Rational Design of an Auxin Antagonist of the ... - ACS Publications

ACS Chemical Biology

Supplementary Information Rational design of an auxin antagonist of the SCFTIR1 auxin receptor complex Ken-ichiro Hayashi*1, Joshua Neve2, Masakazu Hirose1, Atsuhito Kuboki, Yukihisa Shimada3, Stefan Kepinski2, Hiroshi Nozaki1 1

Department of Biochemistry, Okayama University of Science, Okayama 700-0005, Japan; 2Centre for Plant

Sciences, University of Leeds, Leeds, LS2 9JT, UK, 3RIKEN Plant Science Center, Tsurumi, Yokohama, Kanagawa, 230-0045 Japan.*To whom correspondence should be addressed. Supplemental Figures 1-6. SI-Figure 1 Effects of ligands (1–14) on auxin-responsive DR5::GUS reporter gene expression. SI-Figure 2 Docking study of ligand 14, auxinole (15) and PEO-IAA (16) with TIR1 auxin receptor. SI-Figure 3. Effects of auxinole analogs (23 and 24) on auxin-responsive DR5::GUS reporter gene expression. SI-Figure 4. Effects of auxinole and PEO-IAA on endogenous IAA level in Arabidopsis seedling. SI-Figure 5. The antagonistic effects of auxinole and synthetic auxins, 2,4-D, 1-NAA and picloram on phenotypes of Arabidopsis plant and tomato plants. SI-Figure 6. Amino acid sequences of TIR1 orthologs in Arabidopsis, tomato, corn, the fern Selaginella moellendorffii, the moss Physcomitrella patens and auxin interacting amino acid residues in TIR1 binding site. Supplemental text. 1. The synthesis of ligands (1-4) 2. Synthesis of α-alkyl IAAs (5, 6, 9, 10, 11, 12, 13 and 14) 3. Synthesis of α-alkyl IAAs (7 and 8) 4. Synthesis of PEO-IAA derivatives, ligands (15 – 22). 5. In silico screening and docking study. 6. Analysis of lateral root formation and root gravitropism. 7. Generation of the 35S::FLAG-TIR1 line SI-References.

1


Supplemental Figures SI-Figure 1

SI-Figure 1. Effects of ligands (1–14) on auxin-responsive DR5::GUS reporter gene expression. 5-day old Arabidopsis auxin-responsive DR5::GUS reporter line was incubated in the liquid germination medium(GM) containing ligands with or without 2 μM 1-NAA for 5h. The GUS reporter enzyme activity was analysed histochemically. The seedlings were washed with a GUS-staining buffer (100 mM sodium phosphate, pH 7.0, 10 mM EDTA, 0.5 mM K4Fe(CN)6, 0.5 mM K3Fe(CN)6, and 0.1 % Triton X-100) and transferred to the GUS-staining buffer containing 1mM 5-bromo-4-chloro-3-indolyl β-D-glucuronide (X-Gluc), the substrate for histochemical staining and incubated at 37 °C until sufficient staining developed.

2


SI-Figure 2.

SI-Figure 2. Docking study of ligand 14, auxinole (15) and PEO-IAA (16) with TIR1 auxin receptor. (A) Validation of docking calculation by surflex software. IAA was docked to TIR1 binding site by surflex docking software with exhaustive docking accuracy parameter sets (see surflex manual). The predicted binding pose of top 3-scored poses were visualized as yellow molecules. Red colored IAA molecule was imposed on the coordinates in the crystal structure (PDB ID: 2P1P and 2P1Q). In this calculation condition, the predicted affinity score of IAA was 7.63 (highest scored). (B) α-Phenylethyl-IAA (14) and PEO-IAA (16) was docked into TIR1 auxin binding site by surflex. Seven high-scored conformers of ligand were displayed in binding site. Red colored IAA molecule was imposed from crystal structure (PDB ID: 2P1P). Phe 82 of TIR1 would interact with Phenyl ring of ligand by π−π hydrophobic stacking. The pose number and estimated affinity score (–log Kd) of ligands to TIR1 binding site were listed. (C) Predicted binding pose of PEO-IAA [(R)-form ] and both enantiomers of auxinole by surflex. The Aux/IAA binding cavity of TIR1 is closely packed with the m-xylene ring of auxinole. The affinity score of auxinole were 9.38 (R-form) and 8.99 (S-form). This lower affinity score would be due to the steric hindrance of ligand (Crush Score by surflex [near to zero means less steric hindrance]: R-auxinole, –1.35; R-PEO-IAA, –0.75; S-auxinole, –1.65; S-PEO-IAA, –1.10). 3


SI-Figure 3

SI-Figure 3. Effects of auxinole analogs (23 and 24) on auxin-responsive DR5::GUS reporter gene expression. (A) Chemical structure of auxinole, inactive antagonist, N-propyl auxinole (24) and weak agonist, α-(2-oxopropyl)-IAA (23). (B) . Effects of auxinole analogs (23 and 24) on DR5::GUS reporter gene expression. 5-days old DR5::GUS reporter line was incubated in the liquid germination (GM) medium containing ligands with or without 2 μM of 1-NAA for 5h. The GUS reporter enzyme activity was histochemically analyzed. (C) 5-days old Arabidopsis DR5::GUS seedling grown with 0.2 μM 1-NAA or 20 μM ligand 23. The induced GUS reporter enzyme activity of the root were histochemically stained.

4


SI-Figure 4

SI-Figure 4. Effects of auxinole and PEO-IAA on endogenous IAA level in Arabidopsis seedling. 6-days old Arabidopsis seedling was cultured in liquid GM media for 24 h and then ligands was added at indicated concentration. The seedling was incubated with ligand for 3h then immediately frozen with liquid nitrogen. The endogenous IAA was measured by the LC-MS/MS using the D5-labelled IAA as internal standard The detail of procedure is reported in Soeno K et al. [Plant Cell Physiol. (2010) 51, 524-36].

5


SI-Figure 5

SI-Figure 5. The antagonistic effects of auxinole and synthetic auxins, 2,4-D, 1-NAA and picloram on phenotypes of Arabidopsis plant and tomato plants. (A) Arabidopsis seedlings were grown with auxinole with or without synthetic auxins (2,4-D and 1-NAA) and auxinole on GM media for 7 days under continuous light. (c) 6-day old Arabidopsis seedling grown on GM media with or without 1 μM picloram and auxinole. (c) Effects of auxinole on tomato plant growth. 4-days old tomato seedlings were cultured with auxinole on GM media for another 11 days. (Scale bars = 10 mm).

6


SI-Figure 6.

SI-Figure 6. Amino acid sequences of TIR1 orthologs in Arabidopsis, tomato, corn, the fern Selaginella moellendorffii, the moss Physcomitrella patens and auxin interacting amino acid residues in TIR1 binding site. (A) Arabidopsis TIR1, AFB2, 3, 4 and 5, Solanum lycopersicum [tomato] TIR1a (NCBI protein ID: ACU81102) and TIR1b (NCBI protein ID: ACY26209), Zea may [corn] TIR1a (MaizeCyc: GRMZM2G135978), TIR1b (MaizeCyc: GRMZM2G137451), TIR1c (MaizeCyc: GRMZM2G137451), Selaginella moellendorffii TIR1a (Phytozome ID: 170974), TIR1b (Phytozome ID: 168175), Physcomitrella patens TIR1a (Phytozome ID: Pp1s44_198V6), TIR1b (Phytozome ID: Pp1s16_2V6), TIR1c (Phytozome ID: Pp1s196_87V6), TIR1d (Phytozome ID: Pp1s137_148V6). The amino acid sequences were aligned by ClustalW program (Bootstran NJ method). Representative amino acid residues required for the interaction of auxinole was indicated. (B) 2D interaction map of (R)-auxinole and binding pose of auxinole (R- and S- form) in TIR1 binding site. The interactions between ligand and amino acid residues of TIR1 were predicted by the software Accelrys Discovery Studio Visualizer 3.0. 7


Supplemental text Synthesis of chemicals General experimental condition. 1

H and 13C-NMR spectra were recorded on a Bruker ARX400 (Bruker, Japan). Chemical shifts are shown as δ

values from TMS as the internal reference. Peak multiplicities are quoted in Hz. Mass spectra were measured on a JMS-700 spectrometer (JEOL, Japan). Column chromatography was carried out on columns of silica gel 60 (230–400 mesh, Merck, Japan). All chemicals were purchased from Tokyo Chemical Industry Japan (Tokyo, Japan), Wako Pure Chemical (Tokyo, Japan) and Sigma-Aldrich Japan (Tokyo, Japan) unless otherwise stated. 1. The synthesis of ligands (1-4)

Scheme 1. Reagents and conditions: (a) LDA, HMPA, THF, –78˚C, 1h, (b) 2N NaOH /MeOH, 50˚C, 1h. α-tert-Butoxycarbonyl-6-aminohexyl-indole-1-acetic acid (1) . BH-IAA (1) was synthesized according to the published procedure in (Hayashi et al. 2008) α-tert-Butoxycarbonyl-6-aminohexyl-naptholene-1-acetic acid methyl ester (2a). To the solution of naphthalene 1-acetic acid methyl ester (150 mg, 0.75 mmol) in THF was added hexamethyl phosphoramide (HMPA, 671 mg, 3.75 mmol) and Lithium diisopropylamide (LDA, 1.5M in cyclohexane, 0.75ml, 1 mmol), and the reaction mixture was then stirred for 30 min at –78 ˚C. tert-Butoxycarbonyl-6-aminohexyl iodide (270 mg, 0.82 mmol) in THF (2 mL) was added dropwise to the solution, and then stirred for 1h at –78 ˚C. After warming to 0 ˚C for 15 min, the resulting solution was added to water (50 mL), and extracted with ethyl acetate [EtOAc] (20 mL × 2). The organic layer was washed with saturated NH4Cl solution and brine, and then dried over Na2SO4. The residue was purified by a silica gel column chromatography (hexane:EtOAc=8:2) to give 2a as oil (271 mg, 91% yield): 1H-NMR (400 MHz, CDCl3): δ 8.11 (d, J=8.5Hz, 1H), 7.83 (d, J=8.0Hz, 1H), 7.74 (d, J=8.1Hz, 1H), 7.40 - 7.54 (m, 4H), 4.71 (s, 1H), 4.36 (t, J=7.8Hz, 1H), 3.61 (s, 3H), 3.04 (m, 2H), 2.07 (m, 2H), 1.24 - 1.48 (m, 17H); 13C-NMR (100 MHz, CDCl3): δ 174.7, 155.9, 135.3, 133.8, 131.3, 128.8, 127.5, 126.1, 125.4, 125.3, 124.6, 122.8, 78.7, 51.8, 46.5, 40.3, 32.9, 29.7, 28.9, 28.2, 27.6, 26.3; FAB-MS: m/z 400 [M+H]+ α-tert-Butoxycarbonyl-6-aminohexyl-naptholene-1-acetic acid (2). The methyl ester 2a (100 mg, 0.25 mmol) was dissolved in aqueous methanolic NaOH solution (2N NaOH : 8


