Environ. Sci. Technol. 2009, 43, 6691–6696
Rapid Detection of Naegleria Fowleri in Water Distribution Pipeline Biofilms and Drinking Water Samples GEOFFREY J. PUZON,* JAMES A. LANCASTER, JASON T. WYLIE, AND JASON J. PLUMB Water for a Healthy Country Flagship, Centre for Environment and Life Sciences, CSIRO Land and Water, Private Bag No.5, Wembley, Western Australia 6913, Australia
Received February 11, 2009. Revised manuscript received June 12, 2009. Accepted July 9, 2009.
Rapid detection of pathogenic Naegleria fowleri in water distribution networks is critical for water utilities. Current detection methods rely on sampling drinking water followed by culturing and molecular identification of purified strains. This culturebased method takes an extended amount of time (days), detects both nonpathogenic and pathogenic species, and does not account for N. fowleri cells associated with pipe wall biofilms. In this study, a total DNA extraction technique coupled with a real-time PCR method using primers specific for N. fowleri was developed and validated. The method readily detected N. fowleri without preculturing with the lowest detection limit for N. fowleri cells spiked in biofilm being one cell (66% detection rate) and five cells (100% detection rate). For drinking water, the detection limit was five cells (66% detection rate) and 10 cells (100% detection rate). By comparison, culture-based methods were less sensitive for detection of cells spiked into both biofilm (66% detection for 4 months annually, providing ideal conditions for Naegleria spp. colonization (21). In order to provide safe water for consumers, water utilities require rapid and reproducible detection systems to ensure the effectiveness of protective barriers. The current procedure for detecting N. fowleri in distribution networks involves collecting bulk water samples which are then cultured on non-nutrient agar (NNA) plates seeded with Escherichia coli and incubated at 42 °C for 48 h (22). Positive samples are then subcultured and tested for identification of Naegleria spp. by real time-PCR (RT-PCR) melt curve analysis (22, 23). This method however, takes a significant amount of time (3+ days), and does not provide an assessment of Naegleria spp. associated with pipe wall biofilms. In addition to the delay in obtaining a result from this conventional testing procedure, other issues are likely to limit the effectiveness of this test. For example, nonpathogenic Naegleria are noted to rapidly out grow N. fowleri (personal communicationPathWest) on NNA-E. coli plates contributing to possible false negative results. Also, current RT-PCR melt curve methods use consensus primers, which detect all Naegleria species (22, 23), and are used to assay individual pure cultures which means that pure strains have to be obtained prior to RT-PCR analysis. Here we report a method able to specifically detect N. fowleri in both biofilm and bulk water samples from a drinking water distribution network. Total DNA extraction coupled with N. fowleri specific RT-PCR melt curve analysis allowed for direct analysis of N. fowleri in the environmental samples without introducing culturing bias. This new method was employed along with conventional testing procedures to monitor Naegleria spp. within parts of full-scale water distribution systems colonised by pathogenic and nonpathogenic species of Naegleria. The suitability and efVOL. 43, NO. 17, 2009 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
6691
fectiveness of the new method is compared with the conventional testing procedures.
