Re-Endothelialization Study on Endovascular Stents Seeded by

Research Article www.acsami.org

Re-Endothelialization Study on Endovascular Stents Seeded by Endothelial Cells through Up- or Downregulation of VEGF Xue Wu,†,‡ Yinping Zhao,†,‡ Chaojun Tang,† Tieying Yin,† Ruolin Du,† Jie Tian,† Junli Huang,† Hans Gregersen,§,∥ and Guixue Wang*,† †

Key Laboratory for Biorheological Science and Technology of Ministry of Education (Chongqing University), State and Local Joint Engineering Laboratory for Vascular Implants (Chongqing) and §GIOME Center, Bioengineering College of Chongqing University, Chongqing 400044, China ∥ GIOME Academy, Aarhus University, Aarhus, Denmark S Supporting Information *

ABSTRACT: We studied the effects of gene transfection of endothelial cells with vascular endothelial growth factor (VEGF) on re-endothelialization and inhibition of in-stent restenosis. Transfected endothelial cells (ECs) exposed to different VEGF levels were seeded on a stent surface for evaluation in vitro. VEGF121++ ECs and VEGF121−− ECs were established using lentiviral-mediated HUVECs transfection. VEGF RNA transcription level and VEGF protein expression were detected by qPCR, Western blot, and ELISA. Methyl thiazolyl tetrazolium (MTT) assay, wound healing assay, and in vitro HUVEC tube formation assay showed that VEGF overexpression promoted cell proliferation, migration, and endothelial capillary-like tube formation. Downregulation of VEGF expression inhibited these activities. Using a rotational culturing system, cells tightly adhered on the stent surface. Stents seeded with transfected ECs at different VEGF levels were implanted in abdominal aortas of New Zealand white rabbits to study re-endothelialization and inhibition of in-stent restenosis. Stents with cells exposed to excess VEGF expression were almost completely covered with cells after stent implantation for 1 week (w). In the VEGF interference group this process was delayed over 4 w due to RNAi-mediated silencing of VEGF. Cryosectioning after 12 w showed that stents seeded with HUVECs exposed to excess VEGF expression significantly reduced the neointima area and stenosis when compared with bare metal stents and stents from the VEGF interference group. Transgenic HUVECs were not found in tissues of experimental animals. Furthermore, cells from these tissues were similar to those from normal tissue. In conclusion, VEGF-mediated endothelialization was found. Furthermore, ECs exposed to VEGF overexpression reduced neointimal hyperplasia, promoted endothelialization, and reduced in-stent restenosis. KEYWORDS: vascular stents, re-endothelization, restenosis, VEGF, gene transfection

1. INTRODUCTION

surface endothelialization of a coronary stent has potential to become the next-generation stent.14,15 There are two ways to design endothelialization on the stent surface, i.e., endothelialization can be done in vivo or in vitro. Biocompatibility for achieving endothelialization can be enhanced by seeding endothelial cells (EC) on stents in vitro.16 However, seeding ECs to stents in vitro has not been widely applied widely, primarily due to limited cell proliferation and adherence on the struts. Therefore, it is critical to find a novel way to improve the performance of ECs or stimulate the re-endothelialization process. Vascular endothelial growth factor (VEGF) is a potent endothelium-specific angiogenic factor that promotes reendothelialization of the denuded arterial wall.17 Studies with

Coronary atherosclerosis is an angiocardiopathy that severely impairs health.1 Percutaneous coronary intervention (PCI) combined with balloon distension of the lesion has been the standard treatment to reopen the stenosed arterial blood vessel.2 In recent years, coronary stenting gradually became the leading therapy.3−5 Stent implantation expands the stenotic vessel and thereby increases the lumen area. However, in-stent restenosis (ISR) is a major risk factor for coronary stent implantation and remains a major concern to patients who had bare-metal stents implanted.6−8 Since 1987 new treatments have been developed including drug eluting stent (DES) and radiotherapy. However, none of these new treatments completely eliminate ISR and the risk for late thrombosis. It was found that ISR was decreased due to endothelialization of coronary stents. This was considered an important factor for prevention of thrombosis and for reduction of proliferation and migration of smooth muscle cells (SMCs).9−13 Therefore, rapid © XXXX American Chemical Society

Received: January 5, 2016 Accepted: February 29, 2016

A

DOI: 10.1021/acsami.6b00152 ACS Appl. Mater. Interfaces XXXX, XXX, XXX−XXX

Research Article

ACS Applied Materials & Interfaces

Figure 1. HUVEC and immunofluorescence. Scale bars = 100 μm. (A) Appearance of HUVEC; (B) immunofluorescence of HUVEC with CD31; (C) immunofluorescence of HUVEC with VEGFR2.

VEGF-coated stents have suggested that increased reendothelialization reduces restenosis and inhibits stent thrombosis.18−20 Other endothelial mitogens like basic fibroblast growth factor,21 platelet-derived growth factor,22 and eNOS23 facilitated testing the hypothesis that gene therapy-mediated acceleration of endothelial recovery is an alternative strategy for prevention of neointimal proliferation. In this study we aim to improve stent re-endothelialization in vitro by transfecting VEGF to ECs. We studied endothelialization in vitro and prepared transfected stent-seeded ECs at different VEGF levels. The potential mechanism for inhibition of in-stent restenosis and for prevention of thrombosis was further examined in a series of animal experiments.