MeOH=1:4). The solution was heated at 50 ˚C for 1h. The resulting solution was cooled and acidified to pH 3.5 with 6N HCl. After removal of MeOH in vacuo, the resulting suspension was extracted with ethyl acetate (50 mL × 2). The organic layer was washed successively with saturated NH4Cl solution and brine. After dried over Na2SO4, the solvent was removed in vacuo. The residue was purified by a silica gel column chromatography (CHCl3:MeOH=95:5) to give ligand 2 as a oil (90 mg, 93% yield): 1H-NMR (400 MHz, CDCl3): δ 8.13 (d, J=8.4Hz, 1H), 7.84 (d, J=7.9Hz, 1H), 7.75 (d, J=8.1Hz, 1H), 7.41 - 7.53 (m, 4H), 4.56 (s, 1H), 4.35 (t, J=7.4Hz, 1H), 3.03 (m, 2H), 2.05 (m, 2H), 1.22 - 1.46 (m, 17H); 13C-NMR (100 MHz, CDCl3): δ 179.0, 156.0, 135.1, 133.9, 131.6, 128.9, 127.7, 126.2, 125.5, 125.4, 124.9, 123.1, 79.0, 46.6, 40.4, 32.7, 29.8, 29.0, 28.3, 27.7, 26.4; IR υ max (neat): 3417, 1705, 1457, 1268, 1099 cm-1; FAB-MS: m/z 386 [M+H]+

9


Scheme 2. Reagents and conditions: (a) AcCl, MeOH, rt, 2h (b) Methyl chlorofolmate, tetrabutyl ammonium iodide, CH2Cl2 : 30% NaOH aqueous solution=1:1, 0˚C, 2h, (c) LHMDS, HMPA, tert-Butoxylcarbonylaminohexyl iodide, THF, -78˚C, 2h, and (d) 2N NaOH /MeOH, 70˚C, 1.5h. 5-Fluoroindole 3-acetic acid methyl ester (3c). To the solution of 5-fluoroindole 3-acetic acid (3d: 240

mg, 1.24

mmol) in MeOH (5 mL) was added acetyl

chloride (0.2 mL) and then stirred for 2h at room temperature. The solvent was evaporated in vacuo and then dissolved in EtOAc. The organic layer was washed with an aqueous Na2CO3 and brine, and then dried over Na2SO4. The residue was purified by a silica gel column chromatography (hexane:EtOAc=7:3) to give 3c as a oil (256 mg, 99% yield) : 1H-NMR (400 MHz, CDCl3): δ 8.42 (s, 1H), 7.20 (d, J=9.6Hz, 1H), 6.99 - 7.02 (m, 1H), 6.82 - 6.86 (m, 2H), 3.65 (s, 2H), 3.64 (s, 3H); 13C-NMR (100 MHz, CDCl3): δ 172.8, 158.8, 156.4, 132.5, 127.3, 127.2, 125.1, 112.0, 111.9, 110.2, 109.9, 107.7, 107.6, 103.4, 103.2, 51.8, 30.7; IR υ max (neat): 1739, 1456, 1393, 1269, 1157, 1080 cm-1; EI-MS: m/z 207 [M]+. 5-Fluoro-N-methoxycarbonyl-indole-3-acetic acid methyl ester (3b). To the solution of methyl ester 3c (240 mg, 1.16 mmol) and tetra-n-butylammonium iodide (4 mg, 0.011mmol) in CH2Cl2 (2.5 mL) was added aqueous 30% NaOH (2.5 mL) at 0˚C. Methyl chlorocarbonate (219 mg, 2.32 mmol) was added to the reaction mixture and stirred for 2h at 0˚C. The reaction solution was neutralized with 6N HCl and extracted with CHCl3 (20 mL × 2). The organic layer was washed with saturated NH4Cl solution and brine, and then dried over Na2SO4. The residue was purified by a silica gel column chromatography (hexane:EtOAc=8:2) to give 3b as oil (273

mg, 89% yield) : 1H-NMR (400 MHz, CDCl3): δ 8.10 (s, 1H), 7.62 10


(s, 1H), 7.19 (d, J=8.8Hz, 1H), 7.05 (t, J=9.6Hz, 1H), 4.01 (s, 3H), 3.72 (s, 3H), 3.66 (s, 2H);

13

C-NMR (100

MHz, CDCl3): δ 171, 160.6, 158.2, 151.0, 131.7, 131.0, 130.9, 125.5, 116.2, 116.1, 113.7, 113.6, 112.7, 112.4, 104.9, 104.7, 53.8, 52.2, 30.7; IR υ max (neat): 1739, 1472, 1382, 1264, 1169, 1077 cm-1; EI-MS: m/z 265 [M]+. α-tert-Butoxycarbonyl-6-aminohexyl-5-fluoro-N-methoxycarbonyl-indole-3-acetic acid methyl ester (3a). To the solution of 3b (40 mg, 0.15 mmol) in THF was added hexamethyl phosphoramide (HMPA, 0.13ml, 0.75 mmol) and lithium bis(trimethylsilyl)-amide (LHMDS, 1.0M in THF, 0.23 mL 0.23 mmol), and the reaction mixture was then stirred for 30 min at –78˚C. tert-Butoxycarbonyl-6-aminohexyl iodide (60 mg, 0.18 mmol) in THF (1 mL) was added dropwise to the solution, and then stirred for 1h at –78˚C. After warming to 0 ˚C for 15 min, the resulting solution was added to water (50 mL), and extracted with EtOAc (20 mL × 2). The organic layer was washed with saturated NH4Cl solution and brine, and then dried over Na2SO4. The residue was purified by a silica gel column chromatography (hexane:EtOAc=75:25) to give 3a as oil (65 mg, 94% yield) : 1H-NMR (400 MHz, CDCl3): δ 8.11 (s, 1H), 7.59 (s, 1H), 7.26 - 7.29 (m, 1H), 7.06 (t, J=9.0Hz, 1H), 4.54 (s, 1H), 4.03 (s, 3H), 3.73 (t, J=7.6Hz, 1H), 3.69 (s, 3H), 3.09 (m, 2H), 1.98 (m, 2H), 1.24 - 1.49 (m, 17H);

13

C-NMR (100 MHz,

CDCl3): δ 173.8, 160.5, 158.1, 155.9, 151.2, 131.8, 130.4, 124.5, 119.0, 116.2, 116.1, 112.7, 112.4, 105.3, 105.0, 78.9, 53.8, 52.1, 42.6, 40.4, 31.9, 29.9, 28.9, 28.4, 27.5, 26.5; IR υ max (neat): 3401, 1741, 1451, 1381, 1264, 1166, 1075 cm-1; FAB-MS: m/z 465 [M+H]+. α-tert-Butoxycarbonyl-6-aminohexyl-5-fluoro-indole-3-acetic acid (3). Methyl ester 3a (50 mg, 0.11 mmol) was dissolved in aqueous methanolic NaOH solution (2N NaOH : MeOH=1:4). The solution was heated at 70 ˚C for 0.5h. The resulting solution was cooled and acidified to pH 3.5 with 6N HCl. After removal of MeOH in vacuo, the resulting suspension was extracted with EtOAc (50 mL × 2). The organic layer was washed successively with saturated NH4Cl solution and brine. After dried over Na2SO4, the solvent was removed in vacuo. The residue was purified by a silica gel column chromatography (CHCl3:MeOH=95:5) to give a ligand 3 as pale yellowish paste (38 mg, 90% yield) : 1H-NMR (400 MHz, CDCl3): δ 8.45 (s, 1H), 7.33 (d, J=9.8Hz, 1H), 7.19 - 7.22 (m, 1H), 7.12 (s, 1H), 6.90 (t, J=9.0Hz, 1H), 4.56 (s, 1H), 3.75 (t, J=7.6Hz, 1H), 3.04 (m, 2H), 1.96 (m, 2H), 1.21 - 1.48 (m, 17H);

13

C-NMR (100 MHz, CDCl3):

δ 179.5, 158.9, 156.6, 156.2, 132.7, 126.9, 126.8, 124.1, 113.6, 113.5, 111.9, 111.8, 110.6, 110.3, 104.3, 104.1, 79.3, 42.9, 40.5, 32.1, 29.8, 28.9, 28.4, 27.4, 26.4; IR υ max (neat): 3335, 1699, 1456, 1168 cm-1; FAB-MS: m/z 415 [M+Na]+. 6-Fluoroindole-3-acetic acid methyl ester (4c). Methyl ester 4c was prepared from 6-fluoro-indole-3-acetic acid (4d: 240mg, 1.25 mmol) by same procedure as described in 3c. Methyl ester 4c (oil: 234 mg, 91% yield) : 1H-NMR (400 MHz, CDCl3): δ 8.40 (s, 1H), 7.42 (t, J=6.4Hz, 1H), 6.79 - 6.86 (m, 3H), 3.69 (s, 2H), 3.65 (s, 3H); 13C-NMR (100 MHz, CDCl3): δ 172.9, 160.9, 158.6, 11