Material and Methods Naegleria Isolates and Culturing. All Naegleria isolates were provided by PathWest Laboratory Medicine, Perth, Western Australia, www.pathwest.com.au. All Naegleria strains were isolated from environmental water samples submitted by clients to PathWest. Each Naegleria isolate was further confirmed by an independent National Association of Testing Authorities (NATA) accredited laboratory (Australian Water Quality Centre, South Australia) for identification to the species level. E. coli cells used as the Naegleria food source were grown in 1 L LB broth at 37 °C to late log phase OD600 nm ) 1.0, concentrated by centrifugation 7000 rpm 10 min and resuspend in 25% Ringer solution (Oxoid, England). Naegleria cultures were grown in tissue culture flasks (Iwaki, Japan) containing 10 mL of 25% Ringers solution with E. coli (5.39 × 108 cells/mL) as a food source N. fowleri cultures were incubated at 37 °C and nonpathogenic N. lovaniensis cultures were incubated at 30 °C. Flasks were subcultured every 7-14 days. For experiments requiring Naegleria growth on solid media, cultures were plated on nonnutrient agar (NNA) prespread with E. coli and incubated at 42 °C for 48 h (22, 23). Drinking Water Sampling, Biofilm Culturing, and Bacterial Enumeration. Drinking water and biofilm samples used for experiments were obtained from regional water supply schemes in the Great Southern Region of Western Australia, approximately 250 km southeast of Perth. Drinking water was collected in a sterile 10 L container and stored at 20 °C. Bacterial concentrations (cells/mL) in drinking water were enumerated by serial dilution and plating on Plate Count Agar (Merck, Germany). Biofilm was obtained from biofilm monitoring devices (KIWA, Netherlands) (24) connected directly to the distribution pipe with flow rates set at 50 L/h. Glass rings, within the biofilm monitoring devices, were used as biofilm growth supports. Rings were removed and sonicated three times to dislodge biofilm. Total bacterial concentration in biofilm (cells/mL) was calculated by staining a 1:120 dilution of the sonicated biofilm with 5 µL of 100 µg/mL DAPI (4′, 6′ diamidino-2-phenylindole) for 30 s. Cells were then counted using a Zeiss fluorescent microscope (Carl Zeiss, Germany) and enumerated on a per mL basis. Biofilm used in experiments was resuspended in filtered distribution water to a concentration of 1.83 × 107 cells/mL. Naegleria Spiking Experiments and DNA Extraction. Viable Naegleria trophozoites grown in tissue culture flasks were used in all experiments and enumerated using a Thoma hemocytometer (Lab Optik, Germany). Cells were diluted and spiked into 250 mL of drinking water or 1 mL of resuspended biofilm at 1000, 100, 10, 5, or 1 cell per sample. Replicate sets (n ) 6) were done for each experiment. Three replicates were prepared for total DNA extraction as follows. Drinking water samples with cells were first centrifuged at 800 g for 10 min at 20 °C. Supernatant was decanted and samples resuspended in 1 mL of drinking water, transferred to a 1.5 mL tube and reconcentrated by centrifugation at 10 000g for 10 min at 20 °C. Supernatant was then removed by pipet and samples were resuspended in 100 µL Instagene matrix (BioRad, U.S.). Total DNA was extracted following the BioRad protocol with an initial 30 min incubation at -80 °C. Biofilm samples with cells were centrifuged at 10 000g for 10 min at 20 °C and total DNA extracted using the ZR Soil Microbe Kit (Zymo Research, U.S.). For competitive detection experiments, both N. fowleri and N. lovaniensis, cells were spiked into 250 mL of drinking water or 1 mL of biofilm at a ratio of 10 N. fowleri to either 10, 100, or 1000 N. lovaniensis cells followed by concentration of samples and extraction of total DNA as outlined above. 6692
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 43, NO. 17, 2009