2. EXPERIMENTAL SECTION 2.1. Culture and Identification of Human Umbilical Vein Endothelial Cells (HUVECs). HUVECs (a generous gift from Dr. Lushan Liu, Nan Hua University, China) in endothelial basal media (RPMI 1640; HyClone USA, Logan, UT) supplemented with 10% fetal calf serum (FCS; Cambrex Corp, Charles City, IA) and antibiotic/antimycotics solution (Gibco Industries Inc., Langley, OK) were grown to confluence in T-75 polystyrene flasks (Becton Dickinson and Co., Franklin Lakes, NJ). Cells were cultured in a CO2 incubator (5% CO2) at 37 °C. HUVECs were identified by means of morphologic studies and immunofluorescence assay of CD31 (Platelet-endothelial cell adhesion molecule-1 [PECAM-1/CD31]) and VEGFR2 (Vascular endothelial growth factor receptor). 2.2. Construction of VEGF121 Overexpression and RNA Interference Lentiviral Vectors. To construct the VEGF121 overexpression lentiviral vector, a fragment was amplified according to the sequence of VEGF 121 using the primers PON1-F: 5′‐TAGAGCTAGCGAATTCGCCACC

ATGAACTTTCTGCTGTCTTGG‐3′ and PON1-R: 5′-CCTTGTAGTCGAATTCCCGCCTCGGCTTGTCACAT-3′. Sequences for EcoRI enzyme site and Kozak have been underlined by single and double lines, respectively. The PCR products were recovered from the gel, and the fragment was cloned into the plasmid pCDH-CMV-MCS-3Flag-EF1-copGFP lentiviral vector (Shanghai Sunbio Medical Biotechnology Co., China) by the EcoRI and BamHI enzyme sites. The recombined plasmids were transformed into DH5α, and positive clones were verified primarily by the primer pair CMV-F: 5′-CGCAAATGGGCGGTAGGCGTG-3′ and EF1-R: 5′-CGCCACCTTCTCTAGGCAC-3′. Among them, CMV-F locates in the CMV promoter sequence, and EF1-R is in the EF1 promoter sequence which is in multiple cloning sites (MCS) downstream. Then the transgene was confirmed by sequencing. The VEGF RNA interference (RNAi) lentiviral vector was constructed successfully according to the design principle of shRNA (http://www.ambion.com/techlib/misc/siRNA_finder.html). The sequence for targeting the VEGF121 gene was 5′-TTCTCCGAACGTGTCACGT-3′. As control we used a scrambled sequence 5′-TCATCACGAAGTGGTGAAG-3′. Briefly, two reverse complemented sequences were cloned into pMAGic 4.1 (Shanghai Sunbio Medical Biotechnology Co., China) to generate the hairpin structure, which can downregulate the expression of target gene. Two reverse complemented sequences were amplified with the primers

Figure 2. Infected HUVECs showed green fluorescence: (A, a) the group of VEGF121-overexpression HUVECs named VEGF-t, (B, b) the group of VEGF121-overexpression control HUVECs named con-t, (C, c) the group of VEGF121-interference HUVECs named si-VEGF, and (D, d) the group of VEGF121-interference control HUVECs named si-con. Scale bars = 500 μm. LVT708-1: 5′-CcggTCATCACGAAGTGGTGAAGTTCAAGAGACTTCACCACTTCGTGATGATTTTTTg-3′ LVT708-2: 5′-aattcaaaaaaTCATCACGAAGTGGTGAAGTCTCTTGAACTTCACCACTTCGTGATGA-3′ The recombined plasmids were transformed into DH5α, and positive clones were confirmed by PCR and sequencing. 2.3. Stable Infection of VEGF121 in HUVECs. Lentiviruses were produced in HEK293T cells using the above constructing lentiviral vectors encased in viral capsid encoded by three packaging plasmids (Shanghai Sunbio Medical Biotechnology Co., China). The supernatant containing the viruses was collected 48 h after transfection, B


Research Article


Figure 3. Expression level of VEGF in infected HUVECs in vitro. (A) Western blot for VEGF expression. (B) Statistical result of VEGF Western blot. (C) Transcription levels of VEGF by quantitative reverse-transcription PCR. (D) Determination of VEGF protein concentration by ELISA. VEGF-t, VEGF121-overexpression HUVECs; si-VEGF, VEGF121-interference HUVECs; con-t, VEGF121-overexpression control HUVECs; si-con, VEGF121-interference control HUVECs (n = 3; asterisk (*) indicates P < 0.05, double asterisk (**) indicates P < 0.01).

Figure 4. Transfection with VEGF121 promoted cell growth, migration, and angiogenesis in vitro. (A) Migration of transfection cells and HUVEC; scale bars = 200 μm. (B) In vitro tube formation of transfection cells and HUVEC. (C) Growth curve of transfected cells and nontransfected cells. (D) Histogram of transfected cells and HUVEC migration (n = 6; asterisk (*) P < 0.05, double asterisk (**) P < 0.01). (E) Histogram of in vitro tube formation branch points (n = 3; asterisk (*) P < 0.05, double asterisk (**) P < 0.01). (F) Histogram of in vitro tube formation tube length (n = 3; asterisk (*) P < 0.05, double asterisk (**) P < 0.01. centrifuged at 5000 rpm for 5 min, filtered through 0.45 μm Acrodisc filters, and used for subsequent studies. The virus particle concentration was adjusted to 2.36 × 108 and 3.37 × 108 TU/mL. HUVECs were infected with the lentiviruses at a multiplicity of infection (MOI) of 50. Real-time quantitative PCR detection (qPCR), Western blot, and ELISA assay were used for the assessment of infection efficiency. The exact sequences of the primers used for the VEGF121 qPCR were as follows Forward primer: 5′-AACTTTCTGCTGTCTTGG-3′ Reverse primer: 5′-ACTTCGTGATGATTCTGC-3′

HUVECs were harvested after infection for 72 h, and total cellular proteins were extracted using a kit (Beyotime, China) containing protease inhibitors. Equal amounts of protein were separated by 10% SDS−polyacrylamide gel electrophoresis and subsequently electrotransferred onto PVDF membranes (Millipore). Western blotting was probed with antibodies against VEGF (Boster, China), and the horseradish peroxidase-signed secondary goat antirabbit IgG antibody (Beyotime, China) was selected. β-Actin was used as internal control. VEGF121 expression in the supernatant of infected cells was examined by ELISA Kit (Boster, China), and 450 nm absorbance was measured for computation of the protein concentration. C


