Reactive Sulfur Species-Mediated Activation of the Keap1–Nrf2

Mar 25, 2015 - Environmental Biology Laboratory, Faculty of Medicine, University of ... Tohoku University School of Medicine, 2-1 Seiryo-cho, Aoba-ku,...
0 downloads 0 Views 3MB Size
Download PDF
Article pubs.acs.org/crt

Reactive Sulfur Species-Mediated Activation of the Keap1−Nrf2 Pathway by 1,2-Naphthoquinone through Sulfenic Acids Formation under Oxidative Stress Yasuhiro Shinkai,†,¶ Yumi Abiko,†,¶ Tomoaki Ida,‡ Takashi Miura,† Hidenao Kakehashi,† Isao Ishii,§ Motohiro Nishida,∥ Tomohiro Sawa,⊥ Takaaki Akaike,‡ and Yoshito Kumagai*,†,¶ †

Graduate School of Comprehensive Human Sciences, University of Tsukuba, 1-1-1 Tennodai, Tsukuba, Ibaraki 305-8575, Japan Environmental Biology Laboratory, Faculty of Medicine, University of Tsukuba, 1-1-1 Tennodai, Tsukuba, Ibaraki 305-8575, Japan ‡ Laboratory of Environmental Health Sciences, Tohoku University School of Medicine, 2-1 Seiryo-cho, Aoba-ku, Sendai 980-8575, Japan § Department of Biochemistry, Graduate School of Pharmaceutical Sciences, Keio University, 1-5-30 Shibakoen, Minato-ku, Tokyo 105-8512, Japan ∥ Division of Cardiocirculatory Signaling, Okazaki Institute for Integrative Bioscience, 5-1 Higashiyama, Myodaiji-cho, Okazaki, Aichi 444-8787, Japan ⊥ Department of Microbiology, Graduate School of Medical Sciences, Kumamoto University, 1-1-1 Honjo, Kumamoto 860-8556, Japan ¶

S Supporting Information *

ABSTRACT: Sulfhydration by a hydrogen sulfide anion and electrophile thiolation by reactive sulfur species (RSS) such as persulfides/ polysulfides (e.g., R-S-SH/R-S-Sn-H(R)) are unique reactions in electrophilic signaling. Using 1,2-dihydroxynaphthalene-4-thioacetate (1,2-NQH2-SAc) as a precursor to 1,2-dihydroxynaphthalene-4-thiol (1,2-NQH2-SH) and a generator of reactive oxygen species (ROS), we demonstrate that protein thiols can be modified by a reactive sulfenic acid to form disulfide adducts that undergo rapid cleavage in the presence of glutathione (GSH). As expected, 1,2-NQH2-SAc is rapidly hydrolyzed and partially oxidized to yield 1,2-NQ-SH, resulting in a redox cycling reaction that produces ROS through a chemical disproportionation reaction. The sulfenic acid forms of 1,2-NQ-SH and 1,2-NQH2-SH were detected by derivatization experiments with dimedone. 1,2-NQH2-SOH modified Keap1 at Cys171 to produce a Keap1-S-S-1,2-NQH2 adduct. Subsequent exposure of A431 cells to 1,2-NQ or 1,2-NQH2-SAc caused an extensive chemical modification of cellular proteins in both cases. Protein adduction by 1,2-NQ through a thio ether (C−S−C) bond slowly declined through a GSH-dependent S-transarylation reaction, whereas that originating from 1,2-NQH2-SAc through a disulfide (C−S−S−C) bond was rapidly restored to the free protein thiol in the cells. Under these conditions, 1,2-NQH2-SAc activated Nrf2 and upregulated its target genes, which were enhanced by pretreatment with buthionine sulfoximine (BSO), to deplete cellular GSH. Pretreatment of catalase conjugated with poly(ethylene glycol) suppressed Nrf2 activation by 1,2-NQH2-SAc. These results suggest that RSS-mediated reversible electrophilic signaling takes place through sulfenic acids formation under oxidative stress.

■

INTRODUCTION Electrophiles are known to activate different cell signaling pathways by covalent modification of key regulatory proteins.1,2 1,2-Naphthoquinone (1,2-NQ) is a reactive chemical found in the atmosphere3 that has two biologically relevant chemical properties: (1) as an electrophile, it covalently binds to reactive nucleophilic functions (e.g., cysteine thiols and histidine imidazoles) in proteins as well as lower molecular weight compounds; (2) as a prooxidant, it generates reactive oxygen species (ROS) by redox cycling using available electron sources.4 We found that 1,2-NQ activates the transcription factor, NF-E2-related factor-2 (Nrf2), and the epidermal © XXXX American Chemical Society

growth factor receptor (EGFR) via covalent modification of reactive thiols of Kelch-like ECH-associated protein 1 (Keap1) and protein tyrosine phosphatase 1B (PTP1B), respectively, but not by production of ROS.5,6 Protection of cellular proteins against these actions can be provided by glutathione (GSH), which acts as an alternate nucleophile that conjugates electrophiles.7 Hydrogen sulfide (H2S) is proposed to be a signaling molecule.8,9 We discovered that the sulfhydration of electroReceived: October 14, 2014