The second half of the replicates were plated onto NNA-E. coli, as mentioned above, for viability and detection. DNA was extracted from plates positive for Naegleria growth by the Instagene method (22). Negative controls of drinking without addition of Naegleria cells were included for all experiments. Real Time-PCR (RT-PCR) Melt Curve Analysis. RT-PCR melt curve analysis of the Naegleria intragenic spacer region (ITS) was done using a BioRad iQ5 (BioRad, U.S.) following the method of Robinson et al. (22). Each 25 µL reaction contained, 12.5 µL Hot Star Taq Master Mix (Qiagen, U.S.), 500 nM forward primer, 500 nM reverse primer, 2.0 µM SYTO9 (Molecular Probes, U.S.), and 2 µL of DNA template or nuclease free water for controls. Primer pairs amplifying the ITS of all Naegleria species (22, 25) as well as other amoebae, e.g., consensus primers (CP), were used for competition experiments. For specific detection of N. fowleri the primer pair designed by Pelandakis et al. (25) was initially used, however the forward primer was found to misprime in the opposite direction generating short fragments not suitable for RT-PCR melt curve analysis. A new forward primer (FWS) (5′GTGAAAACCTTTTTTCCATTT3′), specific for the N. fowleri ITS, was designed and combined with the consensus reverse primer (5′TTTCTTTTCCTCCCCTTATTA3′) (25) to form a primer pair (SP) specific for N. fowleri. RT-PCR cycling conditions were 95 °C 15 min followed by 50 cycles of 95 °C 30 s, 52 °C 30 s, 72 °C 45, with a 6 s pause at 80 °C for fluorescent dye detection. Cycle thresholds (CT) were determined automatically by the iQ5 optical system software. After completion of amplification, the PCR products were subjected to melt curve analysis by the iQ5 for species-specific Naegleria detection. Samples were progressively denatured by ramping the temperature from 75 to 95 °C in 0.2 °C increments. Fluorescent dye emission was detected for 10 s at each 0.2 °C increment. Melt curve profiles were automatically plotted by the iQ5 system software. Each sample was assayed in triplicate. Sensitivity of RT-PCR with N. fowleri Specific Primers. To determine the sensitivity of the N. fowleri specific primer set, control RT-PCR reactions of N. fowleri ITS PCR products or DNA extracted from N. fowleri cells were analyzed. Purified N. fowleri ITS PCR products were quantified (ng/µL) and then calculated based on the sequences molecular weight to determine the total number of ITS sequences/µL (26). The cell equivalent ratio was then calculated based on 4000 ITS copies/cell (27, 28) and serially diluted to a range of 1000-0.01 cells. For whole cells, N. fowleri trophozoites were counted on a Thoma hemocytometer, serially diluted to yield 1000 to 1 cell in 1 mL of 25% ringers solution, concentrated by centrifugation and extracted by Instagene or Zymo ZR Soil DNA kit. Samples were analyzed by RT PCR melt curve analysis in triplicate and detection sensitivity curves plotted. Specific Detection of N. fowleri in Drinking Water and Water Distribution Pipe Biofilm. To determine the application of RT-PCR detection of N. fowleri in real biofilm and drinking water samples, total DNA was extracted from field drinking water samples (250 mL) in 100 µL of Instagene matrix as described above. Total DNA from biofilms, grown on field site biomonitors, was extracted using the Zymo ZR Soil DNA kit as described above. All field samples were analyzed by RT- PCR melt curve, with SP or CP primers, in triplicate and assayed for viable Naegleria on NNA- E. coli plates. Positive controls containing N. fowleri and negative controls of drinking without addition of Naegleria cells were included for all experiments.
Results Specificity and Sensitivity of N. fowleri Specific Primer Pair. RT-PCR melt curve analysis using SP primers produced PCR products with identical melt curve profiles comprised of two
FIGURE 1. Melt curve profile for N. fowleri amplified using SP primers. Results were the averages of triplicate experiments. peaks of similar intensity at Tm1 ) 81.3 ( 0.3 °C and Tm2 84.2 ( 0.4 °C (Figure 1). No amplification was detected when N. lovaniensis, N. australiensis, N. byersi, N. italica, Willaertia sp., Hartmanella sp., or E. coli DNA was used as a template. All SP amplified PCR products were sequenced and confirmed as N. fowleri by BLAST analysis. RT-PCR sensitivity using the SP primer pair was estimated by serial dilution of purified ITS DNA as template (26). Assays detected N. fowleri down to 0.01 cells, CT ) 33.71 ( 0.29, (data not shown). Since the Naegleria ITS sequence is carried on a plasmid with a copy number of 4000 (27, 28), 0.01 cells is approximately 40 copies. Similar results were published by Robinson et al. (22). RT-PCR analysis using the SP primers was performed on a serial 10-fold dilution (1000-1) of viable N. fowleri trophozoites. Total DNA extracted by either Instagene Matrix or ZR Soil DNA extraction kit was used for RT-PCR