Research Article


Figure 5. In vitro tube formation of transfection cells and HUVEC. VEGF-t, VEGF121-overexpression HUVECs; si-VEGF, VEGF121-interference HUVECs; con-t, VEGF121-overexpression control HUVECs; si-con, VEGF121-interference control HUVECs. Scale bars = 200 μm. 2.4. HUVECs Proliferation Assay, Migration Assay, and in Vitro Tube Formation Assay. Cell proliferation in vitro was assessed by methyl thiazolyl tetrazolium (MTT) assay. The cells were harvested, plated in 96-well plates at 1 × 104 per well in 100 μL of medium, and maintained at 37 °C in a humidified incubator containing 5% CO2. During the proliferation experiment, 150 μL of the DMSO solution was added to each well and incubated for 4 h. The 450 nm absorbance was measured to calculate the numbers of vital cells in each well. In order to measure the cell migration distance, confluent monolayers of HUVECs were wounded by scraping with a pipet tip (10 μL) across the monolayer to produce initial wounds with a constant diameter. The cells were washed with phosphate-buffered saline (PBS) three times to remove loose cells. Subsequently, the cells were maintained at 37 °C in a humidified incubator containing 5% CO2 with culture medium containing 2% fetal bovine serum (FBS). The site for pipet scraping on the monolayer was chosen randomly. The area chosen of the scratch on the 0 h image was marked on the outside of the plate, forming a rectangle with the scratch. Photos were taken at the same location after 12 and 24 h. The total number of cells migrating into the selected area after 12 and 24 h were counted. Images were obtained using a microscope (Olympus IX81, Japan) with a 49 phase-contrast objective. Semiquantitative measurements were made of the control and treated wounds with Image Tool software (version 2.0; UTHSCSA). HUVEC proliferation was minimal in the

culture during this period. All results reported have been obtained from three different wells from three separate experiments. We applied the method of rat tail collagen to detect the ability of HUVECs tube formation. In brief, 200 μL of collagen type I (1.5 mg/mL) was added into a 24-well plate. The pH value was adjusted to make collagen gel. The plates were incubated at 37 °C for 30 min to allow the collagen to solidify. The collagen was overlaid with 500 μL of culture medium containing 104 cells per well. Further incubation was done at 37 °C for 4 h.21,22 The endothelial capillary-like tube formation was monitored by phase-contrast microscopy (Olympus IX81, Japan). Average tubule length was obtained from three randomly selected fields per well. 2.5. Cell Seeding and Detecting in Vitro. 316L stainless steel stents (1.6 mm in diameter and 18 mm in length; Beijing Amsino Medical Co, China) were used in this study. In order to coat the stent surface with transfected HUVECs or nontransfected cells, the stents were first coated with gelatin (0.4%) using an ultrasonic spraying process. This was followed by radiation sterilization with ultraviolet light. Cells were detached from flasks by mild trypsinization (0.25% trypsin for 2−3 min at 37 °C, followed by trypsin neutralization with FCS). Detached cells (1.0 × 105 cells/mL) were resuspended in serum-free media. The stents were submerged into the medium containing resuspended cells in an organic glass tube mounted to D


Research Article


Figure 6. Statistical results of in vitro tube formation. VEGF-t, VEGF121-overexpression HUVECs; si-VEGF, VEGF121-interference HUVECs; con-t, VEGF121-overexpression control HUVECs; si-con, VEGF121-interference control HUVECs. Scale bars = 200 μm (n = 3; asterisk (*) P < 0.05, double asterisk (**) P < 0.01). a custom-built rotating device for 12 h of rotation at a speed of 0.4 rpm,23 followed by another 48 h of static culture without rotation. Dilation of stents in vitro was used to simulate the transfer process and to characterize cell adhesion and cell growth on the modified stent surface. A stent coated with cells was mounted on a balloon and expanded. Cells adhered on the stent surface were studied by phasecontrast microscopy (Olympus IX81, Japan). 2.6. Animal Experiments. The Guide for Chinese Animal Care and Use Committee standards was followed for the animal housing and surgical procedures. All in vivo procedures were done in accordance with protocols approved by the Animal Ethics Committee of Chongqing University. Male New Zealand white rabbits (1.5−2.5 kg) were housed in the Animal Laboratory Center in Chongqing Medical University, China, and divided into six groups. Group 1 received bare metal stents (BMS); group 2 received nontransfected HUVECscoated stents (HUVECs); group 3 received VEGF121-overexpression HUVECs-coated stents (VEGF-t); group 4 received VEGF121interference HUVECs-coated stents (si-VEGF); group 5 received VEGF121-overexpression control HUVECs-coated stents (con-t); group 6 received VEGF121-interference control HUVECs-coated stents (si-con). All animals were exposed to an immunological tolerance experiment by injecting transfected cell suspension for 2 w. This ensured that the rabbits were healthy without immune reactions before the procedure. The cells were injected intravenously. About 1 × 105 cells were injected every day. A blood sample was used for testing immune reactions. Rabbits were fed with a normal diet during the study period.

Rabbits were anesthetized by intramuscular injection of ketamine (50 mg/kg) and intravenous injection of sodium pentobarbital (30 mg/kg). A 5F introducer sheath was positioned in the right femoral artery under surgical exposure. Heparin sodium (200 IU/kg) was injected intra-arterially. All catheters were subsequently introduced through the sheath and advanced to the external iliac artery through a 0.014 in. Balance Middle Weight guide wire (Guidant Corp., St. Paul, Minnesota). Baseline angiograms of the external iliac arteries were obtained for each rabbit. Abdominal aorta injury was created using an angioplasty balloon catheter (Clear stream, Ireland) with distensions at 10 atm (atm) pressure three times in a 10 s interval at the same location. The angioplasty balloon diameter was 3 mm, and the length was 3 cm. Prepared stents were deployed in the infrarenal abdominal aorta during angiographic guidance. The stent was positioned at the site of injury using a guidewire with two radiograph opacity sites. It was ensured that no branches were present in the stented region. Stents were dilated at 10 atm pressure. At the level of the balloon dilatation, the diameter of the aorta was 2.8−3.0 mm and the expansion ratio of the aorta was 1.2−1.3. Predeployment and postdeployment digital subtraction angiography was recorded. Rabbits were fed a normal diet after the intervention. Rabbits were killed at 0 h, 1 d, 1 w, 4 w, and 12 w (n = 3 at each time point for each group). Aortic specimens were fixed in 0.25% glutaraldehyde for 12−16 h for SEM and morphologic analysis of the intima surface at 0 h, 1 d, 1 w, and 4 w. At 12 w, aortic specimens were excised transversely into two parts. One was fixed in 4% E