A

DOI: 10.1021/tx500416y Chem. Res. Toxicol. XXXX, XXX, XXX−XXX

Article

Chemical Research in Toxicology philes by H2S anion (HS−) acts as a modulator of electrophilic signaling.10,11 Notably, we recently found that Cys hydropersulfide rather than H2S is synthesized from cystine by cystathione β-synthase (CBS) and cystathione γ-lyase (CSE)catalyzed reactions, which, in turn, contribute to the production of gluthathione hydropersulfide and other polysulfide derivatives. These reactive sulfur species (RSS), like HS−, also undergo facile electrophile thiolation reactions,12,13 as also mentioned by others.14 In this context, electrophiles such as 1,2-NQ can react with HS− to form the corresponding catechol-thiol (1,2-NQH2-SH) that readily undergoes autoxidation to yield 1,2-NQ-SH and the thio ether of 1,2-NQ (1,2NQ-S-1,2-NQ).10 Similar sulfur adducts of 1,2-NQ are also formed (Shinkai et al., unpublished observation) when GS-SSG was used as a model for endogenous polysulfide produced by CBS/CSE,13 suggesting that not only HS− but also polysulfides act as nucleophiles that react with electrophiles such as 1,2-NQ to form 1,2-NQH2-SH. This reaction can serve as an alternative metabolic pathway of quinones. Because the initial products of quinones with HS− are hydroquinones, there is a net loss of electrophilic sites, and the covalent modification of cellular proteins associated with electrophilic signaling is decreased.10 Sulfenic acid (R-SOH) is the initial oxidation product of a thiol formed by an oxidizing agents such as hydrogen peroxide (H2O2).14−16 We previously reported that redox cycling between 9,10-phenanthraquinone and its two-electron reduction metabolite 9,10-dihydroxyphenanthraquinone is associated with oxidative stress.17 On the basis of these reaction sequences, a redox cycling reaction between 1,2-NQH2-SH and 1,2-NQ-SH is also possible that yields ROS. The H2O2 produced in such a chemical disproportionation reaction can covert 1,2-NQH2-SH to its sulfenic acid form. The sulfenic acid can, in turn, react with a protein thiol to form a disulfide by displacement of the hydroxyl group. Herein, we describe a study investigating this possibility, i.e., whether 1,2-NQH2-SOH can modify Keap1 by disulfide bond formation and activate the Nrf2-antioxidant response element (ARE) pathway in human epithelial A431 cells. Because 1,2-NQH2-SH is highly reactive under physiological conditions, we synthesized 1,2-dihydroxynaphthalene-4-thioacetate (1,2-NQH2-SAc) as its precursor. Since 1,2-NQH2-SAc undergoes hydrolysis, forming 1,2-NQH2SH, the generated hydrogen peroxide can convert some of the thiol to its corresponding sulfenic acid. We then examined the reaction of the resulting mixture with cellular proteins and its reversibility. The current findings indicate that 1,2-NQH2-SOH is capable of activating the Keap1−Nrf2 pathway through disulfide-based modification of Keap1 and that such modification is readily restored by cellular GSH.

