Rational Crystal Contact Engineering of Lactobacillus brevis Alcohol

Article pubs.acs.org/crystal

Cite This: Cryst. Growth Des. XXXX, XXX, XXX−XXX

Rational Crystal Contact Engineering of Lactobacillus brevis Alcohol Dehydrogenase To Promote Technical Protein Crystallization Phillip Nowotny, Johannes Hermann, Jianing Li, Angela Krautenbacher, Kai Klöpfer, Dariusch Hekmat, and Dirk Weuster-Botz*

Crystal Growth & Design Downloaded from pubs.acs.org by WASHINGTON UNIV on 03/01/19. For personal use only.

Technical University of Munich, Institute of Biochemical Engineering, Boltzmannstraße 15, 85748 Garching, Germany ABSTRACT: Technical protein crystallization is an alternative to preparative chromatography for purification of proteins. However, only a few proteins are satisfactorily crystallizable for this technical purpose. In the present work, the crystallizability of Lactobacillus brevis alcohol dehydrogenase (LbADH) was significantly improved by rational engineering of its crystal contact patches. The concept was to exchange amino acids at the crystal contact patches with the objective of (i) surface entropy reduction (SER) and (ii) enhancement of ionic interactions. We present three newly designed, enzymatically active LbADH mutants with improved crystallizability: K32A (via SER) and Q126H and Q126K (both via enhancement of ionic interactions). The wild type crystallized with a low crystallization success rate in microbatch experiments. All mutants crystallized consistently with enhanced crystallization kinetics under identical conditions. Mutant K32A crystallized at reduced protein concentrations. Mutant Q126H crystallized at reduced concentrations of protein and the crystallization agent polyethylene glycol. Furthermore, the X-ray structure of mutant K32A reveals evidence of crystal contact enforcement which does explain enhanced crystallizability on the atomic level. The increased space−time yield of mutant K32A in stirred tank crystallizers demonstrates that rational crystal contact engineering is a powerful tool to promote technical protein crystallization.

■

INTRODUCTION Engineering of proteins in order to enable crystallizability and to improve crystal quality for crystallographic analysis has been performed for almost three decades. Starting in 1991, intermolecular crystal contacts of the protein ferritin were engineered to obtain crystals with sufficient quality for X-ray diffraction analysis.1 Other early work focused on protein engineering in order to generally enable and enhance crystallizability.2−4 It was found that single amino acid exchanges can have a distinct effect on the crystallization properties of the protein. A first review on protein engineering as a tool for crystallography was published by Price and Nagai.5 A rational engineering approach toward enhanced crystallizability was developed by Derewenda’s group. In the case of the Rho-specific guanine nucleotide dissociation inhibitor (RhoGDI), it was shown that crystallization was promoted by mutating surface-oriented lysine to alanine.6 This concept was called surface entropy reduction (SER) and was proposed to generate “low-entropy” surface patches leading to improved crystal quality for X-ray crystallography of a number of engineered proteins.7−11 In comparable crystallization studies, the substitution of alanine or aspartic acid for glutamic acid12 and arginine for lysine13 led to improved crystallizability. The objective of the aforementioned work on protein crystal engineering was to create single, large, and well-diffracting protein crystals for structural analysis. However, in addition to crystallography, there has been an increased demand in recent © XXXX American Chemical Society

years for crystallization as a technical means for the purification and formulation of proteins. Various studies have shown that technical protein crystallization is a viable alternative to conventional protein purification methods such as common preparative chromatography.14−24 Since technical protein crystallization requires no costly equipment and consumables (e.g., resins), it addresses the key bottleneck of preparative chromatography.15 From a technical perspective, the requirements are met for an effective process integration of protein crystallization as a purification step. As the most prominent example, recombinant insulin has been industrially crystallized for several decades.25 However, only a few proteins are satisfactorily crystallizable for industrial purposes. According to the authors’ knowledge, no research on engineering of proteins to promote technical crystallization has yet been published. The objective of the present work is to apply rational protein engineering exemplarily to the industrially relevant Lactobacillus brevis alcohol dehydrogenase (LbADH) in order to enhance its applicability in technical crystallization: i.e., by increasing the crystallization space−time yield and thus decreasing process costs. LbADH is a homotetrameric enzyme that catalyzes the enantioselective reduction of prochiral ketones to the corresponding secondary Received: January 15, 2019 Revised: February 14, 2019 Published: February 19, 2019 A