Research Article


Figure 7. Cell seeded stents. Scale bars = 500 μm for all except H where it is 100 μm. (A−C) VEGF-t; (D−F) con-t; (G−I) si-VEGF; (J−L) si-con; (M−O) HUVEC. (A, D, G, J, M, N) Phase contrast microscope examination after rotational culturing. (B, E, H, K) Fluorescence microscope examination after rotational culturing. (C, F, I, L, O) SEM examination after static culturing. paraformaldehyde and embedded in light-cured resin with toluidine blue stain for pathology organization analysis. The other was fixed in 0.25% glutaraldehyde for 12−16 h for SEM and morphologic analysis of the intima surface. At 12 w, the proximal part and distal part of the stented vessel, myocardium, liver, spleen, lung, and kidney of rabbits were frozen and sliced to check fluorescence of transplanted cells. Morphometric analysis was done with a computerized digital image analysis system by an independent observer blinded to the study groups. Histomorphometric analysis was done on each section including vessel area (mm2), internal elastic lamina (IEL) area (mm2), lumen area (mm2), neointima area (mm2), and the neointima thickness (mm) using Image Tool. The percentage of stenosis was calculated using the

(

following equation 1 −

IEL area − neointima area IEL area

The shape of the cells seemed to be polygons and stretched on the plates. Positives immunofluorescence staining of CD31 and VEGFR2 were found, as indicated by cell-edged green fluorescence circles representing the expression of CD31 and VEGFR2 in cellular membranes (Figure 1B and 1C). Therefore, the characteristics of the cultured cells were consistent with those of HUVECs. 3.2. Infection with VEGF121 to HUVECs. Due to the expression of green fluorescent protein (GFP) as a marker for the lentiviral vector promoter, transfected cells were observed after infection with VEGF121 to HUVECs under an inverted microscope and fluorescence microscope (Figure 2). The results showed that cells in all infected groups almost completely expressed green fluorescence, indicating successful infection. Western blot analysis showed that VEGF expression in the VEGF-t group was significantly higher than that in the nontransfected HUVEC group (HUVEC) and the empty vector control group (con-t). Furthermore, VEGF expression in the si-VEGF group was significantly lower than that in the nontransfected HUVEC group (HUVEC) and in the empty vector control group (si-con) (Figure 3A and 3B). ELISA assay

) × 100%.

24

2.7. Statistical Analysis. Statistical analyses were done using SPSS (version 11.0; SPSS Inc., Chicago, IL). All data are presented as mean ± SD. Comparisons between group means were done by the t test. Probability values of P < 0.05 were considered statistically significant. P < 0.01 was considered highly significant.

3. RESULTS 3.1. Identification of HUVECs. HUVECs were identified in accordance with the morphology (Figure 1A) and immunofluorescence of CD31 (Figure 1B) and VEGFR2 (Figure 1C). F


Research Article


inoculation have elongated, extended pseudopodia, connected with the surrounding cells, and formed a semicircle. In contrast si-VEGF cells still showed a primal state and were round with no cell spreading. The con-t group was similar to the si-con. The normal HUVEC group had a small number of cells extending pseudopodia, showing divergent patterns in all directions without cells being connected. After 12 h, for the VEGF-t group, almost all cells started to stretch out and connect with the surrounding lumen structure gradually being formed. si-VEGF cells, which were similar to control group cells at 4 h, began to extend pseudopodia. The con-t group, si-con group, and normal group HUVEC cells at 12 h linked into a chain elongation, but compared with the VEGF-t group, fewer cells participated in this structure. After 24 h, the tubular structure was clearly visible in the VEGF-t group, and semicircular cell structure closed and further attached to a circle or polygon. In the si-VEGF control group for 12 h, the cells were connected with the formation of long chains. The con-t group, si-con group, and normal group HUVEC showed some luminal-like structure formation, but the structure was not completely closed. Data for branch points and the length of tubular structure in the 4, 12, and 24 h groups are shown in Figure 6 including the statistics. The length of the structure nodes and luminal cell formation increased as a function of time. Overexpression of VEGF significantly enhanced the HUVEC tube formation. In contrast, after VEGF interference, the ability to form HUVEC tubes was significantly weakened. 3.4. Cell Seeding and Detecting in Vitro. Infected HUVECs in all groups and nontransfected HUVECs were seeded on stents and observed by phase-contrast microscopy, fluorescence microscopy, and SEM. It was found that all seeded cells had a high-coverage fraction on the stent surface (Figure 7A, 7D, 7G, 7H, 7J, and 7M). Transfected groups showed better green fluorescence (Figure 7 B, 7E, 7K, and 7N). Furthermore, compared to the si-VEGF group, the up-VEGF group appeared spread and continued to grow at 2−4 d of static culturing (Figure 7C, 7F, 7I, 7L, and 7O). Cell retention detection images showed that many cells were still attached to the stents though some cells detached and fell off the stents after stent expansion by balloon in vitro (Figure 8). 3.5. Stent Implantation. Angiograms obtained immediately after stent implantation showed that all deployment procedures were successful (Figure 9A). All stented vessels were competent (Figure 9B). Re-examination angiograms at different time points revealed no shifting of the stents, aneurysm, or thrombus in the vessels. 3.6. Infected HUVECs in Rabbit Abdominal Aorta Model. The six types of stents were randomly implanted in abdominal aortas of male New Zealand white rabbits. Angiograms obtained immediately after stent implantation showed that all deployment procedures were successful and all stented vessels were competent. Re-examination angiograms at different time points did not reveal a shift of the stents, aneurysm, or thrombus in the vessels. All rabbits survived for the entire study period (0 h, 1 d, 1 w, 4 w, and 12 w). Rabbits were at the preselected time point euthanized for histomorphometric and histopathologic analyses, evaluation of endothelial regeneration, and safety evaluation of stents with seeded transfected cells. Figure 10 shows re-endothelialization areas on the stents. At 0 h, numerous cells adhered on the stent surface in the VEGF-t group after implantation. At 1 d some cells were shaped like endothelial