■

Technology (Beverly, MA, USA). Polyclonal antibody to 1,2-NQ was prepared as reported previously.18 All other reagents used were of the highest purity available. Synthesis of 1,2-NQH2-SAc. 1,2-NQ (500 mg) was dissolved in acetonitrile (200 mL), followed by addition of thioacetic acid (250 μL) using a gas-tight syringe. The resulting mixture was stirred at RT for 10 min. The reaction was quenched by the addition of HCl(aq) (1 N), the mixture was filtered, and the residue was washed with CHCl3 and HCl(aq). The resulting solid was purified by preparative column chromatography using an Ultra Pack ODS-S-50B (300 × 26 mm i.d., 50 μm, Yamazen Science Inc., Osaka, Japan) and eluted with 30% acetonitrile, 0.1% formic acid at a flow rate of 3 mL/min. The fractions containing the product, characterized by UV at 238 nm, were collected and then evaporated to dryness in vacuo. The purified 1,2-NQH2-SAc, a white needle-like solid, was stored at −80 °C before use. 1H NMR analysis was performed for identification purposes (Figure S1): 1H NMR (500 MHz, CDCl3): δ 8.12 (d, J = 8.3 Hz, 1H), 8.07 (d, J = 8.3 Hz, 1H), 7.505 (t, J = 7.5 Hz, 1H), 7.45 (t, J = 7.6 Hz, 1H), 7.32 (s, 1H), 5.82 (s, 1H), 5.36 (s, 1H), 2.5 (s, 3H). Preparation of Catalase Conjugated with Poly(ethylene glycol) (PEG−CAT). CAT conjugated with PEG was prepared as previously described.19 Briefly, PEG (30 g) was dissolved in 200 mL of 1,4-dioxane and mixed with 1,1′-carbonyldiimidazole (16.2 g). After the solution was incubated at room temperature for 1 h, the reaction mixture was dialyzed with Spectra/Por membranes MWCO 2000 (Funakoshi Co. Ltd., Tokyo, Japan) against 5 L of distilled deionized water four times at 4 °C for 12 h, and then the dialyzed PEG was lyophilized. The resulting activated PEG (26 g) was incubated with CAT (0.5 g) in 20 mL of 0.1 M sodium borate buffer (pH 8.5) at 4 °C for 6 h. 2-Aminoethanol (1.22 g) was added into the mixture to mask unreacted groups of activated PEG bound to CAT, and the mixture was incubated at 4 °C for 2 h. The components in the reaction mixture other than PEG−CAT were removed by an Amicon ultrafiltration system with XM300 (Millipore, Billerica, MA, USA). The concentrated solution was lyophilized, and the final preparation of PEG− CAT (15 647 U/mg of protein) was stored at −20 °C. HPLC. To examine the degradation of 1,2-NQH2-SAc, an HPLC system (Shimadzu, Kyoto, Japan) with a UV detector at 238 nm was used. The sample was loaded onto a C18 YMC HPLC column (250 mm × 4.6 mm, i.d.) (YMC, Kyoto, Japan) equipped with a guard column (17 mm × 4.6 mm i.d.). The mobile phase consisted of acetonitrile/water (1:1) containing 0.1% formic acid. The flow rate was fixed at 1 mL/min. After determination of 1,2-NQH2-SAc concentration, the data were fit to a single-exponent decay model to estimate the half-life by nonlinear regression procedures (Prism software, La Jolla, CA, USA). Intracellular GSH content was measured as described by Vignaud et al.20 with slight modifications using an HPLC system (Shimadzu) linked to a coulometric detector (Coulochem II; ESA, Cergy, France). Cells were washed twice with PBS and collected in 1 mM EDTA. After sonication, protein concentrations were measured by BCA protein assay. Cell lysates were filtered by using an Ultrafree-MC 5000 MW filter unit (Millipore, Billerica, MA, USA) and then mixed with the mobile phase to 50%. Ten microliter samples were loaded onto a C18 YMC HPLC column (250 mm × 4.6 mm, i.d.) (YMC) equipped with a guard column (17 mm × 4.6 mm i.d.). Elution was performed isocratically, with 98% of the mobile phase containing a 20 mM ammonium phosphate solution adjusted to pH 2.5 with orthophosphoric acid and the remaining 2% of the mobile phase containing acetonitrile. The flow rate was fixed at 0.6 mL/min. H2O2 Detection. H2O2 was determined as previously described with slight modification.21 Briefly, 1,2-NQH2-SAc (100 μM) was incubated with 2.4 mM ferrous ammonium sulfate in 0.3 M potassium thiocyanate at room temperature, and then the absorption of each sample at 480 nm was measured. H2O2 was used as the calibration standard. LC-MS. For determination of 1,2-NQH2-SAc and its related compounds, UPLC-MSE analysis was performed using an Acquity UPLC system (Waters, Milford, MA, USA) equipped with an Acquity UPLC BEH C18 column (2.1 mm × 50 mm i.d., 1.7 μm) held at 40 °C

EXPERIMENTAL PROCEDURES

Materials. 1,2-NQ, 1,2-NQH2, and 2-aminoethanol were obtained from Tokyo Chemical Industries Co. (Tokyo, Japan). Buthionine sulfoximine (BSO), dihydroethidium (DHE), and 1,4-dioxane were obtained from Wako (Osaka, Japan). Poly(ethylene glycol) 4000 (PEG) and 1,1′-carbonyldiimidazole were obtained from Nacalai (Kyoto, Japan). Dimedone, catalase (CAT) from bovine liver and antiactin antibody were purchased from Sigma-Aldrich (St. Louis, MO, USA). Anti-Nrf2 antibody was obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Anti-hemeoxygenase-1 (HO-1) antibody was purchased from Stressgen (Victoria, BC, Canada). Anti-xCT antibody was purchased from Abcam (Cambridge, MA, USA). Horseradish peroxidase (HRP)-conjugated anti-rabbit IgG and antimouse IgG secondary antibodies were obtained from Cell Signaling B

DOI: 10.1021/tx500416y Chem. Res. Toxicol. XXXX, XXX, XXX−XXX

Article

Chemical Research in Toxicology Table 1. Human Gene-Specific Primers for Quantitative Real-Time RT-PCR gene

forward primer (5′→3′)

reverse primer (5′→3′)

product size (bp)