DOI: 10.1021/acs.cgd.9b00067 Cryst. Growth Des. XXXX, XXX, XXX−XXX

Crystal Growth & Design

Article

Fisher Scientific, Darmstadt, Germany). The purity of LbADH solutions was assessed by SDS-PAGE. Enzymatic activities of LbADH variants were determined photometrically by detection of the NADPH oxidation during reduction of acetophenone to 1-phenylethanol in microtiter plates at 30 °C (Multiskan FC Microplate Photometer, Thermo Fisher Scientific, Darmstadt, Germany). A 20 μL portion of LbADH solution (6 mg L−1 LbADH in the protein buffer) was added to 180 μL of protein buffer containing 10 mM acetophenone and 0.5 mM NADPH. The absorption was measured at 340 nm at 6 s intervals for 10 min. Crystallization of LbADH Variants. Static microbatch crystallization of LbADH variants was performed in 96-well microbatch plates (MRC UnderOil Crystallization Plate, SWISSCI, Neuheim, Switzerland) comparable to the method of Hermann et al.31 In an initial crystallization screening, wild type (WT) LbADH and 25 mutants were crystallized in at least 8-fold experimental approaches under the following defined standard conditions. The protein solutions contained 10 g L−1 LbADH in the protein buffer. The crystallization buffer was composed of 100 mM Tris-HCl at pH 7.0, 50 mM MgCl2, and 15% (w/v) PEG 550 MME (monomethyl ether). The crystallization of the selected mutants K32A, Q126H, and Q126K was conducted under the following six different crystallization conditions. The protein solutions contained 5 or 10 g L−1 LbADH in the protein buffer. The crystallization buffer was composed of 100 mM Tris-HCl at pH 7.0, 50 mM MgCl2, and 5, 10, and 15% (w/v) PEG 550 MME. Equal amounts of crystallization buffer and protein solution were mixed in a 1.5 mL polypropylene reaction tube. Ten microliter drops in quadruplicate were transferred to 96-well microbatch plates and sealed with transparent adhesive tape (Duck Brand HD Clear High Performance Packaging Tape, Avon, USA). Protein crystallization was conducted at a constant temperature of 20 °C and monitored by automated imaging. Stirred milliliter batch crystallization was conducted in tank crystallizers with a stirrer speed of 150 rpm (as described by Smejkal et al.20). Experiments were performed with a total crystallization volume of 5 mL under standard buffer conditions and initial LbADH concentrations of 10 g L−1. All crystallizers were placed in a temperature-controlled refrigerated circulator at 20 °C (No. 1157P, VWR, Darmstadt, Germany). Forty microliter samples were taken manually, diluted by a factor of 1:10 in order to prevent further crystallization, and centrifuged for 30 s at 16000g and 20 °C. The protein concentration of the supernatant was assessed by BCA assay. Automated Crystal Imaging. Microscopic images of protein crystals in 96-well plates were photographed automatically every 1 h at multiple focus levels until crystallization equilibrium using a light microscope (Nikon Eclipse 50i, Nikon, Düsseldorf, Germany, with a 10-fold objective (CFI Plan Fluor), an attached digital camera (DS2Mv, Nikon), and the controlling and NIS Elements v3.2 imaging software, Nikon, Düsseldorf, Germany). The automated microscope was placed inside an incubator (KB115, Binder, Tuttlingen, Germany) whose temperature was kept constant at 20 °C. X-ray Analysis. For X-ray structure analysis, the protein crystal was cryoprotected with reservoir solution supplemented with 30% (w/v) ethylene glycol before flash-freezing and stored in liquid nitrogen until data collection. X-ray diffraction data were collected at the ID30-A beamline at the Synchrotron Radiation Facility (ESRF, Grenoble, France). Data reduction was conducted with XDS34 and AIMLESS.35 Structure solution and refinement was conducted with the CCP4 software suite (version 7.0).36 Molecular replacement with Phaser37 was conducted with an in silico mutated structure (6H07)31 as search model. For the refinement, REFMAC38 was used and manual model building was performed using Coot.39 The final structure was validated with PDB-REDO.40

alcohols. LbADH is stable and enzymatically active at elevated temperatures and has a broad substrate range, making it a valuable tool in industrial biocatalysis.26−30 High-resolution Xray structures of LbADH have been published27,28 of which our previously published LbADH structure (PDB ID 6H07)31 was the foundation for the rational crystal contact engineering approach of this work.