136.0, 135.9, 123.6, 123.5, 119.3, 119.1, 108.1, 107.9, 107.7, 97.5, 97.3, 51.8, 30.8; IR υ max (neat): 3364, 1730, 1438, 1255 cm-1; EI-MS: m/z 207 [M]+. 6-Fluoro-N-methoxycarbonyl-indole-3-acetic acid methyl ester (4b). Compound 4b was prepared from 4c (oil: 220mg, 1.06 mmol) by same procedure as described in 3b. Compound 4b (oil: 247 mg, 88% yield): 1H-NMR (400 MHz, CDCl3): δ 7.83 (s, 1H), 7.50 (s, 1H), 7.39 (t, J=6.7Hz, 1H), 6.97 (t, J=8.9Hz, 1H), 3.98 (s, 3H), 3.70 (s, 3H), 3.63 (s, 2H); 13C-NMR (100 MHz, CDCl3): δ 170.9, 162.1, 159.7, 150.8, 135.3, 126.1, 124.0, 119.6, 119.5, 113.5, 111.0, 110.8, 102.4, 102.1, 53.6, 51.9, 30.4; IR υ max (neat): 1743, 1448, 1380, 1267 cm-1; EI-MS: m/z 265 [M]+. α-tert-Butoxycarbonyl-6-aminohexyl-6-fluoro-N-methoxycarbonyl-indole-3-acetic acid methyl ester (4a). Compound 4a was prepared from 4b (40 mg, 0.15 mmol) by same procedure as described in 3a. Compound 4a (oil: 49 mg, 70% yield) : 1H-NMR (400 MHz, CDCl3): δ 7.89 (s, 1H), 7.52 - 7.55 (m, 2H), 7.01 (t, J=8.9Hz, 1H), 4.53 (s, 1H), 4.03 (s, 3H), 3.76 (t, J=7.9Hz, 1H), 3.68 (s, 3H), 3.08 (m, 2H), 1.99 (m, 2H), 1.24 - 1.49 (m, 17H); 13

C-NMR (100 MHz, CDCl3): δ 173.9, 162.3, 159.9, 155.9, 151.0, 136.0, 135.8, 125.7, 123.2, 120.2, 120.1, 119.1,

111.3, 111.1, 102.8, 102.5, 79.0, 53.9, 52.1, 42.6, 40.5, 32.0, 29.9, 28.9, 28.4, 27.5, 26.5; IR υ max (neat): 3401, 1739, 1447, 1378, 1266, 1173 cm-1; FAB-MS: m/z 465 [M+H]+. α-tert-Butoxycarbonyl-6-aminohexyl-6-fluoro-indole-3-acetic acid (4). Ligand 4 was prepared from 4a (40 mg, 0.086mmol) by same procedure as described in 3. Ligand 4 (waxy paste: 32 mg, 93% yield): 1H-NMR (400 MHz, CDCl3): δ 8.44 (s, 1H), 7.58 (t, J=7.0Hz, 1H), 7.06 (s, 1H), 6.99 (d, J=9.6Hz, 1H), 6.86 (t, J=9.2Hz, 1H), 4.56 (s, 1H), 3.80 (t, J=7.6Hz, 1H), 3.05 (m, 2H), 1.98 (m, 2H), 1.14 - 1.49 (m, 17H); 13C-NMR (100 MHz, CDCl3): δ 179.4, 161.1, 158.8, 156.2, 136.2, 136.1, 123.1, 122.6, 122.5, 120.0, 120.0, 113.6, 108.4, 108.2, 97.6, 97.3, 79.3, 42.9, 40.5, 32.2, 29.8, 28.9, 28.4, 27.5, 26.4; IR υ max (neat): 3339, 1699, 1520, 1456, 1167 cm-1; FAB-MS: m/z 393 [M+H]+.

12


2. Synthesis of α-alkyl IAAs (5, 6, 9, 10, 11, 12, 13 and 14)

Scheme 3. Reagents and conditions: (a) AcCl, MeOH, rt, 3h, 96%, (b) Methyl chlorofolmate, tetra-butyl ammonium iodide, CH2Cl2 : 30% NaOH aqueous solution=1:1, 0˚C, 2h, 87%, (c) LDA, HMPA, THF, -78˚C, 1h, (d) 2N NaOH /MeOH,, 70˚C, 0.5h. 2.1. General synthetic procedure of α-alkyl IAAs Starting material, N-methoxycarbonylmethyl-indole-3-acetic acid methyl ester (5b) was synthesized from indole-3-acetic acid (IAA) according to methods described by Katayama et.al. (2004). The alkyl-IAAs were synthesized by essentially same procedures in Hayashi et al. (2008). To the solution of 5b in THF was added lithium diisopropyl amide (1.5 equiv.) and hexamethylphosphoric triamide (5 equiv.), and then stirred for 30 min at -78˚C. The corresponding alkyl iodide, R-I (1.1 equiv.) in THF was added dropwise to the solution, and then stirred for 1h at -78˚C. After warming to 0 ˚C for 15 min, the resulting solution was added to water (100 mL), and extracted with EtOAc (50 mL × 2). The organic layer was washed with saturated NH4Cl solution and brine, and then dried over Na2SO4. The residue was purified by a silica gel column chromatography to give the corresponding α-alkyl-N-methoxycarbonylmethyl-indole-3-acetic acid methyl ester (5a-14a). The methyl ester (5a-14a) was dissolved in aqueous methanolic NaOH solution (2N NaOH : MeOH=1:4). The solution was heated at 70 ˚C for 0.5h. The resulting solution was cooled and acidified to pH 3.5 with 6N HCl. After removal of MeOH in vacuo, the resulting suspension was extracted with EtOAc (50 mL × 2). The organic layer was washed 13


successively with saturated NH4Cl solution and brine. After dried over Na2SO4, the solvent was removed in vacuo. The residue was purified by a silica gel column chromatography to give the corresponding α-alkyl-IAAs (5-14). α-tert-Butoxycarbonyl-4-aminobutyl-N-methoxycarbonyl-indole-3-acetic acid methyl ester (5a) Prepared from α-tert-butoxycarbonyl-4-aminobutyl iodide and indole 5b, and then purified by a silica gel column chromatography (hexane:EtOAc=8:2) to give 5a as oil (373 mg, 75% yield ) as oil: 1H-NMR (400 MHz, CDCl3): δ 8.18 (d, J=7.8Hz, 1H), 7.60 (d, J=7.8Hz, 1H), 7.55 (s, 1H), 7.34 (t, J=7.9Hz, 1H), 7.25 (t, J=7.7Hz, 1H), 4.59 (s, 1H), 4.02 (s, 3H), 3.80 (t, J=7.6Hz, 1H), 3.67 (s, 3H), 3.09 (m, 2H), 2.03 (m, 2H), 1.25 - 1.53 (m, 13H); 13C-NMR (100 MHz, CDCl3): δ 173.9, 155.9, 151.2, 135.5, 129.3, 124.8, 123.0, 122.9, 119.2, 119.1, 115.2, 78.9, 53.6, 52.0, 42.5, 40.2, 31.7, 29.8, 28.3, 24.8; FAB-MS: m/z 419 [M+H]+ . α-tert-Butoxycarbonyl-6-aminobutyl-indole-3-acetic acid (5). Methyl ester 5a (100 mg, 0.24 mmol) was hydrolyzed and purified by a silica gel column chromatography (CHCl3:MeOH=95:5) to give 1 (72 mg, 87% yield) as pale yellowish solid: mp. 61–63°C, 1H-NMR (400 MHz, CDCl3): δ 8.35 (s,1H), 7.67 (d, J=7.8Hz, 1H), 7.28 (d, J=7.8Hz, 1H), 7.15 (t, J=7.7Hz, 1H), 7.09 (t, J=7.3Hz, 1H), 7.00 (s, 1H), 4.57 (s, 1H), 3.81 (t, J=7.5Hz, 1H), 3.02 (m, 2H), 1.97 (m, 2H), 1.23 - 1.48 (m, 13H), 13C-NMR (100 MHz, CDCl3): δ 179.6, 156.1, 136.1, 126.4, 122.3, 122.0, 119.4, 119.1, 113.0, 111.3, 79.3, 42.9, 40.3, 31.9, 29.7, 28.4, 24.8; IR υ max (neat): 3747, 1699, 1520, 1456, 1367, 1250, 1170 cm-1; FAB-MS: m/z 347 [M+H]+ . α-tert-Butoxycarbonyl-2-(2-aminoethoxy)-ethyl-N-methoxycarbonyl-indole-3-acetic acid methyl ester (6a). Prepared from tert-butoxylcarbonylaminoethoxyethyl iodide and indole 5b, and then purified by a silica gel column chromatography (hexane:EtOAc=8:2) to give 6b as oil (165 mg, 79% yield) as oil: 1H-NMR (400 MHz, CDCl3): δ 8.18 (d, J=7.0Hz, 1H), 7.63 (d, J=7.7Hz, 1H), 7.57 (s, 1H), 7.34 (t, J=7.7Hz, 1H), 7.26 (t, J=7.3Hz, 1H), 4.98 (s, 1H), 4.02 - 4.06 (m, 4H), 3.69 (s, 3H), 3.43 - 3.51 (m, 4H), 3.30 (m, 2H), 2.29 (m, 2H), 1.45 (s, 3H); 13

C-NMR (100 MHz, CDCl3): δ 173.8, 155.9, 151.2, 135.4, 129.3, 124.8, 123.1, 122.9, 119.2, 118.8, 115.2, 79.1,

69.8, 68.3, 52.7, 52.1, 40.3, 39.3, 32.2, 28.3; FAB-MS: m/z 435 [M+H]+ . α-tert-Butoxycarbonyl-2-(2-aminoethoxy)-ethyl-indole-3-acetic acid (6). Methyl ester 6a (80 mg, 0.18 mmol) was hydrolyzed and purified by a silica gel column chromatography (CHCl3:MeOH=9:1) to give 6 (70 mg, 87% yield) as an paste: 1H-NMR (400 MHz, CDCl3): δ 8.40 (s, 1H), 7.67 (d, J=7.9Hz, 1H), 7.29 (d, J=8.0Hz, 1H), 7.15 (t, J=7.8Hz, 1H), 7.08 (t, J=7.3Hz, 1H), 7.04 (s, 1H), 5.03 (s,1H), 4.04 (t, J=7.1Hz, 1H), 3.30 - 3.46 (m, 4H), 3.23 (m, 2H), 2.26 (m, 2H), 1.44 (s, 9H);

13

C-NMR (100 MHz,

CDCl3): δ 179.2, 156.2, 136.2, 126.4, 122.6, 122.1, 119.5, 119.1, 112.6, 111.3, 79.4, 69.7, 68.5, 40.3, 39.7, 32.3, 28.4; IR υ max (neat): 3406, 3332, 1699, 1520, 1458, 1367, 1252, 1169, 1119 cm-1; FAB-MS: m/z 385 [M+Na]+ .