Nrf2 HO-1 GCLC xCT B2M

CAGTCAGCGACGGAAAGAGTATGA GCCACCAAGTTCAAGCAGCTCTA ATCTACGAACAGCTGTTGCAGGAA ATGTCCGCAAGCACACTCCTCTA GGGTTTCATCCATCCGACATTG

GGCTGGCTGAATTGGGAGAA AGCAGCTCCTGCAACTCCTCAA ATTGTCTGCCAATTTGTGGACTGA TCGAAGATAAATCAGCCCAGCAA GTTCACACGGCAGGCATACTCA

151 139 167 158 165

in direct injection mode. The elution conditions are described in the legend, and the flow rate was fixed at 0.3 mL/min. The total running time, including the conditioning of the column to the initial conditions, was 15 min. The eluted chemical compounds were then transferred to the electrospray source of a Synapt HDMS system. ESI was used with a capillary voltage of 2.8 kV, sampling cone voltage of 35 V, and transfer cone voltage of 4 V (low). Low (6 eV) or elevated (steps from 20 to 30 eV) collision energies were used to generate either intact precursor ions (low energy) or product ions (elevated energy). The source temperature was 80 °C, and the detector was operated in negative ion mode. Data were collected from m/z 50 to 1000 using an independent reference spray via a LockSpray interference with leucine enkephalin [M − H]− ion as the lock mass (m/z 554.2615) to ensure accuracy and reproducibility. Data were analyzed with MassLynx, version 4.1, software and MassFragment, version 1.1, software. For high-resolution mass analysis, LC-Q-time-of-flight (TOF)-MS was used with an Agilent 6510 Q-TOF mass spectrometer (Agilent Technologies) and an HPLC chip-MS system consisting of a nano pump (G2226A; Agilent) with a four-channel microvacuum degasser (G1379B; Agilent) and a microfluidic chip cube (G4240; Agilent). Samples were separated on a reverse-phase (RP)-HPLC chip (43 mm × 75 μm i.d.; Zorbax 300SB-C18, Agilent) with mobile phases A (0.1% formic acid) and B (acetonitrile) by applying a linear gradient from 5 to 90% B in 7 min and a flow rate of 600 nL/min. The capillary pump was used for loading samples with mobile phase A at 4 μL/min. The ESI-Q-TOF instrument was operated in negative ionization mode with an ionization voltage of 1800 V and a fragmentor voltage of 175 V at 300 °C. The selected m/z ranges were 200−400 Da in the MS mode, and the instrument setting was 4 s−1 for the MS scan rate. Recombinant mouse Keap1 (10 μM) was incubated with DMSO or 1,2-NQH2-SAc (50 μM) for 30 min at 25 °C in 100 mM Tris-HCl (pH 8). Native and 1,2-NQ-S-modified mouse Keap1 were alkylated at 25 °C in the dark for 45 min with 2-iodoacetamide (55 mM) in 50 mM ammonium bicarbonate and rinsed with 400 μL of washing solution twice for 10 min. The resulting protein was subjected to SDSPAGE, and the rinsed gel band was then dehydrated using acetonitrile. Murine Keap1 was digested with 10 μL of MS-grade modified trypsin (Promega, Madison, WI, uSA) (trypsin/Keap1 ratio = 1:50) for 16 h at 37 °C. The resulting peptide was extracted from the gel by adding 5 μL of acetonitrile/trifluoroacetic acid/water (50:0.1:49.9 v/v/v) and incubating for 15 min followed by transfer to a sample vial. Analyses were performed by using a nanoAcquity UPLC system (Waters Co., Milford, MA, USA) equipped with a BEH130 nanoAcquity C18 column (100 mm × 75 μm i.d., 1.7 μm) held at 35 °C in the direct injection mode. Mobile phases A [water containing 0.1% (v/v) formic acid] and B [acetonitrile containing 0.1% (v/v) formic acid] were linearly mixed by using a gradient program, and the instrument was calibrated immediately prior to each series of experiments. The flow rate was 0.3 μL/min, and the mobile phase composition was 1% B for 1 min, linear increase over 120 min to 40% B, linear increase over 1 min to 95% B, and maintain at 95% B for 4 min before returning linearly to 1% B over 10 min. The total running time, including conditioning the column to the initial conditions, was 130 min. The eluted peptides were then transferred to the nanoElectroSpray source of a Q-TOF mass spectrometer (Synapt high definition mass spectrometry system, Waters) through a Teflon capillary union and a precut PicoTip (Waters). The system control and analysis of the mass spectra were performed by using Waters MassLynx software, version 4.1. Electrospray ionization was used with a capillary voltage of