■

EXPERIMENTAL SECTION

Cloning and Mutagenesis. A His6 tag was genetically fused to the N-terminus of LbADH linked by a glycine−serine−glycine sequence, and the genetic construct was cloned into expression plasmid pET28a(+), resulting in pET28a_LbADH_GSG_His6 (as previously reported by Hermann et al.31). Site-directed mutagenesis of the LbADH gene was performed using the standard QuikChange PCR protocol with adaptations in primer design (according to Zheng et al.32). Primers used for the three LbADH mutants K32A, Q126H, and Q126K were: LbADH_K32A, GGGCTGCGGTCATGATTACC (forward), CATGACCGCAGCCCCTTCTTC (reverse); primer LbADH_Q126H, GGATTCATCGGATGAAGAACAAAGGC (forward), CGATGAATCCCTAATCGGGTACCG (reverse); primer LbADH_Q126K, GGATTAAACGGATGAAGAACAAAGGC (forward), CGTTTAATCCCTAATCGGGTACCG (reverse). E. coli DH5α was transformed with QuikChange PCR product digested with DpnI, and the amplified DNA sequences of mutated plasmids were verified by DNA sequencing (Eurofins Genomics, Ebersberg, Germany). Production and Purification of LbADH Variants. BL21 (DE3) competent E. coli cells were transformed with plasmid pET28a_LbADH_GSG_His6 or mutated variants thereof and precultivated in 13 mL tubes (Sarstedt AG & Co. KG, Nümbrecht, Germany) containing 6 mL of TB medium and 35 mg L−1 of kanamycin. Precultures were grown at 37 °C and 250 rpm for 18 h. Two milliliter portions of the precultures were transferred to 500 mL shaking flasks with 100 mL of TB medium including 35 mg L−1 of kanamycin and were continuously grown at 37 °C and 250 rpm. LbADH gene expression was induced by addition of IPTG (final concentration 1 mM) upon reaching an OD600 value of 0.8. After 14 h of IPTG induction, the cells were concentrated by centrifugation (1500g, 5 min, 4 °C) and the cell pellets were washed by resuspension in chilled PBS followed by a second, identical centrifugation step. The supernatant was discarded, and the pellets were frozen at −20 °C for at least 2 h. For cell disruption, the pellets were thawed on ice and resuspended in 10 mL of PBS containing 1 mM PMSF and 1 μg mL−1 DNase I. Cells were disrupted by sonication (2 × 3 min, 90% intensity, 50% pulse, Sonoplus HD 2070 + Micro tip MS 72, BANDELIN electronic GmbH & Co. KG, Berlin, Germany). Cell debris was separated by centrifugation (12000g, 20 min, 4 °C) and filtration through a 0.2 μm polypropylene syringe filter. The supernatant was loaded onto a 1 mL nickel-affinity column (HisTrap High Performance column, Ä KTA Pure system, GE Healthcare Life Science, Munich, Germany) which was pre-equilibrated in a binding buffer (20 mM sodium phosphate pH 7.0, 40 mM imidazole, 500 mM NaCl). After a washing step with an increased imidazole concentration of 67.6 mM, bound LbADH was eluted in an elution buffer (20 mM sodium phosphate pH 7.0, 270 mM imidazole, 500 mM NaCl). LbADH fractions were dialyzed against the protein buffer (20 mM HEPES-NaOH pH 7.0, 1.0 mM MgCl2) by a factor of 1:106 using a 14 kDa dialysis membrane (Membra-Cel, Serva, Heidelberg, Germany) while they were stirred gently. Subsequently, protein solutions were concentrated to 10 g L−1 by ultrafiltration (10 kDa MWCO Vivaspin 500, Sartorius, Göttingen, Germany). Protein Analytics. LbADH concentration was determined by UV absorbance at 280 nm with a spectrophotometer (BioSpectrometer Basic, Eppendorf, Hamburg, Germany) using a theoretical molar extinction coefficient of 19940 M−1 cm−1 calculated with ProtParam.33 Concentration determinations of the supernatant during stirred milliliter batch experiments were performed by applying the bicinchoninic acid reaction (Pierce BCA Protein Assay Kit, Thermo

■

RESULTS AND DISCUSSION

Engineering Concept and Crystallization Screenings of LbADH Mutants. Positions for site-directed amino acid exchanges were identified at the crystal contact patches of WTLbADH (Figure 1). The first rational crystal contact B



Article

Figure 1. Overview of the amino acid positions of WT-LbADH which were selected for rational mutagenesis of the crystal contact patches. (a) Crystal packing of three LbADH tetramers; bound Mg2+ ions are shown in magenta. (b) Enlargement of the larger crystal contact of LbADH between the green and cyan tetramer. (c) Enlargement of the smaller crystal contact between the orange and green (left part) and the extension of the larger crystal contact between the orange and cyan tetramer, illustrating the periodic arrangement (right part). This figure was prepared using PyMOL (v.2.1; Schrödinger).

engineering approach was to apply the concept of surface entropy reduction (SER), in which lysine (K) and glutamic acid (E) are exchanged by entropically favored alanine.6−12 Since there were only four lysines and two glutamic acids located at the crystal contact patches, we extended the SER screening to histidine (H) and arginine (R) (both have large, positively charged side chains similar to lysine) and aspartic acid (D) (large, negatively charged side chains similar to glutamic acid). The second engineering approach was to introduce positively charged arginine (R), lysine (K), and histidine (H) or negatively charged aspartic acid (D) and glutamic acid (E). The objective was to generate or enhance ionic interactions with existing oppositely charged amino acids of the opposite crystal contact patch. In two crystallization screenings of a total of 25 LbADH single mutants, 16 crystallized under the standard conditions, 8 of which revealed a higher crystallization success rate (percentage of microbatch experiments in which crystallization was observable within 48 h) (see Table 1). Notably, four out of six cases in which lysine or glutamic acid was exchanged by alanine (original SER strategy) led to an enhanced crystallization success rate, whereas the substitution of arginine, histidine, and aspartic acid with alanine reduced the crystallization success rate. In addition, four mutants with an increased crystallization success rate were found in the ionic interaction screening. These results demonstrate that the incorporation of charged amino acids in fact can enhance crystallizability. Four noncrystallizable mutants were observed in both screenings under standard conditions. Since their enzymatic activities were preserved in seven out of eight cases (only the mutation threonine to aspartic acid at position 103 (T103D) inactivated the enzymatic activity of LbADH, data not shown), we deduce a conservation of the tetramer

