21 65984275; e-mail: [email protected] or [email protected]. ORCID

Yayi Wang: 0000-0001-5886-0941 Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by the National Natural Science Foundation of China (NSFC) (5152280 and 51778446). The Foundation of the State Key Laboratory of Pollution Control and Resource Reuse (Tongji University, China) (PCRRT16005) is also acknowledged.

■

REFERENCES

(1) Kartal, B.; Kuenen, J. G.; van Loosdrecht, M. C. M. Sewage treatment with anammox. Science 2010, 238, 702−703. (2) van Loosdrecht, M. C. M.; Brdjanovic, D. Anticipating the next century of wastewater treatment. Science 2014, 344, 1452−1453. (3) Degnan, P. H.; Ochman, H. Illumina-based analysis of microbial community diversity. ISME J. 2012, 6 (1), 183−194. (4) Shendure, J.; Ji, H. Next-generation DNA sequencing. Nat. Biotechnol. 2008, 26 (10), 1135−1145. (5) Schmid, M.; Walsh, K.; Webb, R.; Rijpstra, W. I.; van de PasSchoonen, K.; Verbruggen, M. J.; Hill, T.; Moffett, B.; Fuerst, J.; Schouten, S.; Sinninghe Damsté, J.; Harris, J.; Shaw, P.; Jetten, M.; Strous, M. Candidatus “Scalindua brodae”, sp. nov., Candidatus “Scalindua wagneri”, sp. nov., Two new species of anaerobic 6904

DOI: 10.1021/acs.est.9b01017 Environ. Sci. Technol. 2019, 53, 6895−6905

Article

Environmental Science & Technology (24) Snaidr, J.; Amann, R.; Huber, I.; Ludwig, W.; Schleifer, K. H. Phylogenetic analysis and in situ identification of bacteria in activated sludge. Appl. Environ. Microbiol. 1997, 63 (7), 2884−2896. (25) Woebken, D.; Fuchs, B. M.; Kuypers, M. M. M.; Amann, R. Potential interactions of particle-associated anammox bacteria with bacterial and archaeal partners in the Namibian upwelling system. Appl. Environ. Microbiol. 2007, 73 (14), 4648−4657. (26) Schönhuber, W.; Fuchs, B.; Juretschko, S.; Amann, R. Improved sensitivity of whole-cell hybridization by the combination of horseradish peroxidase-labeled oligonucleotides and tyramide signal amplification. Appl. Environ. Microbiol. 1997, 63 (8), 3268−3273. (27) Foladori, P.; Bruni, L.; Tamburini, S.; Ziglio, G. Direct quantification of bacterial biomass in influent, effluent and activated sludge of wastewater treatment plants by using flow cytometry. Water Res. 2010, 44 (13), 3807−3818. (28) Foladori, P.; Laura, B.; Gianni, A.; Giuliano, Z. Effects of sonication on bacteria viability in wastewater treatment plants evaluated by flow cytometry-Fecal indicators, wastewater and activated sludge. Water Res. 2007, 41 (1), 235−243. (29) Sekar, R.; Fuchs, B. M.; Amann, R.; Pernthaler, J.; Planck, M.; Microbiology, M. Flow sorting of marine bacterioplankton after fluorescence in situ hybridization flow sorting of marine bacterioplankton after fluorescence in situ hybridization. Appl. Environ. Microbiol. 2004, 70 (10), 6210−6219. (30) Sekar, R.; Pernthaler, A.; Pernthaler, J.; Posch, T.; Amann, R. I.; Warnecke, F. An improved protocol for quantification of freshwater actinobacteria by fluorescence in situ hybridization an improved protocol for quantification of freshwater actinobacteria by fluorescence in situ hybridization. Appl. Environ. Microbiol. 2003, 69 (5), 2928−2935. (31) Wallner, G.; Amann, R.; Beisker, W. Optimizing fluorescent in situ hybridization with rRNA targeted oligonucleotide probes for flow cytometric identification of microorganisms. Cytometry 1993, 14 (2), 136−143. (32) Schmid, M.; Twachtmann, U.; Klein, M.; Strous, M.; Juretschko, S.; Jetten, M.; Metzger, J. W.; Schleifer, K.-H.; Wagner, M. Molecular evidence for genus level diversity of bacteria capable of catalyzing anaerobic ammonium oxidation. Syst. Appl. Microbiol. 2000, 23 (1), 93−106. (33) Zhang, L.; Narita, Y.; Gao, L.; Ali, M.; Oshiki, M.; Okabe, S. Maximum specific growth rate of anammox bacteria revisited. Water Res. 2017, 116, 296−303. (34) Riis, V.; Lorbeer, H.; Babel, W. Extraction of microorganisms from soil: evaluation of the efficiency by counting methods and activity measurements. Soil Biol. Biochem. 1998, 30 (12), 1573−1581. (35) Boenigk, J. A disintegration method for direct counting of bacteria in clay-dominated sediments: dissolving silicates and subsequent fluorescent staining of bacteria. J. Microbiol. Methods 2004, 56 (2), 151−159. (36) Buesing, N. Comparison of detachment procedures for direct counts of bacteria associated with sediment particles, plant litter and epiphytic biofilms. Aquat. Microb. Ecol. 2002, 27 (1), 29−36. (37) Vignola, M.; Werner, D.; Hammes, F.; King, L. C.; Davenport, R. J. Flow-cytometric quantification of microbial cells on sand from water biofilters. Water Res. 2018, 143, 66−76. (38) Biggs, C. A.; Lant, P. A. Activated sludge flocculation: on-line determination of floc size and the effect of shear. Water Res. 2000, 34 (9), 2542−2550. (39) Biegala, I. C.; Biegala, I. C.; Not, F.; Not, F.; Vaulot, D.; Vaulot, D.; Simon, N.; Simon, N. Quantitative assessment of picoeukaryotes in the natural environment by using taxon-specific oligonucleotide probes in association with tyramide signal amplification-fluorescence in situ hybridization and flow cytometry. Appl. Environ. Microbiol. 2003, 69 (9), 5519−5529. (40) Amann, R. I.; Binder, B. J.; Olson, R. J.; Chisholm, S. W.; Devereux, R.; Stahl, D. A. Combination of 16S rRNA-targeted oligonucleotide probes with flow cytometry for analyzing mixed microbial populations. Appl. Environ. Microbiol. 1990, 56 (6), 1919− 1925.