14


α-2-(1-Acetyl-piperidin)-ethyl-N-methoxycarbonyl-indole-3-acetic acid methyl ester (9a). Prepared from 1-[4-(2-iodo-ethyl)-piperidin-1-yl]-ethanone and indole (5b), and then purified by a silica gel column chromatography (CHCl3:acetone=9:1) to give 9b (54 mg, 65% yield) as oil: 1H-NMR (400 MHz, CDCl3): δ ; 8.18 (d, J=6.7Hz, 1H), 7.61 (d, J=7.8Hz, 1H), 7.56 (s, 1H), 7.35 (t, J=8.4Hz, 1H), 7.25 - 7.28 (m, 1H), 4.57 (d, J=12.8Hz, 1H), 4.03 (s, 3H), 3.73 - 3.79 (m, 2H), 3.68 (s, 3H), 2.99 (t, J=12.9Hz, 1H), 2.50 (t, J=12.6Hz, 1H), 1.91 - 2.19 (m, 5H), 1.73 (t, J=10.4Hz, 2H), 1.49 (m, 1H), 1.26 - 1.32 (m, 2H), 1.05 - 1.12 (m, 2H); 13C-NMR (100 MHz, CDCl3): δ 173.8, 168.7, 151.2, 135.4, 129.3, 124.8, 122.9, 119.2, 119.1, 115.2, 53.7, 52.1, 46.6, 42.7, 41.7, 35.9, 34.2, 32.5, 31.6, 29.2, 21.4; FAB-MS: m/z 401 [M+H]+ α-2-(1-Acetyl-piperidin)-ethyl-indole-3-acetic acid (9). Methyl ester 9b (48 mg, 0.12 mmol) was hydrolyzed and purified by a silica gel column chromatography (CHCl3:acetone=3:2) to give 9 (26 mg, 65% yield) as pale yellowish solid: mp. 141–143°C: 1H-NMR (400 MHz, CDCl3): δ 8.54 (s, 1H), 7.67 (d, J=7.9Hz, 1H), 7.31 (d, J=8.0Hz, 1H), 7.16 (t, J=7.7Hz, 1H), 7.07 - 7.11 (m, 2H), 4.48 (d, J=12.7Hz, 1H), 3.81 (t, J=7.5Hz, 1H), 3.66 (d, J=13.2Hz, 1H), 2.89 (t, J=12.5Hz, 1H), 2.43 (t, J=12.6Hz, 1H), 1.86 - 2.17 (m, 5H), 1.62 (t, J=16.5Hz, 2H), 1.41 (m, 1H), 1.22 - 1.28 (m, 2H), 0.93 - 1.01 (m, 2H); 13

C-NMR (100 MHz, CDCl3): δ178.8, 169.3, 136.2, 126.5, 122.3, 122.0, 119.5, 119.1, 113.3, 111.4, 46.7, 43.1,

42.0, 35.7, 34.2, 32.5, 31.6, 29.7, 21.3; IR υ max (neat): 3410, 1699, 1454, 1271 cm-1; FAB-MS: m/z 329 [M+H]+ α-1-Cyclopentyl-methyl-N-methoxycarbonyl-indole-3-acetic acid methyl ester (10a). Prepared from cyclopentyl-methyl iodide and indole (5b), and then purified by a silica gel column chromatography (hexane:EtOAc=13:1) to give 10a (153 mg, 76% yield) as oil: 1H-NMR (400 MHz, CDCl3): δ 8.18 (d, J=6.0Hz, 1H), 7.63 (d, J=7.8Hz, 1H), 7.57 (s, 1H), 7.32 (t, J=7.4Hz, 1H), 7.25 (t, J=7.4Hz, 1H), 3.99 (s, 3H), 3.88 (t, J=7.7Hz, 1H), 3.67 (s, 3H), 2.05 (m, 2H), 1.76 - 1.79 (m, 3H), 1.59 - 1.62 (m, 2H), 1.47 - 1.50 (m, 2H), 1.12 - 1.17 (m, 2H); 13C-NMR (100 MHz, CDCl3): δ 174.1, 151.1, 135.4, 129.4, 124.6, 122.8, 119.4, 119.2, 115.1, 53.6, 51.9, 41.7, 38.5, 37.9, 32.5, 32.3, 24.9; EI-MS: m/z 329 [M]+ α-1-Cyclopentyl-methyl-indole-3-acetic acid (10). Methyl ester 10a (100 mg, 0.30 mmol) was hydrolyzed and purified by silica gel column chromatography (CHCl3:MeOH=95:5) to give 10 (58 mg, 75% yield) as powder: mp. 133–135°C: 1H-NMR (400 MHz, acetone-d6): δ 10.13 (s, 1H), 7.70 (d, J=7.8Hz, 1H), 7.38 (d, J=8.1Hz, 1H), 7.28 (s, 1H), 7.10 (t, J=8.0Hz, 1H), 7.02 (t, J=7.1Hz, 1H), 3.73 (t, J=7.7Hz, 1H), 2.06 (m, 2H), 1.78 - 1.83 (m, 3H), 1.47 - 1.61 (m, 4H), 1.17 - 1.20 (m, 2H); 13C-NMR (100 MHz, acetone-d6): δ 175.8, 137.3, 127.4, 123.1, 121.8, 119.5, 119.2, 114.1, 111.9, 42.4, 39.6, 38.7, 32.9, 25.3; IR υ max (neat): 3418, 1699, 1456, 1339, 1097 cm-1; FAB-MS: m/z 258 [M+H]+ α-2-Ethyl-butyl-N-methoxycarbonyl-indole-3-acetic acid methyl ester (11a). 15


Prepared from 2-Ethyl-butyl iodide (86 mg, 0.41 mmol) and indole (5b), and then purified by a silica gel column chromatography (hexane:EtOAc=9:1) to give 11a (104 mg, 78% yield) as oil : 1H-NMR (400 MHz, CDCl3): δ 8.18 (d, J=7.0Hz, 1H), 7.64 (d, J=7.8Hz, 1H), 7.57 (s, 1H), 7.34 (t, J=7.7Hz, 1H), 7.26 (t, J=7.4Hz, 1H), 4.01 (s, 3H), 3.93 (t, J=7.8Hz, 1H), 3.67 (s, 3H), 1.96 (m, 2H), 1.21 - 1.41 (m, 5H), 0.82 - 0.88 (t, 6H); 13C-NMR (100 MHz, CDCl3): δ 174.3, 151.3, 135.5, 129.5, 124.7, 122.9, 119.7, 119.3, 115.2, 53.7, 52.0, 40.4, 38.0, 35.6, 25.1, 24.9, 10.4; IR υ max (neat): 1738, 1455, 1377, 1256, 1164, 1085 cm-1; EI-MS: m/z 331 [M]+ α-2-Ethyl-butyl-indole-3-acetic acid (11). Methyl ester 11a (70 mg, 0.21 mmol) was hydrolyzed and purified by a silica gel column chromatography (CHCl3:MeOH=95:5) to give 11 (53 mg, 96% yield) as powder: mp. 81–84°C: 1H-NMR (400 MHz, CDCl3): δ 8.02 (s, 1H), 7.70 (d, J=7.9Hz, 1H), 7.30 (d, J=8.0Hz, 1H), 7.17 (t, J=7.9Hz, 1H), 7.11 (t, J=7.5Hz, 1H), 7.08 (s, 1H), 3.97 (t, J=7.8Hz, 1H), 1.96 (m, 2H), 1.23 - 1.39 (m, 5H), 0.78 - 0.84 (t, 6H); 13C-NMR (100 MHz, CDCl3): δ 181.1, 136.1, 126.6, 122.2, 122.2, 119.7, 119.3, 113.7, 111.2, 40.6, 37.8, 35.9, 25.0, 10.4; IR υ max (neat): 3414, 1703, 1458, 1293, 1098 cm-1; FAB-MS: m/z 260 [M+H]+ α-4-Methyl-pentyl-N-methoxycarbonyl-indole-3-acetic acid methyl ester (12a). Prepared from 4-methyl-pentyl iodide (86 mg, 0.41 mmol) and indole (5b), and then purified by a silica gel column chromatography (hexane:EtOAc=95:5) to give 12a (113 mg, 84% yield) as oil: 1H-NMR (400 MHz, CDCl3): δ 8.18 (d, J=6.8Hz, 1H), 7.62 (d, J=7.8Hz, 1H), 7.56 (s, 1H), 7.33 (t, J=7.8Hz, 1H), 7.25 (t, J=7.5Hz, 1H), 4.01 (s, 1H), 3.82 (t, J=7.7Hz, 1H), 3.68 (s, 3H), 2.01 (m, 2H), 1.52 (m, 1H), 1.30 - 1.37 (m, 2H), 1.20 - 1.25 (m, 2H), 0.83 - 0.86 (m, 6H); 13C-NMR (100 MHz, CDCl3): δ 174.1, 151.3, 135.5, 129.5, 124.7, 122.9, 119.5, 119.3, 115.2, 53.6, 51.9, 42.6, 38.5, 32.4, 27.7, 25.4, 22.5; IR υ max (neat): 1739, 1456, 1377, 1256, 1165, 1086 cm-1; EI-MS: m/z 331 [M]+ α-4-Methyl-pentyl-indole-3-acetic acid (12). Methyl ester 12a (70 mg, 0.21 mmol) was hydrolyzed and purified by a silica gel column chromatography (CHCl3:MeOH=95:5) to give 12 (50 mg, 91% yield) as oil: 1H-NMR (400 MHz, CDCl3): δ 8.04 (s, 1H), 7.69 (d, J=7.9Hz, 1H), 7.29 (d, J=8.1Hz, 1H), 7.17 (t, J=7.6Hz, 1H), 7.10 (t, J=7.2Hz, 1H), 7.06 (s, 1H), 3.86 (t, J=7.5Hz, 1H), 1.99 (m, 2H), 1.49 (m, 1H), 1.16 - 1.36 (m, 4H), 0.80 - 0.83 (m, 6H); 13C-NMR (100 MHz, CDCl3): δ 180.9, 136.1, 126.5, 122.2, 122.2, 119.6, 119.2, 113.4, 111.2, 42.9, 38.6, 32.6, 27.7, 25.5, 22.5; IR υ max (neat): 3417, 1699, 1457, 1338 cm-1; FAB-MS: m/z 260 [M+H]+ α-2-Cyclopentyl-ethyl-N-methoxycarbonyl-indole-3-acetic acid methyl ester (13a). Prepared from cyclopentylethyl iodide (204 mg, 0.91 mmol) and indole (5b), and then purified by a silica gel column chromatography (hexane:EtOAc=95:5) to give 13a (151 mg, 72% yield) as oil: 1H-NMR (400 MHz, 16