Table 1. Crystallization Success Rate of WT-LbADH and Mutants That Were Generated According to the Extended SER Screening and the Ionic Interaction Screeninga extended SER screening

ionic interaction screening

LbADH variants

crystallization success rate, %

LbADH variants

crystallization success rate, %

WT E28Ab K32Ab R38A H39A D41A E44Ab K45A K48Ab D67A K71Ab E100Ab D197A

78 80 100 4 0 28 0 0 100 8 92 71 0

WT H39D H39E K45R K48R E66D K71H K71R D74E T102E T103D Q126H Q126K D197E

62 0 25 21 90 40 0 56 0 0 0 93 100 66

a

Variants given in boldface were crystallized under standard conditions; variants given in italics are mutants revealing a higher crystallization success rate than the WT. bDesigned according to the original SER strategy by the Derewenda group.6,12

formation which is essential for enzymatic activity of LbADH.27 Hence, since most noncrystallizable mutants maintained their tetrameric formation, we assume a breakup of the crystal contact interactions. Mutation T103D might inactivate LbADH, as T103 is in close proximity (3 Å) to the neighboring monomer of the same tetramer and therefore is most likely involved in the tetramer formation. Three wellcrystallizing mutants K32A, Q126H, and Q126K were C



Article

reproduced, and the crystallization characteristics were analyzed in more detail. Tracing Back Varying Crystallization Behaviors to Single Amino Acid Exchanges. A consistent methodology from gene expression to protein crystallization was a prerequisite for the objective of tracing back varying crystallization behaviors to single amino acid exchanges. It was shown exemplarily for the WT and the three mutants K32A, Q126H, and Q126K that comparable concentrations and purities were obtained after protein production, purification, dialysis, and concentration (Figure 2). Enzymatic activity assays further confirmed the consistent processing of all four duplicates and the preservation of enzymatic activity after mutagenesis (Figure 3).

Figure 4. Heterogeneous crystallization of WT-LbADH under standard conditions due to the presence of a foreign nucleating agent (indicated by the blue arrow): (a) 0 h; (b) 24 h; (c) 48 h.

screenings, which could have had a critical effect on the crystallization success rate.41 However, we were able to compare the crystallization characteristics of the mutants with those of the simultaneously crystallizing WT proteins since identical conditions prevailed. In the case of the duplicative crystallization experiments, the single event in which heterogeneous nucleation occurred showed that the WT was able to crystallize but was not able to form nuclei under the respective conditions. In contrast, all three mutants crystallized reproducibly with more than 10 crystals per well. The number of crystals, the crystal size, and the crystal morphology of LbADH variants were consistently different (Figure 5). However, duplicates crystallized with a

Figure 2. SDS-PAGE of WT-LbADH (His6-tagged, 262 amino acids, 27.8 kDa per monomer) and the mutants K32A, Q126H, and Q126K. (a) and (b) correspond to duplicative protein production starting from an individual E. coli transformation for each protein variant.

Figure 3. Maximum enzymatic activities of mutants K32A, Q126H, and Q126K in relation to WT-LbADH. (a) and (b) correspond to duplicative protein production starting from an individual E. coli transformation for each variant.

Duplicates of WT and mutants K32A, Q126H, and Q126K were subsequently each crystallized simultaneously in quadruplicate under the standard conditions (eight microbatch experiments per LbADH variant). Under these conditions, the WT only crystallized in a single event within 48 h, in which heterogeneous crystallization took place due to the unexpected presence of a foreign nucleating agent (Figure 4). In the initial screenings, the WT crystallized with crystallization success rates of 62% and 78% in the SER screening and in the ionic interactions screening, respectively. The screening preparation of the WT and the three mutants was conducted at a slightly lower ambient temperature in comparison to the initial

Figure 5. Representative crystallization microphotographs of WTLbADH and mutants K32A, Q126H, and Q126K under standard conditions (5 g L−1 LbADH and 7.5% (w/v) PEG) after 48 h.

very similar number of crystals, crystal size, and crystal morphology. Since all LbADH variants revealed the same purity and concentration, distinct crystallization behavior could therefore be traced back to a single amino acid exchange. Extended Nucleation Window of LbADH Mutants. In addition to crystallization under standard conditions, crystallization experiments of the WT and the three mutants were D



Article

Figure 6. Microphotographs of crystallization results after 48 h of WT-LbADH and mutants K32A, Q126K, and Q126H under standard conditions (blue boxes) and at reduced protein and PEG concentrations at 20 °C. WT crystallization under standard conditions only took place in one out of eight experiments where heterogeneous crystallization took place (see Figure 4).