2.8 kV and a sampling cone voltage of 35 V. Low (6 eV) or elevated (step from 15−60 eV) collision energy was used to generate either intact peptide precursor ions (low energy) or peptide product ions (elevated energy). The source temperature was 80 °C, and the detector was operated in positive ion mode. Data were collected in centroid mode from m/z 50 to 1990. All analyses were acquired with an independent reference. Glu-1-fibrinopeptide B (m/z 785.8426) was infused via the NanoLockSpray ion source and sampled every 10 s as the external mass calibrant. Biopharmlynx, version 1.2, software (Waters) was used for baseline subtraction and smoothing, deisotoping, de novo peptide sequence identification, and database searches. Cell Culture and Treatment. Human epithelial carcinoma cell line A431 (ATCC, Manassas, VA, USA) was cultured in a humidified atmosphere of 5% CO2 at 37 °C using Dulbecco’s modified Eagle’s medium (Wako, Osaka, Japan) supplemented with 10% fetal bovine serum, 2 mM L-alanyl-L-glutamine, and antibiotics (100 U/mL penicillin and 100 μg/mL streptomycin). Before treatment, cells were cultured in serum-free medium overnight and then treated with each chemical. ROS Production. Intracellular ROS was detected by using DHE.22 For measurement of fluorescent images, A431 cells were seeded in collagen-coated 8-well glass chamber slides at a density of 1.5 × 105 cells/cm2. Cells were treated with or without DHE (20 μM) for 30 min in phenolred-free DMEM, followed by exposure to 1,2-NQH2SAc (10 or 20 μM) or 1,2-NQ (10 or 20 μM) for 10 min in PBS. After washing, the fluorescent cell images were observed by using a Nikon C2 confocal laser microscope (Nikon, Tokyo, Japan), with an excitation wavelength of 488 nm and an emission wavelength of 575−615 nm. For measurement of fluorescence intensity, A431 cells were seeded in 96-well black plate at a density of 1 × 105 cells/cm2. Cells were treated with or without DHE (20 μM) for 30 min in phenol red-free DMEM, followed by exposure to 1,2-NQH2-SAc (10 or 20 μM) or 1,2-NQ (10 or 20 μM) for 10 min in PBS. After washing, the fluorescence (λex = 518 nm; λem = 605 nm) was monitored by a plate reader (Varioskan, Thermo scientific, Waltham, MA, USA). Enzyme-Linked Immunosorbent Assay (ELISA). Cross-reactivity of the polyclonal antibody against 1,2-NQ toward 1,2-NQH2 was evaluated by ELISA. Maxisorp 96-well plates (Nunc, Roskilde, Denmark) were coated with 100 μL/well of 50 mM carbonate buffer (pH 9.6) containing 1 μg/mL of 1,2-NQ-modified bovine serum albumin (BSA) for 3 h at room temperature. After washing with PBS, PBS containing 1% BSA (50 μL/well) was added to the wells and incubated for 30 min. Then, the wells were probed with 100 μL/well of the diluted antibodies against 1,2-NQ, which were pretreated with or without 1,2-NQ (500 μM) or 1,2-NQH2 (500 μM) for 1 h at 37 °C. After washing with phosphate-buffered saline containing 0.05% Tween 20 (TPBS) two times, 50 μL/well of HRP-conjugated goat anti-rabbit IgG at a dilution of 1:2500 was added to each well and incubated for 30 min at room temperature. After another three washes with TPBS, ABTS ELISA HRP substrate (KPL, Gaithersburg, MD) was prepared according to the manufacturer’s instructions, 50 μL/well was added, and the plate was incubated at room temperature for 30 min, followed by incubation with 1% SDS (50 μL/well); signals were read in a plate reader at 405 nm. Real-Time Polymerase Chain Reaction (PCR). Total RNA was extracted using the RNeasy mini kit (Qiagen, Valencia, CA, USA), and cDNA was synthesized from the mRNA using the high capacity RNAto-cDNA kit (Applied Biosystems, Foster, CA, USA). Real-time PCR was performed using Power SYBR Green PCR master mix (Applied C

DOI: 10.1021/tx500416y Chem. Res. Toxicol. XXXX, XXX, XXX−XXX

Article

Chemical Research in Toxicology

Figure 1. Hydrolysis of 1,2-NQH2-SAc to form 1,2-NQ-SH. (A) Structure of 1,2-NQH2-SAc and 1,2-NQ-SH and their fragmentation pattern. (B) Time-dependent degradation of 1,2-NQH2-SAc. 1,2-NQH2-SAc (40, 20, 10, or 5 mM) was incubated in PBS buffer for 0.5, 1, 2, 5, 8, 10, or 20 min. (C) 1,2-NQH2-SAc was dissolved in acetonitrile containing 0.1% (v/v) formic acid and was then immediately analyzed by UPLC-MSE. Mobile phases A (0.1% formic acid) and B (100% acetonitrile) at 0.3 mL/min were linearly mixed using a gradient system as shown by the dotted line. The total ion monitoring chromatogram of 1,2-NQH2-SAc (left), the MS spectrum (middle), and MSE spectrum (right) of the peak with a retention time of 6.3 min are also shown. The peak at 190 in the MS spectrum results from an in-source fragmentation of 233. (D) 1,2-NQH2-SAc was dissolved in acetonitrile containing 5 mM ammonium formate and was then immediately analyzed by UPLC-MSE. Mobile phases A (5 mM ammonium formate) and B (100% acetonitrile) at 0.3 mL/min were linearly mixed using a gradient system as shown by the dotted line. The total ion monitoring chromatogram of 1,2-NQH2-SAc and its related compound (left) and the MS spectrum (middle) and MSE spectrum (right) of the new peak with a retention time of 5.4 min are also shown. Biosystems) with 0.6 μg of cDNA and 0.2 μM primers (Table 1) on a 7500 real time PCR system (Applied Biosystems). Thermal cycling parameters were 50 °C for 2 min, 95 °C for 10 min, and 40 cycles of 95 °C for 15 s and 60 °C for 1 min. Melting curve analysis and agarose gel electrophoresis with ethidium bromide staining was conducted to ensure a single PCR product of correct amplicon length. Levels of Nrf2, HO-1, glutamate cysteine ligase catalytic subunit (GCLC), cystine transporter (xCT), and beta-2 microglobulin (B2M) mRNA in each RNA sample were quantified by the relative standard curve method. Fold-change for each gene was assessed after normalization of the intensity value to B2M. Western Blotting. After treatment, cells were washed twice with ice-cold PBS(−). Total cell proteins were prepared by lysis in sodium dodecyl sulfate (SDS) sample buffer (50 mM Tris-HCl, pH 6.8, 2% SDS, 10% glycerol), followed by incubation at 95 °C for 10 min. We determined protein concentration using a BCA protein assay reagent kit (Pierce) before 2-mercaptoethanol and bromophenol-blue were added to each sample. The cellular proteins were separated by SDSpolyacrylamide gel electrophoresis (PAGE) on a polyacrylamide gel and electrotransferred onto a poly(vinyl difluoride) (PVDF) membrane (Bio-Rad, Hercules, CA, USA) at 2 mA/cm2 for 1 h, according to the method of Kyhse-Anderson.23 Membranes were blocked with 5% skim milk in TTBS (20 mM Tris-HCl, pH 7.5, 150