reactions. N. fowleri cells were detected in replicate samples (n ) 3) at 100% for 1000, 100, and 10 cells for both extraction techniques. At the 1 cell level, cells were detected in 66% of replicates. Curves plotted using the CT versus the log number of cells produced curves with R2 ) 0.9947 for Instagene extracted DNA (Figure 2A) and R2 ) 0.9929 for ZR soil extracted DNA (Figure 2B). The amplification efficiency, calculated by the iQ5 software, was 96.6% for Instagene extracted DNA and 96.9% for ZR soil extract DNA. Direct Detection of N. fowleri Cells Spiked into Drinking Water and Biofilms. Drinking water and biofilms typically contain metals and humic acids which inhibit RT-PCR analysis and thus make direct detection of N. fowleri difficult even when samples are plated on NNA-E. coli (22). Experiments replicating field conditions to test direct detection methods were conducted. Drinking water and biofilm collected from the drinking water distribution pipeline were spiked with decreasing numbers of viable N. fowleri cells (1000-1). RT-PCR analyses of total DNA extracted by Instagene matrix using SP primers had a detection limit of five N. fowleri cells in 250 mL of drinking water in 66% of samples, CT of 38.96 ( 0.83, and 100% for samples containing g10 cells in 250 mL (Table 1 and Figure 3A). Data plotted for all positive detections produced a linear curve R2 ) 0.9627 (Figure 3A). No detections were made at the 1 cell level. Replicates plated on NNA-E. coli had a detection limit of 10 N. fowleri cells in 250 mL of drinking water in 100% of samples (Table 1). Controls of drinking water without spiked N. fowleri cells were all negative. For RT-PCR biofilm experiments, attempts to use Instagene matrix for total DNA extraction failed. Thus, the Zymo ZR Soil DNA kit was used to extract total DNA and remove RT-PCR inhibitors. RT-PCR of biofilm spiked samples using SP primers detected N. fowleri cells in 100% of g5 cell samples and 66% of samples containing 1 cell, CT 39.73 ( 0.9, (Table 1 and Figure 3B). Data plotted for all positive detections
FIGURE 2. Standard curve of RT-PCR analysis using SP primers for serial diluted N. fowleri cells. (A) Total DNA for RT-PCR extracted by Instagene matrix. (B) Total DNA for RT-PCR extracted by Zymo ZR soil DNA kit. Results were the averages of triplicate experiments with standard deviations.
TABLE 1. Detection of Viable N. fowleri Cells Spiked into 250 mL of Drinking Water and Biofilm with SP Primers N. fowleri cells spiked into 250 mL of drinking water
RT-PCR melt curve detection (% positive)
NNA-E. coli detection (% positive)
1000 cells 100 cells 10 cells 5 cells 1 cell
100% 100% 100% 66%a 0%
100% 100% 100%a 0% 0%
N. fowleri cells spiked into biofilm
RT-PCR melt curve detection (% positive)
NNA-E. coli detection (% positive)
1000 cells 100 cells 10 cells 5 cells 1 cell
100% 100% 100% 100% 66%a
100% 100% 100% 66% 66%a
a Detection limit of the RT-PCR or NNA-E. coli methods. Results are percentages of triplicate experiments.
produced a linear curve R2 ) 0.9406 (Figure 3B). Replicate NNA-E. coli plates detected 5 cells and 1 cell in 66% of samples (Table 1). Control samples of biofilm without spiked N. fowleri cells were all negative. Naegleria Competitive Detection Experiments. Since multiple species of pathogenic and nonpathogenic Naegleria are generally present together in the environment, experiments were designed to asses the detection of N. fowleri in the presence of nonpathogenic Naegleria species. Replicate experiments were prepared with equal numbers (10 cells), VOL. 43, NO. 17, 2009 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
6693
and >432 N. fowleri cells/107 bacterial cells in May. RT-PCR melt curve analysis using CP primers identified various Naegleria profiles in the same biofilm samples; nonpathogenic species in March, mixed peak profile of N. fowleri and nonpathogens in April, and N. fowleri only in May (Figure 4B-D). Drinking water samples were also positive for N. fowleri using SP primers and N. fowleri plus nonpathogens using CP primers (SI Figure S3). Calculations of N. fowleri, based on the standard curve (Figure 3A), in drinking water samples were >17 cells/250 mL of water in March, 86 cells/250 mL of water in May. All positive samples were confirmed as N. fowleri by DNA sequencing. Similar results for both primers were obtained for replicates growing on NNA-E. coli plates.