CDCl3): δ 8.18 (d, J=6.8Hz, 1H), 7.62 (d, J=7.7Hz, 1H), 7.56 (s, 1H), 7.34 (t, J=7.4Hz, 1H), 7.26 (t, J=7.3Hz, 1H), 4.02 (s, 3H), 3.79 (t, J=7.6Hz, 1H), 3.68 (s, 3H), 2.03 (m, 2H), 1.73 - 1.77 (m, 3H), 1.48 - 1.58 (m, 4H), 1.34 (q, J=7.2Hz, 2H), 1.04 - 1.07 (m, 2H); 13C-NMR (100 MHz, CDCl3): δ 174.2, 151.3, 135.5, 129.5, 124.7, 122.9, 119.5, 119.3, 115.2, 53.7, 52.0, 42.8, 39.9, 34.1, 32.6, 32.5, 31.4, 25.1; EI-MS: m/z 343 [M]+ α-2-Cyclopentyl-ethyl-indole-3-acetic acid (13). Methyl ester 13a (100 mg, 0.29 mmol) was hydrolyzed and purified by a silica gel column chromatography (CHCl3:MeOH=95:5) to give 13 (79 mg, 99% yield) as an oil: 1H-NMR (400 MHz, CDCl3): δ 8.19 (s, 1H), 7.69 (d, J=7.9Hz, 1H), 7.29 (d, J=8.0Hz, 1H), 7.16 (t, J=8.0Hz, 1H), 7.10 (t, J=7.5Hz, 1H), 7.06 (s, 1H), 3.83 (t, J=7.6Hz, 1H), 2.01 (m, 2H), 1.70 - 1.75 (m, 3H), 1.45 - 1.55 (m, 4H), 1.34 - 1.37 (m, 2H), 0.98 - 1.03 (m, 2H); 13

C-NMR (100 MHz, CDCl3): δ 180.7, 136.1, 126.5, 122.2, 122.0, 119.5, 119.2, 113.4, 111.2, 43.1, 39.9, 34.1,

32.5, 31.6, 25.1; IR υ max (neat): 3415, 1703, 1457, 1339, 1098 cm-1; FAB-MS: m/z 294 [M+Na]+ α-2-Phenyl-ethyl-N-methoxycarbonyl-indole-3-acetic acid methyl ester (14a). Prepared from phenylethyl bromide (292 mg, 1.58 mmol) and indole (3a), and then purified by a silica gel column chromatography (benzene) to give 14a (228 mg, 54% yield) as oil : 1H-NMR (400 MHz, CDCl3): δ 8.18 (d, J=6.0Hz, 1H), 7.57 (s, 1H), 7.55 (d, J=8.0Hz, 1H), 7.31 (t, J=7.8Hz, 1H), 7.13 - 7.26 (m, 6H), 3.94 (s, 3H), 3.83 (t, J=7.5Hz, 1H), 3.64 (s, 3H), 2.66 (t, J=7.8Hz, 2H), 2.35 (m, 2H); 13C-NMR (100 MHz, CDCl3): δ 173.8, 151.2, 140.9, 135.4, 129.3, 128.4, 128.3, 126.0, 124.8, 123.1, 122.9, 119.3, 119.0, 115.2, 53.7, 52.0, 41.8, 33.5; EI-MS: m/z 351 [M]+ α-2-Phenyl-ethyl-indole-3-acetic acid (14). Methyl ester 14a (150 mg, 0.43 mmol) was hydrolyzed and purified by a silica gel column chromatography (CHCl3:MeOH=95:5) to give 14 (85.3mg, 72% yield) as pale yellowish solid: mp. 141–143°C, 1H-NMR (400 MHz, acetone-d6): δ 10.16 (s, 1H), 7.67 (d, J=8.0Hz, 1H), 7.40 (d, J=8.1Hz, 1H), 7.09 - 7.32 (m, 7H), 7.03 (t, J=7.6Hz, 1H), 3.93 (t, J=7.4Hz, 1H), 2.67 (t, J=5.4Hz, 2H), 2.35 (m, 2H); 13C-NMR (100 MHz, acetone-d6): δ 175.4, 142.4, 137.2, 128.8, 128.7, 127.2, 126.2, 123.2, 121.8, 119.4, 119.2, 113.6, 111.8, 42.5, 34.9, 34.1; IR υ max (neat): 3416, 1700, 1457, 1246, 1098 cm-1; FAB-MS: m/z 280 [M+H]+

17


3. Synthesis of α-alkyl IAAs (7 and 8)

Scheme 4. Reagents and conditions: (a) TFA, rt, 5 min, (b)DCCD, DMAP, N-hydroxysuccinimide, N-acetyl-L-proline, THF, rt, 7h (c) NaOH in H2O/MeOH, 70˚C, 0.5h. α-4-Aminobutyl-N-methoxycarbonyl-indole-3-acetic acid methyl ester (7b). Compound 5a (200 mg, 0.48 mmol) was treated with trifluoroacetic acid (0.4 mL) at room temperature for 5 min. The reaction mixture was carefully poured into aqueous 1M sodium carbonate and then extracted with EtOAc. The EtOAc layer was washed with brine, and then dried over Na2SO4. The amine 7b was used without further purification for successive reaction. α−4-[(1-Acetyl-pyrrolidine-2-carbonyl)-amino]-butyl-N-methoxycarbonyl-indole-3-acetic acid methyl ester (7a). To the amine 7b (150 mg, 0.48 mmol) in 3mL of THF, N-hydroxysuccinimide (85 mg,0.74 mmol), dicyclohexyl carbodiimide (152 mg, 0.74 mmol), 4-dimethylamino pyridine (72 mg, 0.59 mmol) was added and then stirred for 30 min.

N-Acetyl-L-proline (116 mg, 0.74 mmol) was added to the reaction mixture then stirred for 7 h at room

temperature. Saturated aqueous NH4Cl was added to the reaction mixture, and extracted with EtOAc. The organic layer was washed with brine and dried over Na2SO4. After the evaporation, the residue was purified by a silica gel 18