mM NaCl, 0.1% Tween 20) and then incubated with primary antibodies for 1 h at room temperature. The membranes were washed and then incubated with HRP-conjugated secondary antibodies for 1 h at room temperature. Immunoreactive bands were visualized by enhanced chemiluminescence (Chemi-Lumi One L; Nacalai Tesque) and scanned using LAS 3000 (Fujifilm, Tokyo, Japan). Representative blots are shown from at least two independent experiments.

■

RESULTS Precursor of 1,2-NQH2-SH and Its Reactivity. Because of the high reactivity of 1,2-NQH2-SH under physiological conditions, we prepared 1,2-NQH2-SAc as its precursor (Figure 1A). 1,2-NQH2-SAc was stable under acidic conditions (Figure S2A), but incubation with 0.2 M potassium phosphate buffer (pH 7.5) at 25 °C caused decay with a half-life of 4.4 ± 0.27 min (Figure 1B). However, LC-MSE data analysis was consistent with the formation of 1,2-NQ-SH, with a molecular mass of m/z = 189 and a fragment mass of m/z = 161 (Figure 1C,D). These data indicates that 1,2-NQH2-SAc undergoes hydrolysis to form 1,2-NQH2-SH and that some of this thiol adduct is partially oxidized to 1,2-NQ-SH. Once 1,2-NQ-SH is D

DOI: 10.1021/tx500416y Chem. Res. Toxicol. XXXX, XXX, XXX−XXX

Article

Chemical Research in Toxicology

Figure 2. Production of ROS by 1,2-NQH2-SAc and 1,2-NQ. (A) Scheme of 1,2-NQH2-SH-mediated redox cycling and production of ROS. (B) Time-dependent production of H2O2 by 1,2-NQH2-SH. H2O2 production was measured during incubation of 1,2-NQH2-SAc (100 μM) in water for 5 min. Each value represents the average of duplicate determinations. (C) DHE-induced fluorescence imaging of A431 cultured cells (scale bars: 50 μm). A431 cells were treated with 20 μM DHE followed by exposure to the indicated concentrations of 1,2-NQH2-SAc, 1,2-NQ, or H2O2 for 10 min. (D) Measurement of DHE-induced fluorescence intensity in A431 cultured cells using a fluorescent plate reader. A431 cells were treated with 20 μM DHE followed by exposure to the indicated concentrations of 1,2-NQH2-SAc, 1,2-NQ, or H2O2 for 10 min. Each value represents the mean ± SE of five independent experiments. *p < 0.05 and **p < 0.01 compared with control.

oxidative stress interacts with protein thiols as well in cells during 1,2-NQH2-SAc exposure. Covalent Modification of Cysteine Residues in Keap1 by 1,2-NQH2-SH. We previously found that 1,2-NQ is covalently bound to a variety of redox sensor proteins with their reactive cysteine residues (e.g., PTP1B, Keap1, cAMP response element binding protein, and ubiquitin C-terminal hydrolase 1) by forming protein−1,2-NQH2 adducts in which the 1,2-NQH2 moiety is rapidly oxidized to 1,2-NQ.5,6,25,26 Then, the modified protein thiols with pKa values less than 7 bound to 1,2-NQ undergo S-transarylation by cellular GSH with a pKa value of 9.12, thereby regenerating the protein thiols and forming a 1,2-NQ-SG adduct.26,27 As a result, covalent modification of cellular proteins mediated by 1,2-NQ through a C−S bond slowly diminished (Figure 5A). In contrast, incubation of 1,2-NQH2-SAc alone in 0.2 M potassium phosphate buffer (pH 7.5) at 25 °C for 1, 90, or 180 min generated the symmetrical disulfide 1,2-NQH2-S-S-1,2-NQH2 with a molecular mass of m/z = 381 and fragment masses of m/ z = 190 and 161 (Figure S2B,C), which presumably occurred during the interaction of 1,2-NQH2-SH with its sulfenic acid form. This suggests that the structure of the modification site on redox sensor proteins is 1,2-NQH2 rather than 1,2-NQ. For these reasons, we next explored whether the generated 1,2-NQH2-SOH could modify cellular proteins bound to 1,2NQH2 through a S−S bond. To confirm the cross-reactivity of an anti-1,2-NQ antibody that we prepared18 toward 1,2-NQH2 adducts, an ELISA assay was performed. Incubation of anti-1,2NQ antibody with 1,2-NQH2 decreased immunoreactivity against 1,2-NQ-BSA adducts with a lower effect than 1,2-NQ (Figure 4A), indicating that anti-1,2-NQ antibodies can weakly recognize 1,2-NQH2. Thus, 1,2-NQH2-SAc was incubated with