conducted at reduced protein concentrations and reduced PEG concentrations (Figure 6). No WT crystals were observed at reduced concentrations. In addition, mutant Q126K did not form any crystals at either reduced protein or PEG concentrations, although it crystallized reproducibly at standard protein and PEG concentrations. Mutant K32A did not crystallize at reduced PEG concentrations but crystallized in six out of eight experiments at reduced protein concentration. Mutants Q126K and K32A therefore showed a high dependence on PEG for crystal nucleation. Mutant Q126H revealed the largest nucleation window, since crystals grew under all applied conditions. Enhanced Crystallization Kinetics of LbADH Mutants on the Static Microliter Scale. The induction time and the time until crystallization equilibrium was reached were shortest for mutant Q126H. At the highest protein and PEG concentrations, it took 30 min until the first crystals were visible and 12 h until crystallization equilibrium was reached. For mutants K32A and Q126K, it took 6 and 12 h, respectively, until the first crystals were visible. Equilibrium was reached after 24 and 48 h, respectively. In the case of mutant Q126H, both PEG and protein concentrations had an effect on the crystallization kinetics. Induction time was increased when PEG or protein concentrations were reduced. Reduction of the protein concentration led to both an increased nucleation time and a decreased number of crystals, which can be explained by less often occurring nucleation events. For all LbADH variants, a shorter nucleation time together with a shorter time until crystallization equilibrium correlated with a broader nucleation window and a higher number of crystals. Hence, the crystallization success rate is a valid screening parameter when mutants with enhanced crystallization kinetics are targeted. Enhanced Space−Time Yields of LbADH K32A in Stirred Tank Crystallizers. In the stirred 5 mL scale, the WT started to crystallize approximately 45 min after mixing protein solution and crystallization buffer (see Figure 7). After 2.5 and 8 h, 80% and 90% of the protein was crystallized, respectively. In contrast, mutant K32A started immediately to crystallize once protein solution and crystallization buffer were mixed. After 1 and 2 h, 90% and 97% of the protein was crystallized,

Figure 7. Crystallization kinetics of WT-LbADH (white) and mutant K32A (black) in a stirred tank crystallizer (V = 5 mL, nstirrer = 150 min−1, 7.5% (w/v) PEG, starting protein concentration 10 g L−1, T = 20 °C).

respectively, revealing a significantly increased space−time yield. These observations are consistent with the results from the microbatch experiments and demonstrate the scalability from static microliter to stirred milliliter crystallization. Mechanistic Explanation for Improved Crystallizability. The amino acid substitution in mutant K32A took place at a crystal contact comprised of two single aspartic acids (D54) facing each other (Figure 8). Lysine (K32) has a positively charged, large flexible side chain that is located next to D54. According to the SER theory, crystallizability of proteins can be enhanced by substituting alanines for lysines.6−12 In our study, we investigated the applicability of the SER theory at known crystal contact patches. X-ray diffraction data of mutant K32A verified that the crystal contact patch was engineered and no unpredictable formation of new crystal contacts had occurred. Hence, mutation K32A led to the same crystal packing as the WT. WT crystals (PDB ID 6H07, P21221, two monomers in its asymmetric unit, 1.48 Å resolution) and K32A crystals (PDB ID 6HLF, I222, one monomer in its asymmetric unit, 1.55 Å resolution) exhibited similar unit cell parameters (WT, a = 55.74 Å, b = 80.11 Å, c = 114.86 Å; K32A, a = 55.58 Å, b = 81.78 Å, c = 114.90 Å). It had been shown previously that this combination resulted in the same crystal packing and therefore identical crystal contacts.31 E



Article

and molecular dynamics simulations might help to elucidate in the future why SER or the strategy of ionic interaction enhancement promotes crystallizability in one case and prevents it in another. X-ray crystallography of mutant K32A has laid the foundation for a novel mechanistic explanation of improved LbADH crystallizability on the atomic level. We deduced enhanced H bonding from a fixed water molecule between two aspartic acids. This results in an enforced crystal contact that facilitates nucleation and crystal growth even at reduced PEG and protein concentrations. We further demonstrate enhanced crystallizability of mutant K32A in a stirred tank crystallizer. In comparison to the WT, the mutant K32A led to reduced induction time, reduced time until crystallization equilibrium, reduced equilibrium concentration, and therefore an increased space−time yield. A recent study demonstrates that further crystallization scaleup is feasible by keeping the maximum local energy dissipation constant.19 The combination of enhanced crystallizability and preserved enzymatic activities makes crystal contact engineering a valuable tool when it comes to the question of how to increase space−time yields and how to reduce the required amount of crystallization agents in large-scale crystallization processes. Both latter points may lead to process cost savings. Conversely, we regard crystal contact engineering as an equally valuable tool in order to prevent unwanted protein crystallization in biotechnological processes.

Figure 8. Comparison of the crystal contacts mediated by D54 of (a) WT-LbADH and (b) mutant K32A. The red sphere in (b) represents the oxygen atom of a fixed water molecule in the crystal packing of mutant K32A, which indicates a crystal contact enforcement. Distances (in Å) between red oxygen atoms are displayed by dashed lines. This figure was prepared using PyMOL (v.2.1; Schrödinger) and PDB IDs 6H07 (WT) and 6HLF (K32A).