column chromatography (CHCl3:acetone=7:3) to yield 7a (107 mg, 49% yield) as oil: 1H-NMR (400 MHz, CDCl3): δ 8.17 (d, J=7.1Hz, 1H), 7.61 (d, J=7.7Hz, 1H), 7.55 (s, 1H), 7.33 (t, J=7.8Hz, 1H), 7.25 (t, J=7.4Hz, 1H), 7.18 (s, 1H), 4.50 (d, J=7.3Hz, 1H), 4.02 (s, 3H), 3.80 (t, J=7.6Hz, 1H), 3.67 (s, 3H), 3.36 - 3.58 (m, 2H), 3.10 - 3.26 (m, 2H), 1.76 - 2.40 (m, 9H), 1.49 - 1.56 (m, 2H), 1.33 - 1.38 (m, 2H); 13C-NMR (100 MHz, CDCl3): δ 173.8, 171, 170.8, 151.1, 135.3, 129.2, 124.6, 122.9, 122.8, 119.2, 119.1, 115.0, 59.4, 53.6, 51.9, 48.1, 42.3, 38.9, 31.5, 29.0, 27.2, 24.8, 24.7, 22.3; FAB-MS: m/z 458 [M+H]+ α−4-[(1-Acetyl-pyrrolidine-2-carbonyl)-amino]-butyl-indole-3-acetic acid (7). The methyl ester 7a (80 mg, 0.18 mmol) was dissolved in aqueous methanolic NaOH solution (2N NaOH : MeOH=1:4). The solution was heated at 70 ˚C for 0.5h. The resulting solution was cooled and acidified to pH 3.5 with 6N HCl. After removal of MeOH in vacuo, the resulting suspension was extracted with EtOAc (50 mL × 2). The organic layer was washed successively with saturated NH4Cl solution and brine. After dried over Na2SO4, the solvent was removed in vacuo. The residue was purified by a silica gel column chromatography (CHCl3:MeOH=9:1) to give ligand 7 (64 mg, 94% yield) as a paste: 1H-NMR (400 MHz, acetone-d6): δ 10.21 (s, 1H), 8.03 (s, 1H), 7.70 (d, J=7.8Hz, 1H), 7.38 (d, J=8.0Hz, 1H), 7.27 (s, 1H), 7.09 (t, J=7.3Hz, 1H), 7.01 (t, J=7.6Hz, 1H), 4.35 (d, J=7.2Hz, 1H), 3.85 (t, J=7.6Hz, 1H), 3.53 (m, 1H), 3.40 - 3.46 (m, 1H), 3.23 (m, 1H), 3.10 - 3.17 (m, 1H), 1.85 - 2.14 (m, 9H), 1.36 - 1.50 (m, 4H); 13C-NMR (100 MHz, acetone-d6): δ 175.8, 172.1, 170.3, 137.3, 127.5, 123.3, 121.9, 119.7, 119.3, 114.1, 112.0, 60.5, 48.3, 43.3, 39.2, 32.9, 32.5, 25.4, 25.1, 22.2; IR υ max (neat): 3300, 1634, 1456, 1245 cm-1; FAB-MS: m/z 386 [M+H]+ 3-[3-(2-Amino-ethoxy)-1-methoxycarbonyl-propyl]-indole-1-carboxylic acid methyl ester (8b) Compound 6a (150 mg, 0.36 mmol) with trifluoroacetic acid (0.4 mL) at room temperature for 5 min. The reaction mixture was carefully poured into aqueous 1M sodium carbonate and then extracted with EtOAc. The EtOAc layer was washed with brine, and then dried over Na2SO4. The amine 8b was used without further purification for successive reaction. α-2-{2-[(1-Acetyl-pyrrolidine-2-carbonyl)-amino]-ethoxy}-ethyl-N-methoxycarbonyl-indole-3-acetic acid methyl ester (8a). To the amine 8b (80 mg, 0.24 mmol) in 3mL of THF, N-hydroxysuccinimide (41 mg, 0.36 mmol), dicyclohexyl carbodiimide (74 mg, 0.36 mmol), 4-dimethylamino pyridine (35 mg, 0.29 mmol) was added and then stirred for 30 min. N-Acetyl-L-proline (56 mg, 0.36 mmol) was added to the reaction mixture then stirred for 7 h at room temperature. Saturated aqueous NH4Cl was added to the reaction mixture, and extracted with EtOAc. The organic layer was washed with brine and dried over Na2SO4. After the evaporation, the residue was purified by a silica gel column chromatography (CHCl3:acetone=3:2) to yield 8a (76 mg, 67% yield) as oil: 1H-NMR (400 MHz, CDCl3): δ 8.18 (d, J=7.1Hz, 1H), 7.57 - 7.66 (m, 2H), 7.35 (t, J=7.7Hz, 1H), 7.25 - 7.28 (m, 2H), 4.56 (t, 19


J=8.3Hz, 1H), 4.09 (t, J=7.6Hz, 1H), 4.03 (s, 3H), 3.68 (s, 3H), 3.59 (t, J=9.0Hz, 1H), 3.32 - 3.52 (m, 7H), 2.36 2.48 (m, 2H), 1.84 - 2.18 (m, 7H); 13C-NMR (100 MHz, CDCl3): δ 174.2, 171.5, 170.8, 151.5, 135.5, 129.3, 124.8, 123.1, 123, 119.4, 118.9, 115.2, 69.4, 68.4, 59.7, 53.8, 52.2, 48.2, 39.5, 39.2, 32.2, 27.8, 25.0, 22.5; FAB-MS: m/z 474 [M+H]+. α-2-{2-[(1-Acetyl-pyrrolidine-2-carbonyl)-amino]-ethoxy}-ethyl-indole-3-acetic acid (8). The methyl ester 8b (60 mg, 0.13 mmol) was dissolved in aqueous methanolic NaOH solution (2N NaOH : MeOH=1:4). The solution was heated at 70 ˚C for 0.5h. The resulting solution was cooled and acidified to pH 3.5 with 6N HCl. After removal of MeOH in vacuo, the resulting suspension was extracted with EtOAc (40 mL × 2). The organic layer was washed successively with saturated NH4Cl solution and brine. After dried over Na2SO4, the solvent was removed in vacuo. The residue was purified by a silica gel column chromatography (CHCl3:MeOH=9:1) to give ligand 8 (37 mg, 72% yield) as a paste: 1H-NMR (400 MHz, CDCl3): δ 8.48 (d, J=13.4Hz, 1H), 7.70 (t, J=7.9Hz, 1H), 7.34 (d, J=8.1Hz, 1H), 7.09 - 7.21 (m, 3H), 4.67 (t, J=8.3Hz, 1H), 4.04 4.11 (m, 1H), 3.18 - 3.76 (m, 8H), 2.46 - 2.67 (m, 4H), 1.86 - 2.22 (m, 7H); 13C-NMR (100 MHz, CDCl3): δ 178.0, 171.6, 171.2, 136.1, 126.5, 122.3, 122.0, 119.4, 118.9, 113.7, 111.2, 69.3, 68.6, 60.0, 48.5, 41.2, 39.9, 33.7, 29.1, 24.8, 22.3; IR υ max (neat): 3317, 1634, 1456, 1247, 1119 cm-1; FAB-MS: m/z 402 [M+H]+

20


4. Synthesis of PEO-IAA derivatives, ligands (15 – 22).

Scheme 5. Reagents and conditions: (a) AlCl3, CH2Cl2, rt, 4h (b) benzene, reflux, 6h. General procedures for the synthesis of ligands (15 -22) The ligands (15 - 22) were synthesized by the nucleophilic addition of indole to arylkotoacrylic acid, essentially same procedures described in (Abubshait SA, 2007). Briefly, equal mole of indole and acrylic acid was refluxed in benzene. For the synthesis of the acrylic acids (15a–22a), aluminum chloride (2.7 g, 20 mmol) was slowly added to the solution of maleic anhydride (0.98 g, 10 mmol) and phenyl compounds (15–22b, 10 mmol) in CH2Cl2 (40 mL) and then stirred for 4h at room temperature. The reaction mixture was poured into the 1N HCl (100 mL) and then extracted with ethyl acetate (100 mL). The organic layer was washed with saturated NH4Cl solution and brine, and then dried over Na2SO4. The residue was recrystallized from benzene to give acrylic acids (15a–22a). For the synthesis of ligands (15–22), equal mole of acrylic acids (15a–22a) and indole was refluxed in benzene for 6h and evaporated after reaction. The residue was purified by silica gel column chromatography. PEO-IAA (16) [6266-66-6] and (21) [86445-20-7] were prepared by same procedures as described in (Abubshait SA, 2007). trans-4-(2,4-dimethyl-phenyl)-4-oxo-but-2-enoic acid (15a) [22660-11-3]. 15a: yellow needles (77 % yield): mp. 86–88 °C; 1H-NMR (400 MHz, CDCl3) δ 7.75 (d, J=15.6 Hz, 1H), 7.56 (d, J=8.2 Hz, 1H), 7.10 (m, 2H), 6.70 (d, J=15.6 Hz, 1H), 2.50 (s, 3H), 2.38 (s, 3H); 13C-NMR (100 MHz, CDCl3) δ 192.5, 170.9, 143.1, 141.7, 139.5, 133.6, 133.0, 130.9, 130.0, 126.4, 21.5 21.2; IR υ max (neat): 2986, 1703, 1667 cm-1; FAB-MS m/z 205 [M+H]+.

21


4-(2,4-Dimethyl-phenyl)-2-(1H-indol-3-yl)-4-oxo-butyric acid: auxinole (15). Purified by a silica gel column chromatography (CHCl3:MeOH= 20: 1) to give 15 (62 % yield) as white powder: mp 179-183 °C; 1H-NMR (DMSO-d6) δ 7.79 (d, J=7.8 Hz, 1H), 7.65 (d, J=7.8 Hz, 1H), 7.36 (d, J=8.2 Hz, 1H), 7.31 (d, J=2.3 Hz, 1H), 7.10 (m, 3H), 7.00 (td, J=7.3, 1.0 Hz, 1H), 4.32 (dd, J=10.6, 3.9 Hz, 1H), 3.89 (dd, J=17.9, 10.6 Hz, 1H), 3.23 (dd, J=17.9, 3.9 Hz, 1H), 2.37 (s, 3H), 2.31 (s, 3H); 13C-NMR (100 MHz, DMSO-d6) δ 201.9, 175.0 , 141.6, 137.6, 136.4, 134.9, 132.5, 129.4, 136.6, 123.4, 123.4, 121.3, 119.2, 118.8,