(41) Amann, R. I.; Zarda, B.; Stahl, D. A.; Schleifer, K. H. Identification of individual prokaryotic cells by using enzyme-labeled, rRNA-targeted oligonucleotide probes. Appl. Environ. Microbiol. 1992, 58 (9), 3007−3011. (42) Vives-Rego, J.; Lebaron, P.; Nebe-Von Caron, G. Current and future applications of flow cytometry in aquatic microbiology. FEMS Microbiol. Rev. 2000, 24 (4), 429−448. (43) Schönhuber, W.; Zarda, B.; Eix, S.; Rippka, R.; Herdman, M.; Ludwig, W.; Amann, R. In situ identification of cyanobacteria with horseradish peroxidase-labeled, rRNA-targeted oligonucleotide probes. Appl. Environ. Microbiol. 1999, 65 (3), 1259−1267. (44) Pavlekovic, M.; Schmid, M. C.; Schmider-Poignee, N.; Spring, S.; Pilhofer, M.; Gaul, T.; Fiandaca, M.; Löffler, F. E.; Jetten, M.; Schleifer, K. H.; Lee, N. M. Optimization of three FISH procedures for in situ detection of anaerobic ammonium oxidizing bacteria in biological wastewater treatment. J. Microbiol. Methods 2009, 78 (2), 119−126. (45) Mota, C. R.; So, M. J.; de los Reyes, F. L. Identification of nitrite-reducing bacteria using sequential mRNA fluorescence in situ hybridization and fluorescence-assisted cell sorting. Microb. Ecol. 2012, 64 (1), 256−267. (46) DeLong, E. F.; Wickham, G. S.; Pace, N. R. Phylogenetic stains: ribosomal RNA-based probes for the identification of single cells. Science 1989, 243 (4896), 1360−1363. (47) Chen, C. H.; Cho, S. H.; Chiang, H. I.; Tsai, F.; Zhang, K.; Lo, Y. H. Specific sorting of single bacterial cells with microfabricated fluorescence-activated cell sorting and tyramide signal amplification fluorescence in situ hybridization. Anal. Chem. 2011, 83 (19), 7269− 7275. (48) Jupraputtasri, W.; Cheevadhanarak, S.; Chaiprasert, P.; Tanticharoen, M.; Techkarnjanaruk, S. Use of fluorochrome-labeled rRNA targeted oligonucleotide probe and tyramide signal amplification to improve sensitivity of fluorescence in situ hybridization. J. Biosci. Bioeng. 2004, 98 (4), 282−286. (49) Brown, M. R.; Camézuli, S.; Davenport, R. J.; PetelenzKurdziel, E.; Øvreås, L.; Curtis, T. P. Flow cytometric quantification of viruses in activated sludge. Water Res. 2015, 68, 414−422. (50) Basiji, D. A.; Ortyn, W. E.; Liang, L.; Venkatachalam, V.; Morrissey, P. Cellular image analysis and imaging by flow cytometry. Clin. Lab. Med. 2007, 27 (3), 653−670. (51) Teira, E.; Reinthaler, T.; Pernthaler, A.; Pernthaler, J.; Herndl, G. J. Combining catalyzed reporter deposition-fluorescence in situ hybridization and microautoradiography to detect substrate utilization by bacteria and archaea in the deep ocean. Appl. Environ. Microbiol. 2004, 70 (7), 4411−4414.

6905

DOI: 10.1021/acs.est.9b01017 Environ. Sci. Technol. 2019, 53, 6895−6905