produced from 1,2-NQH2-SH, a disproportionation reaction between them occurs to form semiquinone radicals, leading to a redox cycling reaction with molecular oxygen to yield ROS such as superoxide that is, in turn, reduced to H2O2 (Figure 2A).17 In fact, incubation of 1,2-NQH2-SAc (100 μM) produced H2O2 in a time-dependent manner (Figure 2B). Exposure of A431 cells to 1,2-NQH2-SAc as well as 1,2-NQ significantly increased cellular ROS levels in a concentration-dependent manner, as evaluated by a fluorescent probe DHE (Figure 2C,D). If the thiol groups of 1,2-NQ-SH or 1,2-NQH2-SH are oxidized by ROS, then 1,2-NQ-SOH and 1,2-NQH2-SOH would be produced. To address this, 1,2-NQH2-SAc was incubated with dimedone.16 As shown in Figure 3, new peaks identical to a 1,2NQH2-S-dimedone adduct (3.0 min) with a molecular mass of m/z = 329 and fragment masses of m/z = 251 and 201 and a 1,2-NQ-S-dimedone adduct (4.4 min) with a molecular mass of m/z = 327 and fragment masses of m/z = 189 and 160 were identified. Furthermore, high-resolution mass analysis was performed to confirm the formation of such dimedone adducts. Consistent with UPLC-MS analysis, incubation of 1,2-NQH2SAc and dimedone produced new ion peaks at 329.1039 and 327.0706, suggesting that the compositions of these products are C18H18O4S and C18H16O4S, respectively, which corresponds to the 1,2-NQH2-S-dimedone and 1,2-NQ-S-dimedone adducts (Figure S4). These results suggest that 1,2-NQ-SH and 1,2NQH2-SH undergo oxidation by H2O2 to yield these sulfenic acids. We then examined the reaction of 1,2-NQH2-SAc with GSH as a model for protein thiol and identified 1,2-NQH2-SSG among the reaction products (Figure S3), indicating that Sglutathionylation24 occurred through sulfenic acid formation. In other words, this suggests that the 1,2-NQ-SOH formed under E

DOI: 10.1021/tx500416y Chem. Res. Toxicol. XXXX, XXX, XXX−XXX

Article

Chemical Research in Toxicology

Figure 3. Trap of the sulfenic acid form of 1,2-NQH2-SH and 1,2-NQ-SH by dimedone. Mobile phases A (0.1% formic acid) and B (100% acetonitrile with 0.1% formic acid) at 0.3 mL/min were linearly mixed using a gradient system as follows: 20% B for 2 min and linear increase over 6 min to 80% B. (A) Total ion monitoring chromatogram of authentic 1,2-NQH2-SAc and its structure. (B) Total ion monitoring chromatogram of authentic dimedone and its structure. (C) Total ion monitoring chromatogram of the reaction mixture of 1,2-NQH2-SAc and dimedone. 1,2-NQH2SAc (0.1 mM) was incubated with 1 mM dimedone in 100 mM KPi (pH 7.5) at 25 °C for 10 min. Aliquots (10 μL) of the reaction mixture were subjected to UPLC-MSE to detect derivatives of the dimedone complex. The molecular and fragment ion masses are also shown.

recombinant mouse Keap128 as a model redox sensor protein, and the reaction products were analyzed by western blotting and LC-MSE. Immunoblot analysis with an antibody against the 1,2-NQ moiety18 showed that conjugation of Keap1 thiols with 1,2-NQH2-SAc occurred (Figure 4B), and addition of GSH to the incubation mixture of Keap1-S-S-1,2-NQH2 adduct caused a reduction in modified Keap1 (Figure 4C), which was associated with recovery of intact Keap1.27 The MS data indicated that Keap1 was modified at Cys171 (Figure 4D and Table 2), whereas modification sites of Keap1 by 1,2-NQ were found to be Cys151, Cys273, and Cys288.6 Covalent Modification of Cellular Proteins and Nrf2 Activation by 1,2-NQH2-SH. Since we had shown that covalent modification of Keap1 by 1,2-NQ activates Nrf2,6 we thought that 1,2-NQH2-SOH, through formation of a disulfidebased adduct, could also modulate the Keap−Nrf2 system in cells. To compare thio ether-based and sulfenic acid-based modifications of cellular proteins, A431 cells were exposed to 1,2-NQ or 1,2-NQH2-SAc in separate incubations, resulting in extensive chemical modification of cellular proteins in both cases. Although protein adduction by exposure to 1,2-NQ was slowly decreased, that from 1,2-NQH2-SAc reached a peak at 6 min after exposure and then declined rapidly (Figure 5A). Collectively, it is suggested that Nrf2 activation by 1,2-NQH2-