112.0,

111.71 , 43.8, 38.2, 21.1, 21.1; IR υ max (neat): 3428, 2923, 1707 cm-1; FAB-MS m/z 322 [M+H]+, HRFAB-MS found m/z 322.1422 [M+H]+, calcd. 322.1443 for C20H20NO3. trans-4-oxo-4-p-tolyl-but-2-enoic acid (17a) [24849-45-4]. 17a: yellow needles (yield 85%): mp. 120–123 °C; 1H-NMR (400 MHz, CDCl3) δ 8.00 (d, J=15.5 Hz, 1H), 7.92 (d, J=8.1 Hz, 2H),7.33 (d, J=8.1 Hz, 2H), 6.89 (d, J=15.5 Hz, 1H), 2.45 (s, 3H); 13C-NMR (100 MHz, CDCl3) δ 188.8, 170.2, 145.2, 138.5, 133.5, 131.1, 129.7, 129.1, 21.8; FAB-MS m/z 191 [M+H]+. 2-(1H-Indol-3-yl)-4-oxo-4-p-tolyl-butyric acid (17) [54104-21-1]. Purified by silica gel column chromatography (CHCl3 MeOH= 20: 1) to give 17 (yield 74 %) as amorphous solid: mp. 195–197 °C; 1H-NMR (400 MHz, DMSO-d6) δ 7.94(d, J=8.2 Hz, 2H), 7.68(d, J=7.9 Hz, 1H), 7.36(m, 4H), 7.09(td, J=7.8, 0.7 Hz , 1H), 7.01(dt, J=7.8, 0.7 Hz, 1H), 4.34 (dd, J=10.6, 3.9 Hz, 1H), 4.01(dd, J=18.1, 10.6 Hz, 1H), 3.30(dd, J=18.1, 3.9 Hz, 1H), 2.38(s,3H); 13C-NMR (100 MHz, DMSO-d6) δ 198.8, 175.7, 144.5, 137.2, 134.9, 130.2, 129.0, 127.2, 124.1, 122.1, 120.0, 119.5, 112.9, 112.4, 42.0, 38.6, 22.1; HRFAB-MS found m/z 308.1266 [M+H]+, calcd. 308.1287 for C19H18NO3. trans-4-(2,5-dimethyl-phenyl)-4-oxo-but-2-enoic acid (18a) [5394-59-2]. 18a: needles (yield 43%): mp. 56–58 °C; 1H-NMR (400 MHz, CDCl3) δ 7.70 (d, J=15.7 Hz, 1H), 7.39 (s, 1H), 7.25 (d, J=8.4 Hz,1H), 7.18 (d, J=8.4 Hz, 1H), 6.69 (d, J=15.7 Hz, 1H), 2.45 (s, 3H), 2.37 (s, 3H);13C-NMR(100 MHz, CDCl3) δ 193.5, 170.4, 141.7, 136.4, 135.6, 135.4, 132.9, 131.9, 131.2, 129.8, 20.8, 20.4; IR υ max (neat): 2983, 1711, 1673 cm-1; FAB-MS m/z 205 [M+H]+. 4-(2,5-dimethyl-phenyl)-2-(1H-indol-3-yl)-4-oxo-butyric acid (18) Purified by silica gel column chromatography (CHCl3 MeOH= 20: 1) to give 18 (yield 49 %): mp. 175–177 °C; 1

H-NMR (400 MHz, DMSO-d6) δ 7.66 (s, 1H), 7.38 (m, 1H), 7.37 (d, J=3.1 Hz, 1H), 7.32 (d, J=3.1 Hz, 1H),

7.24 (dd, J=7.6, 0.6 Hz, 1H), 7.17 (d, J=7.7 Hz, 1H), 7.09 (td, J=7.1, 0.6 Hz, 1H), 7.00 (t, J=7.5 Hz, 1H), 4.32 (dd, J=10.6, 4.1 Hz, 1H), 3.87 (dd, J=17.9, 10.6 Hz, 1H), 3.26 (dd, J=17.9, 4.1 Hz, 1H), 2.32 (s, 3H), 2.31 (s, 3H); 13C-NMR (100MHz, DMSO-d6) δ 202.6, 174.8, 137.6, 136.3, 135.0, 131.8, 131.5, 129.1, 128.3, 126.2, 123.2, 121.2, 119.0, 118.6, 111.8, 111.5, 44.0, 38.0, 20.4, 20.2; IR υ max (neat): 3415, 2923, 1694 cm-1; 22


HRFAB-MS found m/z 322.1435 [M+H]+, calcd. 322.1443 for C20H20NO3. trans-4-(4-fluoro-phenyl)-4-oxo-but-2-enoic acid (19a) [777-15-1]. 19a: needles (0.57 g, yield 56%): mp. 115–119 °C ; 1H-NMR (400 MHz, CDCl3) δ 8.06 (m, 2H), 7.98 (d, J=15.4 Hz, 1H), 7.21 (m, 2H), 6.90 (d, J=15.4 Hz, 1H); 13C-NMR (100 MHz, CDCl3) δ 187.5, 170.7, 166.3 (d, JC-F= 255.5 Hz), 138.0, 132.8 (d, JC-F=3.2 Hz), 131.7 (d, JC-F=9.9 Hz), 131.6, 116.2 (d, JC-F=22.1 Hz); IR υ max (neat): 2972, 1705, 1665 cm-1; FAB-MS m/z 195 [M+H]+. 4-(4-Fluoro-phenyl)-2-(1H-indol-3-yl)-4-oxo-butyric acid (19) Purified by a silica gel column chromatography (CHCl3 MeOH= 20: 1) to give 19 (yield 47 %): mp. 162–166 °C; 1

H-NMR (400 MHz, DMSO-d6) δ 8.13 (m, 2H), 7.68 (d, J=7.9 Hz, 1H), 7.35 (m, 4H), 7.09 (t, J=7.2 Hz, 1H),

7.00 (t, J=7.1 Hz, 1H), 4.34 (dd, J=10.7 3.9 Hz, 1H), 4.03 (dd, J=18.1, 10.7 Hz, 1H), 3.34 (dd, J=18.1 3.9 Hz, 1H); 13C-NMR (100 MHz, DMSO-d6) δ 198.0, 175.6, 166.0(d, JC-F=250 Hz), 137.2 134.1, 131.93 (d, JC-F=10 Hz), 127.2, 124.2, 122.1, 120.0, 119.5, 116.6 (d, JC-F=22 Hz), 112.8, 112.4, 42.0, 38.6; IR υ max (neat): 3419, 2925, 1679 cm-1; HRFAB-MS found m/z 312.1028 [M+H]+, calcd for 312.1036 for C18H15FNO3. trans-4-(2,4-Difluoro-phenyl)-4-oxo-but-2-enoic acid (20a) [83844-25-1]. 20a: needles (yield 56%): mp. 125–128 °C; 1H-NMR (400 MHz, acetone-d6) δ 7.98 (m, 1H), 7.71 (dd, JH-F=15.6, 3.4, 1H), 7.23 (m, 2H), 6.75 (dd, JH-F=15.6, 1.2 Hz, 1H); 13C-NMR (100 MHz, acetone-d6) δ 187.2 (d, JC-F=3 Hz), 166.9 (dd, JC-F=254, 12 Hz), 166.4, 163.4 (dd, JC-F=254, 13 Hz), 140.0 (d, JC-F=6 Hz), 134.0 (dd, JC-F=11, 4 Hz) 133.0 (d, JC-F=2 Hz) , 123.3 (dd, JC-F=13, 4 Hz), 113.4 (dd, JC-F=222, 4 Hz), 105.8 (dd, JC-F=27, 26 Hz); IR υ max (neat): 2917, 1697, 1661cm-1; FAB-MS m/z 213 [M+H]+ . 4-(2,4-Difluoro-phenyl)-2-(1H-indol-3-yl)-4-oxo-butyric acid. (20) Purified by silica gel column chromatography (CHCl3: MeOH= 20: 1) to give 20 (yield 51 %): mp. 180–184 °C; 1

H-NMR (400 MHz, DMSO-d6) δ 7.98 (m, 1H), 7.65 (d, J=7.9 Hz, 1H), 7.37 (d, J=8.1 Hz, 1H), 7.42 (m, 1H),

7.28 (d, J=2.3 Hz, 1H), 7.24 (m, 1H), 7.09 (t, J=7.1 Hz, 1H), 7.01 (t, J=7.5 Hz, 1H), 4.34 (dd, J=10.5, 3.5 Hz, 1H), 3.90 (m 1H), 3.30 (m, 1H); 13C-NMR (100 MHz, DMSO-d6) δ 195.2 (d, JC-F=4 Hz), 174.8, 165.2 (d, JC-F=253, 14 Hz), 162.2 (d, JC-F=256, 13 Hz), 136.4, 132.7 (dd, JC-F=11, 4 Hz), 126.3, 123.3, 122.2 (dd, JC-F=12, 4 Hz), 121.4, 119.1, 118.8, 112.6 (dd, JC-F=21, 4 Hz), 111.9, 111.8, 105.4 (d, JC-F=26 Hz), 45.6 (d, JC-F=6 Hz), 37.9; IR υ max (neat): 3382, 2919, 1678 cm-1; HRFAB-MS found m/z 330.0910 [M+H]+, calcd for 330.0942 for C18H14F2NO3. trans-4-Oxo-4-(4-propyl-phenyl)-but-2-enoic acid (22a) [32170-40-4]. 22: needles (yield 92%): mp. 81–84 °C ; 1H-NMR (400 MHz, CDCl3) δ 8.01 (d, J=15.6 Hz, 1H), 7.94 (d, J=7.8 23


Hz, 2H), 7.33 (d, J=7.8 Hz, 2H), 6.89 (d, J=15.6 Hz, 1H), 2.68 (t, J=7.6 Hz, 2H), 1.68 (m, 2H), 0.96 (t, J=7.6 Hz, 3H); 13C-NMR (100 MHz, CDCl3) δ 188.9, 170.9, 150.0, 138.8, 134.2, 131.1, 129.2, 38.2, 24.2, 13.8; IR υ max (neat): 2917, 1697, 1661cm-1; FAB-MS m/z 219 [M+H]+ 2-(1H-Indol-3-yl)-4-oxo-4-(4-propyl-phenyl)-butyric acid. (22) Purified by silica gel column chromatography (CHCl3: MeOH= 20: 1) to give 22 (yield 67 %): mp. 159–162 °C; 1

H-NMR (400 MHz, DMSO-d6) δ 7.96 (d, J=7.8 Hz, 2H), 7.69 (d, J=7.8 Hz, 1H), 7.35(m, 4H), 7.10 (t, J=7.8 Hz,

1H), 7.01 (t, J=7.8 Hz, 1H), 4.34 (dd, J=10.5, 3.4 Hz, 1H), 4.02 (dd, J=18.0, 10.5 Hz, 1H), 3.31 (dd, J=18.0, 3.4 Hz, 1H), 2.63 (t, J=7.4 Hz, 2H), 1.61 (m, 2H), 0.89 (t, J=7.4 Hz, 3H); 13C-NMR (100 MHz, DMSO-d6) δ 198.1, 174.9, 148.2, 136.4, 134.4, 1238.8, 128.3, 126.4, 123.4, 121.3, 119.2, 118.8, 112.2, 111.7, 41.2, 37.8, 37.3, 23.9, 13.7; IR υ max (neat) 3324, 2929, 1670 cm-1; HRFAB-MS found m/z 336.1584 [M+H]+, calcd for 330.1600 for C21H22NO3.