Figure 8. Cell seeded stents after expansion. Scale bars = 100 μm. (A) VEGF-t; (B) si-VEGF; (C) con-t; (D) si-con; (E) HUVEC.

of the supernatant from the infected cell groups showed similar results as the Western blot did (Figure 3D). Results from qPCR clearly showed that the VEGF121 gene was detected in transfected HUVECs (Figure 3C). Results showed significantly increased VEGF transcription in VEGF-t group cells, whereas si-VEGF group cells only exhibited little VEGF transcription. 3.3. Transfection with VEGF121 Promoted Cell Growth, Migration, and Tube Formation in Vitro. We quantified the cells migration in VEGF-t, si-VEGF, con-t, si-con, and nontransfected HUVECs. Compared to control cells (con-t), an almost 90% increase in in vitro wound healing was found in the VEGF overexpressing clones relative to control cells (con-t). However, almost 50% decrease in migration was found in VEGF interference clones compared with the control siRNA clones (si-con) (Figure 4A and 4D). In addition, endothelial cell proliferation was minimal in culture with RIPA-1640 media with 2% FBS during 24 h. Thus, ectopic VEGF expression led to increased migration of HUVEC, whereas suppression of endogenous VEGF expression reduced migration. After 24 h, cells in group si-VEGF in small round shapes were similar in shape to isolated cells. However, nontransfected HUVECs, cells in group con-t, and cells in group si-con had a number of connecting branches between cells (Figure 4B). Cells in group VEGF-t led to the development of capillary tubes and formation of cellular networks. Overexpression of VEGF increased the tube-like formation of HUVECs (P < 0.01), whereas VEGF interference decreased the tube-like formation of HUVECs (P < 0.01, Figure 4E and 4F). During MTT assay at 96 h, VEGF overexpression significantly increased the proliferation of HUVECs whereas VEGF interference significantly decreased the proliferation of HUVECs (Figure 4C). Vascular endothelial cells such as HUVECs in threedimensional matrigel form a ring structure, i.e., capillary-like structures. As shown in Figure 5, most VEGF-t cells 4 h after G


Research Article


Figure 9. Angiograms obtained immediately after stent implantation. (A) Deployment procedures were successful. (B) Stented vessel was competent. Arrows show the position of stent implantation.

Figure 10. SEM imaging of stents demonstrating the degree of endothelial coverage after 0 h, 1 d, 1 w, 4 w, and 12 w: BMS, bare metal stent; siVEGF, si-VEGF HUVEC seeding stent; VEGF-t, VEGF-t HUVEC seeding stent; HUVEC, HUVEC seeding stent; si-con, si-con HUVEC seeding stent; con-t, con-t HUVEC seeding stent.

cells on the stent surface in the VEGF-t group. After 1 w, almost complete coverage with cells was obtained. Large

numbers of platelets and red blood cells covered the nonendothelialized areas of BMS. Some si-VEGF group cells H


Research Article


Figure 11. Tissue slices and quantitative histomorphometric data for each of the stent groups: (A) cross sections at 1 w; (B) cross sections at 12 w; double arrow shows thickness, and the star illustrates stent struct; scale bars = 200 μm. Quantitative histomorphometric data: intima area (C), lumen area (D), intima thickness (E), and stenosis (F); n = 3; asterisk (*) indicates P < 0.05, double asterisk (**) indicates P < 0.01).

Table 1. Quantitative Histomorphometric Data for Each of the Stent Groups group

treatment (n = 3)

1 2 3 4 5 6

BMS HUVEC VEGF-t si-VEGF con-t si-con

intima area (mm2) 2.68 1.92 0.63 2.34 2.04 2.08

± ± ± ± ± ±

0.50 0.47 0.33a,b 0.62 0.62 0.38

lumen area (mm2) 2.71 3.58 4.87 3.19 3.46 3.45

± ± ± ± ± ±

0.17 0.27 0.13a,b 0.34 0.42 0.13

intima thickness (mm) 0.65 0.18 0.09 0.32 0.20 0.19

± ± ± ± ± ±

0.10 0.06d 0.01a,b 0.06c 0.06 0.02

percentage stenosis (%) 50.50 21.34 7.13 31.59 19.43 18.53

± ± ± ± ± ±

1..19 6.18 1.06a,b 6.75c 6.98 1.95

a

Group 3 (VEGF121-overexpression HUVECs-coated stents, VEGF-t) vs Group 1 (bare metal stents, BMS), P < 0.01. bGroup 3 (VEGF121overexpression HUVECs-coated stents, VEGF-t) vs Group 4 (VEGF121-interference HUVECs-coated stents, si-VEGF), P < 0.01. cGroup 4 (VEGF121-interference HUVECs-coated stents, si-VEGF) vs Group 1 (bare metal stents, BMS), P < 0.01. dGroup 2 (nontransfected HUVEC-coated stents, HUVEC) vs Group 1 (bare metal stents, BMS), P < 0.05.

did not shape like endothelial cells on the stent surface. After 4 w, the surface of VEGF-t HUVECs-coated stent was almost the same as the surface after 1 w. Other stents were completely covered. The morphology of newly covered cells on the stent surface in the control groups did not differ much for the implantation periods up to 4 w. After 12 w implantation, in the si-VEGF group and BMS group, thick neointima was found on the stent surface rather than a monolayer of cells. Overall, the VEGF-t group was enhanced when compared with other control groups (con-t, si-con, si-VEGF, and BMS group). Representative arterial cross sections from different treatment groups are shown in Figure 11A and 11B. The quantitative histomorphometric data for each of the stent groups are summarized in Figure 11C−F and Table 1. After 12 w, stents in the VEGF-t group had significantly reduced neointima area and

stenosis when compared with those for BMS and stents of the si-VEGF group in vivo. Compared with BMS, stents of the si-VEGF group had some degree of intimal hyperplasia but also reduced stenosis because of better biocompatibility by the cell coating. At 12 w, fluorescence of transplanted cells was not found in frozen sections of rabbit stented vessels (proximal part and distal), myocardium, liver, spleen, lung, and kidney. HE staining showed no lesions in the frozen sections (S1).