An indicator for an enforced crystal contact of mutant K32A in comparison to the WT is the incorporation of a fixed water molecule between both D54 residues facing each other (see Figure 8). This fixed water molecule is missing at the indicated position in the WT crystal. We assume increased H bonding between D54 residues in crystal K32A mediated by this water molecule. In the case of the mutants Q126H and Q126K, we assume a salt bridge formation between the positively charged, stabilized histidine or lysine at position 126 and the negatively charged aspartic acid (D41) of the neighboring monomer (distance 3 Å) resulting in enhanced crystallizability.

■

AUTHOR INFORMATION

Corresponding Author

*D.W.-B.: tel, +49 89 289 15712; fax, +49 89 289 15714; email, [email protected].

■

CONCLUSIONS We demonstrate in this study that single amino acid substitutions at the crystal contact patches of LbADH can significantly alter crystallizability of enzymatically active mutants. The LbADH mutants K32A, Q126H, and Q126K crystallize with increased crystallization success rate in comparison to the WT. An increased crystallization success rate correlates with an extended nucleation window, a higher number of crystals, a lowered induction time, and a lowered time span until crystallization equilibrium. We show that distinct crystallization behavior can be traced back solely to the amino acid exchange in case that WT and mutants are processed in parallel, while applying a consistent methodology from gene expression to protein crystallization. The SER strategy, developed by the Derewenda group, was originally presented as a surface engineering tool enabling crystallizability and improving crystal diffraction quality for crystallographic purposes.6−13 We transferred the SER strategy to the engineering of crystal contacts of LbADH and extended the screening by substitution of histidine, lysine, and aspartic acid with alanine. Only the substitutions suggested by the Derewenda group led to improved crystallizability: namely, substitutions of lysine and glutamic acid with alanine. Additionally, the introduction of charged amino acids facing oppositely charged amino acids at crystal contact patches led to improved crystallizability. Technically, the targeted generation of ionic interactions can be advantageous, especially in case of poorly water soluble proteins which would become even less soluble by applying the SER strategy, where proteins become more hydrophobic. A combination of crystallography

ORCID

Phillip Nowotny: 0000-0002-0767-1603 Johannes Hermann: 0000-0003-2686-3771 Kai Klöpfer: 0000-0002-9387-4510 Dariusch Hekmat: 0000-0003-0263-232X Dirk Weuster-Botz: 0000-0002-1171-4194 Funding

German Research Foundation (DFG), Grant No. WE2715/ 14-1. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS The authors thank the European Synchrotron Radiation Facility (ESRF, Grenoble, France) for beam time, the beamline scientists of ID30A for setting up the beamline, and Dr. Sabine Schneider (Chair of Biochemistry, Technical University of Munich, Garching, Germany) for data collection. Funding by the German Research Foundation (Deutsche Forschungsgemeinschaft DFG) of project WE2715/14-1 within the framework of the SPP 1934 priority program is gratefully acknowledged. We acknowledge the support of Phillip Nowotny and Johannes Hermann by the TUM Graduate School.

■

REFERENCES

(1) Lawson, D. M.; Artymiuk, P. J.; Yewdall, S. J.; Smith, J. M.; Livingstone, J. C.; Treffry, A.; Luzzago, A.; Levi, S.; Arosio, P.; Cesareni, G. Solving the Structure of Human H Ferritin by