Discussion
FIGURE 3. RT-PCR analysis using SP primers for serial diluted N. fowleri cells (A) spiked into 250 mL of drinking water and total DNA for RT-PCR extracted by Instagene matrix. (B) Spiked into 1 mL of biofilm and total DNA for RT-PCR extracted by Zymo ZR soil DNA kit. Results were the averages of triplicate experiments with standard deviations. or greater numbers (100 or 1000 cells), of N. lovaniensis mixed with 10 cells of N. fowleri and spiked into 250 mL of drinking water or 1 mL of biofilm. Total DNA was extracted from half of the samples. The remaining samples were plated on NNAE. coli. For total DNA extractions, RT-PCR melt curve analysis with SP primers detected N. fowleri in all drinking water and biofilm replicates (Table 2). RT-PCR melt curve analysis performed on the same DNA template with CP primers detected N. lovaniensis in all reactions, but only detected N. fowleri in 1 of the 18 replicates (Table 2, Supporting Information (SI) Figures S1 and S2A). Similar results for SP and CP primers were produced when testing the replicate mixed cultures grown on NNA plates (Table 2 and SI Figure S2B), which were typically overgrown after 48 h incubation. In addition, the CT for N. fowleri detection using SP primers remained constant, CT 39.20 ( 0.2, in the presence of increasing N. lovaniensis cell numbers. Detection of N. fowleri in Drinking Water Distribution Pipeline. To test for N. fowleri within drinking water distribution biofilms, samples were obtained from a water distribution pipeline at a specific site known to be seasonally colonised by N. fowleri. Biofilm samples were collected monthly during the autumn 2008 (March-May). Replicate samples (n ) 2) were processed for total DNA and plated on NNA-E. coli plates. RT-PCR melt curve analyses with SP primers identified all biofilm samples were positive for N. fowleri (Figure 4A). RT-PCR CTs were, 42.73 ( 1.95 for March, 36.57 ( 0.66 for April, and 35.67 ( 0.48 for May. N. fowleri cell concentration in the biofilm samples were estimated by comparison to the standard curve (Figure 3B). The contaminated pipeline contained 56 N. fowleri cells/107 bacterial cells in April, 6694
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 43, NO. 17, 2009
Biofilm growth frequently occurs in water distribution networks, even in the presence of recommended free chlorine residuals, and is known to contribute to chlorine demand (16–18, 26). Aside from directly affecting the drinking water quality, biofilms provide microorganisms protection against chlorine and can harbor potential pathogenic organisms (18, 20). Biofilms are also known to support the presence of free-living amoebae in dental unit waterlines (29). In drinking water distribution networks, pipe wall biofilms are believed to promote colonisation by free-living amoebae (19, 21). The free-living pathogenic amoebae N. fowleri is an ongoing issue for many water utilities where biofilm growth occurs at elevated temperatures. Here we have demonstrated a method to directly detect N. fowleri in biofilms and drinking water using RT-PCR melt curve analysis. Through the extraction of total DNA from samples, N. fowleri can be detected by RTPCR melt curve analysis (Figures 3 and 4) without preculturing samples on NNA-E. coli. Using specific primers, N. fowleri can be detected reliably at a concentration of >1-5 cells per sample (biofilm or bulk water) (Figure 3A and B). The use of soil DNA extraction kits further enables the detection of low numbers of cells while overcoming the typical issues of PCR inhibition encountered when working with complex field samples, such as pipe wall biofilms. The direct detection RT-PCR melt curve analysis was completed in 5 h, whereas traditional NNA-E. coli plating requires at least 48 h of incubation before samples are subcultured and tested for N. fowleri by molecular methods (22, 23). In addition, the direct detection method screens the entire sample for N. fowleri, whereas the NNA-E. coli plating can introduce bias through overgrowth of nonpathogenic Naegleria or by subculturing isolated sections of the plate not containing N. fowleri. Comparison of the culturing and molecular detection methods indicates that both are reliable at cell values g10 cell, but the molecular method appears more sensitive at lower cell concentration, e5 cells. Controls for samples with 5 cells were all positive, indicating no loss due to pipetting. Since viable cells were used in all experiments this indicates a loss of cell culturability. Whether this is due to cell death or irreversible encystment is unclear. It could also represent a viable but nonculturable (VBNC) state for N. fowleri, which can readily be detected by molecular methods. VBNC states exist for several drinking water pathogens (30, 31) and should be assessed for free-living amoebae. The use of CP primers, which detect all Naegleria species, for RT-PCR analysis can introduce additional bias in samples with low ratios of N. fowleri to nonpathogen cells and thus provide a false negative result. The current Australian Drinking Water Guidelines (32) puts a threshold of two organisms per liter for N. fowleri. Any primer bias due to nonpathogenic organisms would interfere with detection at this low level. Experiments conducted here demonstrate that RT-PCR melt curves of samples containing equal numbers