4. DISCUSSION In this study we report that stents implanted in rabbit iliac artery achieved re-endothelialization after 4 w. This process needs longer time (>12 w) in the human body.24 VEGF121 accelerated endothelial repair by stimulating the proliferation I


Research Article

ACS Applied Materials & Interfaces and migration of endothelial cells. Hedman25 found that treatment with VEGF in the coronary arteries was safe and had an inhibitory effect on restenosis. Clinical research on VEGF promoting angiogenesis and VEGF inhibition shows that VEGF-A affects the vascular homeostasis, leading to endothelial dysfunction and cardiovascular adverse events.26 VEGF gene therapy has great potential for treatment of cardiovascular diseases.27 However, results from animal experiments did not translate into clinical application yet. The biggest challenge for clinical application is proper selection of the vector. Endothelial cells act as a perfect carrier, as proposed for interventional therapy, due to excellent tissue compatibility and blood compatibility. In this study, VEGF overexpression vector and VEGF interference vector were transfected into endothelial cells. VEGF gene transcription level and VEGF expression level of transfected cells in vitro showed significant changes as evidenced by the in vitro assays. Animal experiments showed that VEGF overexpression endothelial cells entered into vessels with stent implantation and maintained the local concentration of growth factor in the stented vessel. This enhanced the intimal healing process. On the other hand, it had previously been shown that VEGF can reduce the immune responses in allogeneic cell transplantation.28 Transplantation of VEGF overexpression cells may have increased the concentration of VEGF in serum, which contributed to the cell retention on the bracket. Conversely, re-endothelialization in vivo of VEGF interference cells seeded stents was slow. This was probably due to the low cell coverage on the stent surface, slow growth of cells, and immune rejection. Advantages of VEGF overexpression cells seeded stents are that they can not only promote the proliferation of endothelial cells by persistent expression of VEGF but also reduce the time of allogeneic cells on the stent by rapid endothelialization. Analysis of composition and source of cells seeded stent reendothelialization after implantation contribute to the understanding of the endothelialization mechanisms. However, this aspect has rarely been reported in the tissue engineering field. In a recent report, Fu29 seeded a BMS with human trophoblastic endovascular progenitor cells (hTEC) labeled by indium. A porcine coronary artery model was used to compare the rate and extent of endothelial regeneration and the degree of neointimal proliferation. One hour after implantation, it was found that radioactivity counts decreased to 18.3%, and after 7 d it was just 2.7%. For a long period, no transplanted cells were found in the endothelial layer. Nevertheless, SEM showed good cell coverage on the stent surface. The likely explanation for this is that the present transplanted cells (hTEC) mobilized circulating and/or tissue resident endothelial progenitor cells (EPCs) to the vascular injury site. The present study confirmed these results. The transgenic cells used in the animal experiments were labeled with green fluorescence for studying preservation of transplanted cells after implantation. During stent expansion in vitro most cells were retained on the stent, but in the samples at 0 h after in vivo implantation, fluorescence of transplanted cells was not observed using fluorescence microscopy in vivo. Host cells had not climbed onto the stent at 0 h. However, a few endothelial cells adhered to the stent (as observed by SEM) appeared to be transplanted cells. There was no expression of green fluorescence in samples at 24 h and at later time points. Due to limitation of stent implantation procedures, most cells detached during implantation. Hence, endodermic cell on the

stent surface primarily came from the host. SEM and vascular sectioning of the stent implantation segment showed that VEGF overexpression cells seeded stents speeded up the endothelialization process and significantly reduced in-stent stenosis and late thrombus formation. A likely explanation is that transplanted cells were unable to graft into porcine vascular tissue or that they stimulated a delayed cellular T-cell-mediated immune response in the animal.27 However, after the transplanted cells were rejected or shed from the stents, a large amount of VEGF protein from the VEGF overexpression cells would likely still appear on the stents as vascular growth factor. This can enhance the biological compatibility of the stent and induce host cells (EPCs, EC from peripheral vasculature, and other cells derived from endothelium) to adhere and grow on the stent surface to promote rapid endothelialization.30 This may be an important facilitator for the faster endothelialization process of VEGF overexpressing cells seeded stent compared to the other groups.

5. CONCLUSION Transfected ECs exposed to different VEGF levels were seeded on stents for evaluation in vitro. MTT assay, wound healing assay, and in vitro HUVEC tube formation assay showed that VEGF overexpression promoted cell proliferation, migration, and endothelial capillary-like tube formation. In contrast, downregulation of VEGF expression inhibited these activities. In vivo, cryosectioning after 12 w showed that stents seeded with HUVECs exposed to excess VEGF expression significantly reduced the neointima area and stenosis when compared with bare metal stents and stents in the VEGF interference group. Transgenic HUVECs were not found in tissues of experimental animals. Furthermore, cells from these tissues were similar to those from normal tissues, providing evidence for safety for transgenic cell implantation. In conclusion, VEGF-mediated endothelialization was found, and ECs exposed to VEGF overexpression reduced neointimal hyperplasia, promoted endothelialization, and reduced in-stent restenosis. However, storage, transportation, and implant operation for these cell stents are still the most significant limiting factors for their application. These issues constitute the key problems to address in future studies.

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acsami.6b00152. Figure with HE staining of tissue slice (PDF)

■

AUTHOR INFORMATION

Corresponding Author

*Tel.: +86-23-65102508; Fax: +86-23-65102507; E-mail: [email protected]. Author Contributions ‡

X.W. and Y.Z. contributed equally to this work.

Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This study was partially supported by grants-in-aid from the National Natural Science Foundation of China (11332003, 31370949), the Fundamental Research Funds for the Central J


Research Article


W.; Whisenant, B. K.; Yarnold, P. R.; Belknap, S. M.; West, D. P.; Gage, J. E.; Morse, R. E.; Gligoric, G.; Davidson, L.; Feldman, M. D. Hypersensitivity Cases Associated with Drug-Eluting Coronary Stents: a Review of Available Cases from the Research on Adverse Drug Events and Reports (RADAR) Project. J. Am. Coll. Cardiol. 2006, 47, 175−181. (15) Luo, C. F.; Zheng, Y. M.; Diao, Z. J.; Qiu, J. H.; Wang, G. X. Review: Research Progress and Future Prospects for Promoting Endothelialization on Endovascular Stents an Preventing Restenosis. J. Med. Biol. Eng. 2011, 31, 307−316. (16) Wu, X.; Wang, G. X.; Tang, C. J.; Zhang, D. C.; Li, Z. G.; Du, D. Y.; Zhang, Z. C. Mesenchymal Stem Cell Seeding Promotes Reendothelialization of the Endovascular Stent. J. Biomed. Mater. Res., Part A 2011, 98A, 442−449. (17) Yang, Y. G.; Tang, G.; Yan, J. L.; Park, B.; Hoffman, A.; Tie, G.; Wang, R.; Messina, L. M. Cellular and Molecular Mechanism Regulating Blood Flow Recovery in Acute Versus Gradual Femoral Artery Occlusion Are Distinct in the Mouse. J. Vasc. Surg. 2008, 48, 1546−1558. (18) Ferrarini, M.; Arsic, N.; Recchia, F. A.; Zentilin, L.; Zacchigna, S.; Xu, X. B.; Linke, A.; Giacca, M.; Hintze, T. H. Adeno-Associated Virus-Mediated Transduction of VEGF165 Improves Cardiac Tissue Viability and Functional Recovery after Permanent Coronary Occlusion in Conscious Dogs. Circ. Res. 2006, 98, 954−961. (19) Laitinen, M.; Pakkanen, T.; Donetti, E.; Baetta, R.; Luoma, J.; Lehtolainen, P.; Viita, H.; Agrawal, R.; Miyanohara, A.; Friedmann, T.; Risau, W.; Martin, J. F.; Soma, M.; Ylä-Herttuala, S. Gene Transfer into the Carotid Artery Using an Adventitial Collar: Comparison of the Effectiveness of the Plasmid-Liposome Complexes, Retroviruses, Pseudotyped Retroviruses, and Adenoviruses. Hum. Gene Ther. 1997, 8, 1645−1650. (20) Walter, D. H.; Cejna, M.; Diaz-Sandoval, L.; Willis, S.; Kirkwood, L.; Stratford, P. W.; Tietz, A. B.; Kirchmair, R.; Silver, M.; Curry, C.; Wecker, A.; Yoon, Y. S.; Heidenreich, R.; Hanley, A.; Kearney, M.; Tio, F. O.; Kuenzler, P.; Isner, J. M.; Losordo, D. W. Local Gene Transfer of phVEGF-2 Plasmid by Gene-Eluting Stents: an Alternative Strategy for Iinhibition of Restenosis. Circulation 2004, 110, 36−45. (21) Hanna, A. K.; Fox, J. C.; Neschis, D. G.; Safford, S. D.; Swain, J. L.; Golden, M. A. Antisense Basic Fibroblast Growth Factor Gene Transfer Reduces Neointimal Thickening after Arterial Injury. J. Vasc. Surg. 1997, 25, 320−325. (22) Deguchi, J.; Namba, T.; Hamada, H.; Nakaoka, T.; Abe, J.; Sato, O.; Miyata, T.; Makuuchi, M.; Kurokawa, K.; Takuwa, Y. Targeting Endogenous Platelet-Derived Growth Factor B-Chain by AdenovirusMediated Gene Transfer Potently Inhibits in vivo Smooth Muscle Proliferation after Arterial Injury. Gene Ther. 1999, 6, 956−965. (23) Sharif, F.; Hynes, S. O.; Crowley, J.; Daly, K.; O’Brien, T. Accelerated Re-Endothelialization in eNOS Transduced Iliac Artery Following Gene Delivery from an Adenoviral Eluting Stent. Mol. Ther. 2006, 13, S334−S335. (24) Grewe, P. H.; Deneke, T.; Machraoui, A.; Barmeyer, J.; Müller, K.-M. Acute and Chronic Tissue Response to Coronary Stent Implantation: Pathologic Findings in Human Specimen. J. Am. Coll. Cardiol. 2000, 35, 157−163. (25) Hedman, M.; Muona, K.; Hedman, A.; Kivela, A.; Syvanne, M.; Eränen, J.; Rantala, A.; Stjernvall, J.; Nieminen, M. S.; Hartikainen, J.; Ylä-Herttuala, S. Eight-Year Safety Follow-up of Coronary Artery Disease Patients after Local Intracoronary VEGF Gene Transfer. Gene Ther. 2009, 16, 629−634. (26) Ylä-Herttuala, S.; Rissanen, T. T.; Vajanto, I.; Hartikainen, J. Hartikainen. Vascular Endothelial Growth Factors: Biology and Current Status of Clinical Applications in Cardiovascular Medicine. J. Am. Coll. Cardiol. 2007, 49, 1015−1026. (27) Tang, C. J.; Wang, G. X.; Wu, X.; Li, Z. G.; Shen, Y.; Lee, J. C.; Yu, Q. S. The Impact of VEGF-Transfected Human Endothelial Cells on Endothelialization and Restenosis of Stainless Steel Stents. J. Vasc. Surg. 2011, 53, 461−471.

Universities (CQDXWL-2012-120, CQDXWL-2013-031, 2015CDJZR), and the National Key Technology R&D Program of China (2012BAI18B02). The authors thank Mr. Zhenggong Li (Chongqing Zhongshan Hospital, China) and Mr. Dingyuan Du (Chongqing Emergency Medical Center, China) for excellent technical assistance and also are thankful for the support of experimental instruments from the Public Experiment Center of State Bioindustrial Base (Chongqing), China.