F



Article

Genetically Engineering Intermolecular Crystal Contacts. Nature 1991, 349, 541−544. (2) McElroy, H. E.; Sisson, G. W.; Schoettlin, W. E.; Aust, R. M.; Villafranca, J. E. Studies on Engineering Crystallizability by Mutation of Surface Residues of Human Thymidylate Synthase. J. Cryst. Growth 1992, 122, 265−272. (3) Jenkins, T. M.; Hickman, A. B.; Dyda, F.; Ghirlando, R.; Davies, D. R.; Craigie, R. Catalytic Domain of Human Immunodeficiency Virus Type 1 Integrase: Identification of a Soluble Mutant by Systematic Replacement of Hydrophobic Residues. Proc. Natl. Acad. Sci. U. S. A. 1995, 92, 6057−6061. (4) D’Arcy, A.; Stihle, M.; Kostrewa, D.; Dale, G. Crystal Engineering: A Case Study Using the 24 kDa Fragment of the DNA Gyrase B Subunit from Escherichia coli. Acta Crystallogr., Sect. D: Biol. Crystallogr. 1999, 55, 1623−1625. (5) Price, S. R.; Nagai, K. Protein Engineering as a Tool for Crystallography. Curr. Opin. Biotechnol. 1995, 6, 425−430. (6) Longenecker, K. L.; Garrard, S. M.; Sheffield, P. J.; Derewenda, Z. S. Protein Crystallization by Rational Mutagenesis of Surface Residues: Lys to Ala Mutations Promote Crystallization of RhoGDI. Acta Crystallogr., Sect. D: Biol. Crystallogr. 2001, 57, 679−688. (7) Derewenda, Z. S.; Vekilov, P. G. Entropy and Surface Engineering in Protein Crystallization. Acta Crystallogr., Sect. D: Biol. Crystallogr. 2006, 62, 116−124. (8) Derewenda, Z. S. Rational Protein Crystallization by Mutational Surface Engineering. Structure 2004, 12, 529−535. (9) Derewenda, Z. S. The Use of Recombinant Methods and Molecular Engineering in Protein Crystallization. Methods 2004, 34, 354−363. (10) Derewenda, Z. S.; Godzik, A. The ″Sticky Patch″ Model of Crystallization and Modification of Proteins for Enhanced Crystallizability. Methods Mol. Biol. 2017, 1607, 77−115. (11) Cooper, D. R.; Boczek, T.; Grelewska, K.; Pinkowska, M.; Sikorska, M.; Zawadzki, M.; Derewenda, Z. Protein crystallization by surface entropy reduction: Optimization of the SER strategy. Acta Crystallogr., Sect. D: Biol. Crystallogr. 2007, 63, 636−645. (12) Mateja, A.; Devedjiev, Y.; Krowarsch, D.; Longenecker, K.; Dauter, Z.; Otlewski, J.; Derewenda, Z. S. The Impact of Glu→Ala and Glu→Asp Mutations on the Crystallization Properties of RhoGDI: The Structure of RhoGDI at 1.3 Å Resolution. Acta Crystallogr., Sect. D: Biol. Crystallogr. 2002, 58, 1983−1991. (13) Czepas, J.; Devedjiev, Y.; Krowarsch, D.; Derewenda, U.; Otlewski, J.; Derewenda, Z. S. The Impact of Lys→Arg Surface Mutations on the Crystallization of the Globular Domain of RhoGDI. Acta Crystallogr., Sect. D: Biol. Crystallogr. 2004, 60, 275−280. (14) Hekmat, D.; Hebel, D.; Joswig, S.; Schmidt, M.; Weuster-Botz, D. Advanced Protein Crystallization Using Water-soluble Ionic Liquids as Crystallization Additives. Biotechnol. Lett. 2007, 29, 1703−1711. (15) Hekmat, D. Large-scale Crystallization of Proteins for Purification and Formulation. Bioprocess Biosyst. Eng. 2015, 38, 1209−1231. (16) Hekmat, D.; Huber, M.; Lohse, C.; von den Eichen, N.; Weuster-Botz, D. Continuous Crystallization of Proteins in a Stirred Classified Product Removal Tank with a Tubular Reactor in Bypass. Cryst. Growth Des. 2017, 17, 4162−4169. (17) Hebel, D.; Huber, S.; Stanislawski, B.; Hekmat, D. Stirred Batch Crystallization of a Therapeutic Antibody Fragment. J. Biotechnol. 2013, 166, 206−211. (18) Hebel, D.; Ü rdingen, M.; Hekmat, D.; Weuster-Botz, D. Development and Scale up of High-Yield Crystallization Processes of Lysozyme and Lipase Using Additives. Cryst. Growth Des. 2013, 13, 2499−2506. (19) Smejkal, B.; Helk, B.; Rondeau, J.-M.; Anton, S.; Wilke, A.; Scheyerer, P.; Fries, J.; Hekmat, D.; Weuster-Botz, D. Protein Crystallization in Stirred Systems-scale-up via the Maximum Local Energy Dissipation. Biotechnol. Bioeng. 2013, 110, 1956−1963. (20) Smejkal, B.; Agrawal, N. J.; Helk, B.; Schulz, H.; Giffard, M.; Mechelke, M.; Ortner, F.; Heckmeier, P.; Trout, B. L.; Hekmat, D.