TABLE 2. Detection of N. fowleri Mixed with N. lovaniensis Cells Using SP or CP Primersa ratio of N. fowleri to N. lovaniensis cells spiked into 250 mL of drinking water 10:10 cells 10:100 cells 10:1000 cells ratio of N. fowleri to N. lovaniensis cells spiked into spiked into 1 mL of biofilm 10:10 cells 10:100 cells 10:1000 cells
direct detection of N. fowleri (% positive)
detection of N. fowleri cultured on NNA-E. coliplates (% positive)
SP Primers
CP Primers
SP primers
CP primers
100% 100% 100%
33% 0% 0%
100% 100% 100%
0% 0% 0%
direct detection of N. fowleri (% positive)
detection of N. fowleri cultured on NNA-E. coliplates (% positive)
SP primers
CP primers
SP primers
CP primers
100% 100% 100%
0% 0% 0%
100% 100% 100%
0% 0% 0%
a RT-PCR melt curve analysis using total extracted DNA or DNA extracted from replicates cultured on NNA-E. coli plates as template. Results are percentages of triplicate experiments.
FIGURE 4. Detection of N. fowleri and nonpathogenic Naegleria species in field drinking water biofilms. (A) RT-PCR melt curve analysis using SP primers for March-May biofilm samples. RT-PCR melt curve analysis using CP primers for (B) March biofilm sample (N. australiensis and Hartmanella), (C) April biofilm sample (N. fowleri and N. lovaniensis), (D) May biofilm sample (N. fowleri). of pathogen and nonpathogen typically result in the nonpathogenic profile (Table 2). This is likely due to a merging of the N. fowleri and N. lovaniensis melt curve profiles which obscures the important N. fowleri first peak at 80 °C with the base of the larger peak at 81-82 °C. In order to reliably detect N. fowleri with CP primers, N. fowleri needs to be present in approximately 100-fold greater concentration than the nonpathogen (data not shown). Analysis of mixed samples with SP primers appears to be quite robust with no interference in the amplification, as detected by changes in CT, when nonpathogenic cells are present in 100-fold greater numbers. RT-PCR methods have allowed for the detection of pathogens in different backgrounds (33, 34). By using RT-
PCR with SP primers and standard curves, N. fowleri cell concentrations in field samples (Figure 4A) can be calculated. In the drinking water pipeline, concentrations increased from 432 N. fowleri cells/107 bacterial cells between March and May. This shows a dramatic increase in the number of cells in pipe wall biofilm though the peak detection season. Bacterial cell densities in the biofilms, as measured by DAPI counts, increased over the same period from approximately 1.1 × 107 cells/mL to 3.0 × 107 per/mL. The more abundant food source and elevated water temperature, 20-25 °C, likely contributed to the increase in N. fowleri cell density. It is also interesting to note that the CP primers could not detect the low numbers of N. fowleri cells (Figure 4B), but were able to VOL. 43, NO. 17, 2009 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
6695
clearly identify N. fowleri as cell numbers increased (Figure 4C and D). This further indicates that N. fowleri has to be present at elevated numbers in mixed samples for identification using the CP primers. Emphasis must be placed on positive controls of known cell numbers, in a similar background and extracted using identical methods, in the RT-PCR analysis in order to obtain accurate calculations of cells in the field samples. Direct detection by the RT-PCR method may result in the overestimation of viable cells, due to the contribution of nonviable cells and eDNA (35). However, pretreatment to remove dead cells and eDNA from samples may be useful in preventing overestimation of viable cells (35). Upon comparison, N. fowleri detection in drinking water samples appears lower and more variable than pipewall biofilms. The higher number of N. fowleri cells detected in biofilm also highlights the important role of biofilms in harboring N. fowleri, as well as other amoebae. Thus, our results suggest that the detection of N. fowleri in samples from field-based biofilm monitoring devices using the total DNA RT-PCR melt curve method specific for N. fowleri will provide a more rapid and improved method for the surveillance of drinking water distribution networks vulnerable to N. fowleri colonization, which aids water utilities in delivering safer drinking water for consumers.