Scheme 6. Reagents and conditions: (a) AlCl3, benzene, rt, 5h (b) 2N NaOH : MeOH=1:4, rt, 2h (c) N-propyl indole, benzene, reflux, 5h. 2-(1H-Indol-3-yl)-4-oxo-pentanoic acid (23) [32897-68-0] Indole and acetyl acrylic acid methyl ester was stirred in benzene (25 mL) with AlCl3 for 5h. The reaction mixture was poured into water (50 mL), and extracted with EtOAc (40 mL × 2). The organic layer was washed with saturated NH4Cl solution and brine, and then dried over Na2SO4. This residue was purified by silica gel column chromatography (hexane:EtOAc=2:1) to give 23a [313499-45-5] as needles: mp. 107–110°C 1H-NMR (400 MHz, DMSO-d6): δ 11.05 (s, 1H, NH), 7.61 (d, J=6.4, 1H), 7.37 (d, J=6.5, 1H), 7.26 (s, 1H), 7.09 (t, J=6.4, 1H), 7.09 (t, J=6.5, 1H), 4.23 (dd, J=10.3, 4.3, 1H), 3.54 (s, 3H), 3.45 (dd, J=15.4, 10.3, 1H), 2.89 (dd, J=15.4, 3.2, 1H), 2.06 (s, 3H); 13C-NMR (100 MHz, CDCl3): δ 206.89, 173.83, 136.32, 126.03, 123.16, 121.34, 118.84, 118.77, 111.69, 111.23, 51.67, 45.55, 37.31, 29.62; EI-MS: m/z 245 [M+H]+. Methyl ester 23a was then hydrolyzed with aqueous methanolic sodium hydroxide (2N NaOH : MeOH=1:4) for 2h at room temperature. After the neutralization with 3N HCl and the removal of MeOH, the residue was adjusted to pH 3.0 and then extracted with EtOAc (40 mL × 2). The organic layer was washed with 24


saturated NH4Cl solution and brine, and then dried over Na2SO4. This residue was purified by silica gel column chromatography (CHCl3:actone=3:1) to give 23 as needles: mp.172-174°C 1H-NMR (400 MHz, CD3OD): δ 10.35 (s, 1H, NH), 7.63 (d, J=7.8, 1H), 7.32 (d, J=8.2, 1H), 7.11 (s, 1H), 7.11 (m, 1H), 7.09 (t, J=8.2, 1H), 4.29 (dd, J=10.6, 4.5, 1H), 3.38 (dd, J=15.4, 10.6, 1H), 2.85 (dd, J=15.4, 4.5, 1H), 2.13 (s, 3H);

13

C-NMR (100 MHz,

CD3OD): δ 209.9, 177.6, 138.1, 127.5, 123.6, 122.6, 120.0, 119.8, 113.2, 112.4, 47.1, 39.2, 29.9; FAB-MS: m/z 232 [M+H]+. 4-(2,4-Dimethyl-phenyl)-4-oxo-2-(1-propyl-1H-indol-3-yl)-butyric acid (24: N-propyl auxinole). N-propyl-indole and trans-4-(2,4-Dimethyl-phenyl)-4-oxo-but-2-enoic acid (8) was reflux in benzene for 5h . The reaction mixture was then poured into water (50 mL), and extracted with EtOAc (40 mL × 2). The organic layer was washed with saturated NH4Cl solution and brine, and then dried over Na2SO4. This residue was purified by silica gel column chromatography (CHCl3:acetone=5:1) to give 24 as white powder (yield 77 %)：mp.139–141°C. 1

H-NMR (400 MHz, CDCl3): δ 7.70 (d, J=7.8, 1H), 7.59 (d, J=7.8, 1H), 7.28 (d, J=8.2, 1H), 7.18 (t, J=15.1, 1H),

7.07 (m, 2H), 6.99 (d, J=8.7, 2H), 4.56 (dd, J=6.0, 4.1, 1H), 3.97 (m, 2H), 3.91 (m, 1H), 3.28 (dd, J=17.8, 4.1, 1H), 2.43 (s, 3H), 2.30 (s, 3H), 1.80 (m, 2H), 0.89 (t, J=14.7, 3H); 13C-NMR (100 MHz, CDCl3): δ 200.9, 179.7, 142.3, 138.9, 136.3, 134.1, 132.8, 129.1, 126.7, 126.2, 126.1, 121.7, 119.4, 119.2, 110.6, 109.5, 48.0, 44.0, 38.0, 23.4, 21.5, 21.3, 11.5; FAB-MS: m/z 364 [M+H]+. 5. In silico screening and docking study. The structural data of Ask1-TIR1-IAA complex was obtained from the Protein Data Bank with identification numbers of 2P1M, 2P1Q and 2P1P, respectively. The IAA and TIR1 were saved as separate files for docking purposes. The PDB files were visually inspected using Discovery Studio visualizer 3.0 (Accelrys) and all water molecules were removed and hydrogen atoms were added as appropriate. The chemical structure for screening was obtained from ZINC database by filtered with indole substructure and drug likeness properties. The structures were then protonated at pH 7.0 by Open Babel software. Surflex 2.3 was used in Linux workstation. The protomol was generated on TIR1 auxin binding site using a ligand-based approach. The coordinates of BH-IAA was chosen as the ligand for protomol generation. The generated protomols were visually inspected and adjusted with DS visualizer to ensure proper coverage of the desired target area. For the initial in silico screening, a screening parameter set with final docking pose = 4 was used. The high-scored ligands were again docked with exhaustive docking accuracy parameter set and then the docked pose was further evaluated by X-Score 1.21 (Wang, R., 2003) and DrugScore X scoring software (Gohlke, H., 2000). The initial screening results were indicated in supplemental file containing SMILES format and Scores. The final docking results of ligands (1-24) were provided as SDF format. 6. Analysis of lateral root formation and root gravitropism. 25


For lateral root growth, Arabidopsis seedlings were grown vertically for 5 days in continuous light on GM plates containing 1.5% sucrose and 1.4% agar. The seedlings were transferred to liquid GM medium containing the indicated concentration of 1-NAA and auxinole. The seedlings (n = 15-20) were cultivated under continuous light for another 2 days at 24 °C. The number of lateral roots was counted. The experiments were repeated two times with two replications. For root gravitropic response assay, 5-day-old seedlings were grown vertically on GM agar plates under continuous light were transferred on GM agar plates containing the indicated concentration of auxinole. The plate was rotated to 135° angle from vertical after 24h incubation and cultured for 24 days in dark. The angle between root tip orientation and vertical direction was recorded. The experiments were carried out two times (n = 40) with three replications. 7. Generation of the 35S::FLAG-TIR1 line To generate the 35S::FLAG-TIR1 transgenic Arabidopsis line a plant expression vector containing a 3xFLAG was first created by annealing complementary 101bp oligonucleotides including the 3xFLAG coding sequences (see below) and cloning this fragment into XbaI and SalI sites of the vector pFP101. The GATEWAY® C1 cassette (Invitrogen® Gateway® vector conversion reagent system) was then introduced into this plasmid by blunt-end ligation following SalI digestion and end-filling by Klenow reaction to create the destination vector pFP3FLAGSII. The full-length coding sequence for TIR1 was amplified from an Arabidopsis cDNA library using GATEWAY compatible primers (see below) and incorporated into the GATEWAY® donor vector pDONR207 by BP reaction (Invitrogen®). The TIR1 coding sequence was then incorporated into pFP3FLAGSII via a GATEWAY® LR reaction to form the plasmind pFP3FLAGSII-TIR1. Once the integrity of the cloned sequences had been confirmed, this plasmid was transformed into Agrobacterium tumefaciens strain GV3101 (Koncz and Schell, 1986) by electroporation. Wild-type Arabidopsis plants of the Columbia (Col-0) ecotype were subsequently transformed using the floral dip method (Clough and Bent, 1998). Transformants were selected by selected by seed coat fluorescence and were planted into soil and allowed to self-fertilise. In the T2 generation, lines showing a 3:1 ratio of seed coat fluorescent:non-fluorescent plants, indicating single-site integration of the transgene, were selected for further study. Homozygous lines were selected from the T3 generation. Primers: 3xFLAG oligos: 3xFLAGSIIF

:

CTAGAACCATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGAC GATGACAAGTGGAGTCATCCTCAATTCGAGAAG 3xFLAGSIIR: 26


TCGACTTCTCGAATTGAGGATGACTCCACTTGTCATCGTCATCCTTGTAATCGATGTCATGATCTTTATA ATCACCGTCATGGTCTTTGTAGTCCATGGTT TIR1 Gateway

primers

B1-TIR1: GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCAGAAGCGAAT AGCCTTGTCG B2-TIR1: GGGGACCACTTTGTACAAGAAAGCTGGGTTTATAATCCGTTAGTAGTAATGATTTG. SI-References. Katayama M, Kato Y, Marumo S (2004) Biosci Biotechnol Biochem 2004 68:1287-1292. Hayashi, K., Tan, X., Zheng, N., Hatate, T., Kimura, Y., Kepinski, S., and Nozaki, H. (2008) Proc Natl Acad Sci U S A 105, 5632-7. Wang, R. X., Lu, Y. P., and Wang, S. M. (2003) Journal of Medicinal Chemistry 46, 2287-2303. Gohlke, H., Hendlich, M., and Klebe, G. (2000) Journal of Molecular Biology 295, 337-356.

27

Rational Design of an Auxin Antagonist of the ... - ACS Publications

Recommend Documents