Fast and Scalable Purification of a Therapeutic Full-length Antibody Based on Process Crystallization. Biotechnol. Bioeng. 2013, 110, 2452− 2461. (21) Neugebauer, P.; Khinast, J. G. Continuous Crystallization of Proteins in a Tubular Plug-Flow Crystallizer. Cryst. Growth Des. 2015, 15, 1089−1095. (22) Groß, M.; Kind, M. Bulk Crystallization of Proteins by LowPressure Water Evaporation. Chem. Eng. Technol. 2016, 39, 1483− 1489. (23) Barros Groß, M.; Kind, M. Comparative Study on Seeded and Unseeded Bulk Evaporative Batch Crystallization of Tetragonal Lysozyme. Cryst. Growth Des. 2017, 17, 3491−3501. (24) Barros Groß, M.; Kind, M. From Microscale Phase Screening to Bulk Evaporative Crystallization of Proteins. J. Cryst. Growth 2018, 498, 160−169. (25) Harrison, R. G.; Todd, P.; Rudge, S. R.; Petrides, D. P. Bioseparations Science and Engineering, 2nd ed.; Oxford University Press: Oxford, 2015; pp 479−494. (26) Hummel, W. New Alcohol Dehydrogenases for the Synthesis of Chiral Compounds. In New Enzymes for Organic Synthesis; Scheper, T., Babel, W., Blanch, H. W., Cooney, C. L., Enfors, S.-O., Eriksson, K.-E. L., Fiechter, A., Klibanov, A. M., Mattiasson, B., Primrose, S. B., Rehm, H. J., Rogers, P. L., Sahm, H., Schügerl, K., Tsao, G. T., Venkat, K., Villadsen, J., von Stockar, U., Wandrey, C., Eds.; Springer Berlin Heidelberg: Berlin, Heidelberg, 1997; Advances in Biochemical Engineering/Biotechnology, pp 145−184. (27) Niefind, K.; Müller, J.; Riebel, B.; Hummel, W.; Schomburg, D. The Crystal Structure of R-specific Alcohol Dehydrogenase from Lactobacillus brevis Suggests the Structural Basis of its Metal Dependency. J. Mol. Biol. 2003, 327, 317−328. (28) Schlieben, N. H.; Niefind, K.; Müller, J.; Riebel, B.; Hummel, W.; Schomburg, D. Atomic Resolution Structures of R-specific Alcohol Dehydrogenase from Lactobacillus brevis Provide the Structural Bases of its Substrate and Cosubstrate Specificity. J. Mol. Biol. 2005, 349, 801−813. (29) Bräutigam, S.; Dennewald, D.; Schürmann, M.; Lutje-Spelberg, J.; Pitner, W.-R.; Weuster-Botz, D. Whole-cell Biocatalysis: Evaluation of New Hydrophobic Ionic Liquids for Efficient Asymmetric Reduction of Prochiral Ketones. Enzyme Microb. Technol. 2009, 45, 310−316. (30) Dennewald, D.; Pitner, W.-R.; Weuster-Botz, D. Recycling of the Ionic Liquid Phase in Process Integrated Biphasic Whole-cell Biocatalysis. Process Biochem. 2011, 46, 1132−1137. (31) Hermann, J.; Nowotny, P.; Schrader, T. E.; Biggel, P.; Hekmat, D.; Weuster-Botz, D. Neutron and X-ray Crystal Structures of Lactobacillus brevis Alcohol Dehydrogenase Reveal New Insights into Hydrogen-bonding Pathways. Acta Crystallogr., Sect. F: Struct. Biol. Commun. 2018, 74, 754−764. (32) Zheng, L.; Baumann, U.; Reymond, J.-L. An Efficient One-step Site-directed and Site-saturation Mutagenesis Protocol. Nucleic Acids Res. 2004, 32, No. e115. (33) Gasteiger, E.; Hoogland, C.; Gattiker, A.; Duvaud, S.’e.; Wilkins, M. R.; Appel, R. D.; Bairoch, A. Protein Identification and Analysis Tools on the ExPASy Server. In The Proteomics Protocols Handbook; Walker, J. M., Ed.; Humana Press: Totowa, NJ, 2005; Methods Mol. Biol., pp 571−607. (34) Kabsch, W. Integration, Scaling, Space-group Assignment and Post-refinement. Acta Crystallogr., Sect. D: Biol. Crystallogr. 2010, 66, 133−144. (35) Evans, P. R.; Murshudov, G. N. How Good are My Data and What is the Resolution? Acta Crystallogr., Sect. D: Biol. Crystallogr. 2013, 69, 1204−1214. (36) Winn, M. D.; Ballard, C. C.; Cowtan, K. D.; Dodson, E. J.; Emsley, P.; Evans, P. R.; Keegan, R. M.; Krissinel, E. B.; Leslie, A. G. W.; McCoy, A.; McNicholas, S. J.; Murshudov, G. N.; Pannu, N. S.; Potterton, E. A.; Powell, H. R.; Read, R. J.; Vagin, A.; Wilson, K. S. Overview of the CCP4 Suite and Current Developments. Acta Crystallogr., Sect. D: Biol. Crystallogr. 2011, 67, 235−242. G



Article

(37) McCoy, A. J.; Grosse-Kunstleve, R. W.; Adams, P. D.; Winn, M. D.; Storoni, L. C.; Read, R. J. Phaser Crystallographic Software. J. Appl. Crystallogr. 2007, 40, 658−674. (38) Murshudov, G. N.; Skubák, P.; Lebedev, A. A.; Pannu, N. S.; Steiner, R. A.; Nicholls, R. A.; Winn, M. D.; Long, F.; Vagin, A. A. REFMAC5 for the Refinement of Macromolecular Crystal Structures. Acta Crystallogr., Sect. D: Biol. Crystallogr. 2011, 67, 355−367. (39) Emsley, P.; Lohkamp, B.; Scott, W. G.; Cowtan, K. Features and Development of Coot. Acta Crystallogr., Sect. D: Biol. Crystallogr. 2010, 66, 486−501. (40) Joosten, R. P.; Long, F.; Murshudov, G. N.; Perrakis, A. The PDB_REDO Server for Macromolecular Structure Model Optimization. IUCrJ 2014, 1, 213−220. (41) Chen, R.-Q.; Lu, Q.-Q.; Cheng, Q.-D.; Ao, L.-B.; Zhang, C.-Y.; Hou, H.; Liu, Y.-M.; Li, D.-W.; Yin, D.-C. An ignored variable: Solution Preparation Temperature in Protein Crystallization. Sci. Rep. 2015, 5, 7797.

H


Rational Crystal Contact Engineering of Lactobacillus brevis Alcohol

Recommend Documents