Acknowledgments This work was delivered through the CSIRO Water for a Healthy Country Flagship. We thank Water Corporation of Western Australia for logistical help and setup of biofilm biomonitors. We also thank Ray Mogyorosy of PathWest for his advice. Brad Patterson and Maneesha Ginige are thanked for reviewing earlier drafts.
Supporting Information Available Melt curve profiles for N. fowleri and N. lovaniensis using CP primers. Melt curve profile for N. fowleri and nonpathogenic Naegleria species in 250 mL of field drinking water samples using SP and CP primers. This material is available free of charge via the Internet at http://pubs.acs.org.
Literature Cited (1) Marciano-Cabral, F. Biology of Naegleria spp. Microbiol. Mol. Biol. Rev. 1988, 52 (1), 114–133. (2) Marshall, M. M.; Naumovitz, D.; Ortega, Y.; Sterling, C. R. Waterborne protozoan pathogens. Clin. Microbiol. Rev. 1997, 10 (1), 67–85. (3) Chang, S. L. Resistance of pathogenic Naegleria to some common physical and chemical agents. Appl. Environ. Microbiol. 1978, 35 (2), 368–375. (4) Marciano-Cabral, F.; G, A. C. The immune response to Naegleria fowleri amebae and pathogenesis of infection. FEMS Immunol. Med. Microbiol. 2007, 51 (2), 243–259. (5) Marciano-Cabral, F.; MacLean, R.; Mensah, A.; LaPat-Polasko, L. Identification of Naegleria fowleri in domestic water sources by nested PCR. Appl. Environ. Microbiol. 2003, 69 (10), 5864–5869. (6) CDC. Primary amebic meningoencephalitis --- Arizona, Florida, and Texas, 2007. MMWR 2008, 57, (21), 573-577. (7) Cerva, L. Amoebic meningoencephalitis: Sixteen fatalities. Science 1968, 160 (3823), 92. ` erva, L. Studies of limax amoebae in a Swimming Pool. (8) C Hydrobiologia 1971, 38 (1), 141–161. (9) De Jonckheere, J. F. Studies on pathogenic free-living amoebae in swimming pools. Bull Inst. Pasteur. 1979, 77, 385–392. (10) De Jonckheere, J. F.; Van De Voorde, H. The distribution of N. fowleri in man-made thermal waters. Am. J. Trop. Med. Hyg. 1977, 76, 10–15. (11) Huizinga, H. W.; McLaughlin, G. L. Thermal ecology of Naegleria fowleri from a power plant cooling reservoir. Appl. Environ. Microbiol. 1990, 56 (7), 2200–2205. (12) Tyndall, R. L.; Ironside, K. S.; Metler, P. L.; Tan, E. L.; Hazen, T. C.; Fliermans, C. B. Effect of thermal additions on the density and distribution of thermophilic amoebae and pathogenic Naegleria fowleri in a newly created cooling lake. Appl. Environ. Microbiol. 1989, 55 (3), 722–732.