■

REFERENCES

(1) Hu, T. Z.; Yang, J. L.; Cui, K.; Rao, Q.; Yin, T. Y.; Tan, L. L.; Zhang, Y.; Li, Z. G.; Wang, G. X. Controlled Slow-Release DrugEluting Stents for the Prevention of Coronary Restenosis: Recent Progress and Future Prospects. ACS Appl. Mater. Interfaces 2015, 7, 11695−11712. (2) Gruntzig, A. R.; Senning, A.; Siegenthaler, W. E. Nonoperative Dilatation of Coronary-Artery Stenosis: Percutaneous Transluminal Coronary Angioplasty. N. Engl. J. Med. 1979, 301, 61−68. (3) Sun, D. M.; Zheng, Y. M.; Yin, T. Y.; Tang, C. J.; Yu, Q. S.; Wang, G. X. Coronary Drug-Eluting Stents: From Design Optimization to Newer Strategies. J. Biomed. Mater. Res., Part A 2014, 102, 1625−1640. (4) Katz, G.; Harchandani, B.; Shah, B. Drug-Eluting Stents: the Past, Present, and Future. Curr. Atheroscler. Rep. 2015, 17, 485. (5) Li, Q. H.; Zhang, Q.; Zhi, Y.; Li, X. L.; Ji, H. G.; Yin, J. F.; Sun, Yi. Long-Term Effect of Second-Generation Drug-Eluting Stents for Coronary Artery Disease, Everolimus-Eluting Versus ZotarolimusEluting Stents: a Meta-Analysis. Coron. Artery. Dis. 2015, 26, 259−265. (6) Bittl, J. A.; Chew, D. P.; Topol, E. J.; Kong, D. F.; Califf, R. M. Meta-Analysis of Randomized Trials of Percutaneous Transluminal Coronary Angioplasty Versus Atherectomy, Cutting Balloon Atherotomy, or Laser Angioplasty. J. Am. Coll. Cardiol. 2004, 43, 936−942. (7) Serruys, P. W.; de Jaegere, P.; Kiemeneij, F.; Macaya, C.; Rutsch, W.; Heyndrickx, G.; Emanuelsson, H.; Marco, J.; Legrand, V.; Materne, P.; Belardi, Jorge.; Sigwart, U.; Colombo, A.; Goy, J. J.; Heuvel, P.; van den Delcan, J.; Morel, M. A Comparison of BalloonExpandable Stent Implantation with Balloon Angioplasty in Patients with Coronary Artery Disease. Benestent Study Group. N. Engl. J. Med. 1994, 331, 489−495. (8) Fischman, D. L.; Leon, M. B.; Baim, D. S.; Schatz, R. A.; Savage, M. P.; Penn, I.; Detre, K.; Veltri, L.; Ricci, D.; Nobuyoshi, M.; Cleman, M.; Heuser, R.; Almond, D.; Teirstein, P. S.; Fish, R. D.; Colombo, A.; Brinker, J.; Moses, J.; Shaknovich, A.; Hirshfeld, J.; Bailey, S.; Ellis, S.; Rake, R.; Goldberg, S. A Randomized Comparison of Coronary-Stent Placement and Balloon Angioplasty in the Treatment of Coronary Artery Disease. Stent Restenosis Study Investigators. N. Engl. J. Med. 1994, 331, 496−501. (9) Shuchman, M. Debating the Risks of Drug-Eluting Stents. N. Engl. J. Med. 2007, 356, 325−328. (10) Curfman, G. D.; Morrissey, S.; Jarcho, J. A.; Drazen, J. M. DrugEluting Coronary Stents-Promise and Uncertainty. N. Engl. J. Med. 2007, 356, 1059−1060. (11) Shuchman, M. Trading Restenosis for Thrombosis? New Question about Drug-Eluting Stents. N. Engl. J. Med. 2006, 355, 1949−1952. (12) Hauser, R. G.; Maron, B. J. Lessons from the Failure and Recall of an Implantable Cardioverter-Defibrillator. Circulation 2005, 112, 2040−2042. (13) Grines, C. L.; Bonow, R. O.; Casey, D. E.; Gardner, T. J.; Lockhart, P. B.; Moliterno, D. J.; O’Gara, P.; Whitlow, P. Prevention of Premature Discontinuation of Dual Antiplatelet Therapy in Patients with Coronary Artery Stents - A Science Advisory from the American Heart Association, American College of Cardiology, Society for Cardiovascular Angiography and Interventions, American College of Surgeons, and American Dental Association, with Representation from the American College of Physicians. Circulation 2007, 115, 813−818. (14) Nebeker, J. R.; Virmani, R.; Bennett, C. L.; Hoffman, J. M.; Samore, M. H.; Alvarez, J.; Davidson, C. J.; McKoy, J. M.; Raisch, D. K


Research Article

ACS Applied Materials & Interfaces (28) Johnson, B. F.; Clay, T. M.; Hobeika, A. C.; Lyerly, H. K.; Morse, M. A. Vascular Endothelial Growth Factor and Immunosuppression in Cancer: Current Knowledge and Potential for New Therapy. Expert Opin. Biol. Ther. 2007, 7, 449−460. (29) Fu, Q.; Deng, C. L.; Zhao, R. Y.; Wang, Y.; Cao, Y. The Effect of Mechanical Extension Stimulation Combined with Epithelial Cell Sorting on Outcomes of Implanted Tissue-Engineered Muscular Urethras. Biomaterials 2014, 35, 105−112. (30) Balaji, S.; King, A.; Crombleholme, T. M.; Keswani, S. G. The Role of Endothelial Progenitor Cells in Postnatal Vasculogenesis: Implications for Therapeutic Neovascularization and Wound Healing. Adv. Wound Care 2013, 2, 283−295.

L


Re-Endothelialization Study on Endovascular Stents Seeded by

Recommend Documents