6696
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 43, NO. 17, 2009
(13) Blair, B.; Sarkar, P.; Bright, K. R.; Marciano-Cabral, F.; Gerba, C. P. Naegleria fowleri in well water. Emerging Infect. Dis. 2008, 14 (9), 1499–1501. (14) Berry, D.; Xi, C.; Raskin, L. Microbial ecology of drinking water distribution systems. Curr. Opin. Biotechnol. 2006, 17 (3), 297– 302. (15) Flemming, H. C. Biofouling in water systems - cases, causes and countermeasures. Appl. Microbiol. Biotechnol. 2002, 59 (6), 629–640. (16) Hallam, N. B.; West, J. R.; Forster, C. F.; Simms, J. The potential for biofilm growth in water distribution systems. Water Res. 2001, 35 (17), 4063–4071. (17) Hu, J. Y.; Yu, B.; Feng, Y. Y.; Tan, X. L.; Ong, S. L.; Ng, W. J.; Hoe, W. C. Investigation into biofilms in a local drinking water distribution system. Biofilms 2005, 2 (01), 19–25. (18) LeChevallier, M. W.; Babcock, T. M.; Lee, R. G. Examination and characterization of distribution system biofilms. Appl. Environ. Microbiol. 1987, 53 (12), 2714–2724. (19) Hoffmann, R.; Michel, R. Distribution of free-living amoebae (FLA) during preparation and supply of drinking water. Int. J.f Hyg. Environ. Health 2001, 203 (3), 215–219. (20) Thomas, V.; Bouchez, T.; Nicolas, V.; Robert, S.; Loret, J. F.; Le´vi, Y. Amoebae in domestic water systems: resistance to disinfection treatments and implication in Legionella persistence. J. Appl. Microbiol. 2004, 97 (5), 950–963. (21) Trolio, R.; Bath, A.; Gordon, C.; Walker, R.; Wyber, A. Operational management of Naegleria spp. in drinking water supplies in Western Australia. Water Sci. Technol.: Water Supply 2008, 8 (2), 207–215. (22) Robinson, B. S.; Monis, P. T.; Dobson, P. J. Rapid, sensitive, and discriminating identification of Naegleria spp. by real-time PCR and melting-curve analysis. Appl. Environ. Microbiol. 2006, 72 (9), 5857–5863. (23) Behets, J.; Declerck, P.; Delaedt, Y.; Verelst, L.; Ollevier, F. Quantitative detection and differentiation of free-living amoeba species using SYBR green-based real-time PCR melting curve analysis. Curr. Microbiol. 2006, 53 (6), 506–509. (24) van der Kooij, D.; Veenendaal, H. R.; Baars-Lorist, C.; van der Klift, D. W.; Drost, Y. C. Biofilm formation on surfaces of glass and Teflon exposed to treated water. Water Res. 1995, 29 (7), 1655–1662. (25) Pelandakis, M.; Serre, S.; Pernin, P. Analysis of the 5.8S rRNA gene and the internal transcribed spacers in Naegleria spp. and in N. fowleri. J. Eukaryotic Microbiol. 2000, 47 (2), 116–121. (26) Hoefel, D.; Monis, P. T.; Grooby, W. L.; Andrews, S.; Saint, C. P. Culture-independent techniques for rapid detection of bacteria associated with loss of chloramine residual in a drinking water system. Appl. Environ. Microbiol. 2005, 71 (11), 6479–6488. (27) Clark, C. G. Genome Structure and Evolution of Naegleria and Its Relatives. In 5th International Conf on Biology and Pathogenicity of Free Living Amoeba, Brussels, Belgium, Aug 07-11; Society of Protozoologists: Brussels, Belgium, 1989; S2-S6. (28) Clark, C. G.; Cross, G. A. rRNA genes of Naegleria gruberi are carried exclusively on a 14-kilobase-pair plasmid. Mol. Cell. Biol. 1987, 7 (9), 3027–3031. (29) Barbeau, J.; Buhler, T. Biofilms augment the number of freeliving amoebae in dental unit waterlines. Res. Microbiol. 2001, 152 (8), 753–760. (30) Oliver, J. D. The Viable but Nonculturable State in Bacteria. J. Microbiol. 2005, 43 (1), 93–100. (31) Oliver, J. D.; Dagher, M.; Linden, K. Induction of Escherichia coli and Salmonella typhimurium into the viable but nonculturable state following chlorination of wastewater. J Water Health 2005, 3, 249–257. (32) Australian Drinking Water Guidelines; National Health and Medical Research Council and Natural Resource Management Ministerial Council: , 2004; Vol. 6. (33) Gordon, K. V.; Vickery, M. C.; DePaola, A.; Staley, C.; Harwood, V. J. Real-time PCR assays for quantification and differentiation of Vibrio vulnificus strains in oysters and water. Appl. Environ. Microbiol. 2008, 74 (6), 1704–1709. (34) Yu, C.-P.; Farrell, S. K.; Robinson, B.; Chu, K.-H. Development and application of real-time PCR assays for quantifying total and aerolysin gene-containing aeromonas in source, intermediate, and finished drinking water. Environ. Sci. Technol. 2008, 42 (4), 1191–1200. (35) Nocker, A.; Sossa-Fernandez, P.; Burr, M. D.; Camper, A. K. Use of propidium monoazide for live/dead distinction in microbial ecology. Appl. Environ. Microbiol. 2007, 73 (16), 5111–5117.
ES900432M