SAc is transient, whereas 1,2-NQ-mediated activation persists for at least 9 h (Figure 5A). Furthermore, 1,2-NQH2-SAc activates Nrf2 in a time- and concentration-dependent manner (Figure 5B) without affecting Nrf2 mRNA levels (Figure 5C) and upregulated Nrf2 target genes such as HO-1, GCLC, and xCT (Figure 5C). 1,2-NQH2-SAc also significantly increased the protein expression of HO-1 and xCT in a concentrationdependent manner, although the induction rate of HO-1 was lower than that caused by 1,2-NQ exposure (Figure S5). To examine the contribution of ROS to Nrf2 activation mediated by both 1,2-NQH2-SAc and 1,2-NQ, PEG−CAT was used. Pretreatment with PEG−CAT scavenged cellular ROS levels (Figure S6) and decreased Nrf2 activation caused by 1,2NQH2-SAc exposure (Figure 6). On the other hand, PEG− CAT did not suppress 1,2-NQ-dependent activation of Nrf2 (Figure 6), as reported previously.6 Because the activation of Nrf2 by exposure to H2O2 alone (2 mM) was minimal (Figure 6), both ROS and the HS conjugate of the electrophile play an important role in Nrf2 activation by 1,2-NQH2-SAc. To examine the contribution of GSH to Nrf2 activation by 1,2-NQH2-SAc, BSO was used. Pretreatment with 1 mM BSO for 24 h decreased cellular GSH content in A431 cells (Figure 7A). Under these conditions, covalent modification of cellular proteins and the activation of the Nrf2 pathway caused by 1,2F

DOI: 10.1021/tx500416y Chem. Res. Toxicol. XXXX, XXX, XXX−XXX

Article

Chemical Research in Toxicology

Figure 4. Covalent modification of Keap1 and its cysteine residue sites by 1,2-NQH2-SAc. (A) Cross-reactivity of a polyclonal antibody against 1,2NQ toward 1,2-NQH2. Anti-1,2-NQ antibodies (50 μg/mL) were preincubated with or without 1,2-NQ (500 μM) or 1,2-NQH2 (500 μM) for 1 h at 37 °C. The resulting antibodies were subjected to ELISA. (B) Covalent modification of recombinant Keap1 by 1,2-NQ or 1,2-NQH2-SAc. Recombinant mouse Keap1 (1 μg) was incubated with 1,2-NQ (1 or 5 μM) or 1,2-NQH2-SAc (1 or 5 μM) in 100 mM Tris-HCl (pH 7.5) for 30 min. The resulting protein was subjected to SDS-PAGE without 2-mercaptoethanol and detected by western blotting with the antibody against 1,2NQ. (C) GSH-mediated restoration of covalent modification by 1,2-NQH2-SAc in Keap1 protein. Recombinant mouse Keap1 (2 μg) was incubated with 1,2-NQH2-SAc (20 μM) for 10 min followed by incubation with GSH (1 or 10 mM) for 30 min in 100 mM Tris-HCl (pH 7.5). The resulting protein was subjected to SDS-PAGE without 2-mercaptoethanol and detected by western blotting with the antibody against 1,2-NQ. (D) Identification of 1,2-NQ-S-modified cysteine residue sites in Keap1 using UPLC-MSE. Recombinant mouse Keap1 protein (10 μM) was reacted with 50 μM 1,2-NQH2-SAc in 0.1 M Tris-HCl (pH 7.5) for 30 min. The 1,2-NQH2-SAc-treated Keap1 was digested with trypsin and analyzed by using UPLC-MSE as described in the Experimental Procedures. The corresponding MSE data are shown in Table 2.

Table 2. MSE Data of the 1,2-NQH2-S-Modified Peptide from Mouse Keap1a assignment

calculated MS

observed MS

analyte modifiers

b15* b22 y2 y3 y4 a16* a17*

1779.73 2276.10 303.18 440.24 553.32 1864.82 1921.84

1779.76 2276.12 303.18 440.24 553.31 1864.86 1921.81

+1,2-NQH2-S (Cys)

where oxidation of active site Cys797 led to increased kinase activity.30,31 To our knowledge, however, we report for the first time that an electrophilic thiol-derived species (i.e., the sulfenic acid 1,2-NQH2-SOH) is capable of conjugating to protein thiols (e.g., in Keap1), resulting in a reversible protein modification and the corresponding activation of electrophilic signal transduction pathways. It is well-recognized that there are ROS-mediated redox signaling pathways through modification of protein thiols to form a protein disulfide bond and/or S-glutathionylation.32,33 Alternatively, ROS is also involved in production of endogenous electrophiles to modify protein thiols, resulting in activation of electrophilic signaling, which is termed ROSmediated electrophilic signaling.1 We propose here that there is another unique redox signaling pathway called ROS- and RSSmediated electrophilic signaling. This can be triggered by S−S bond formation between cellular protein thiols and the sulfenic acid of the HS conjugate of electrophiles, which is secondary to the direct modification mediated by a quinone itself (Figure 8). Alternatively, such an S−S bond can be formed between the sulfenic acid form of a protein thiol and the HS conjugate of electrophiles. This ROS/RSS-mediated electrophilic signaling is, unlike electrophilic signaling, rapidly reversible by a thiol− disulfide exchange reaction. Because persulfides/polysulfides, which behave like HS−, are enzymatically produced in mammalian cells,14 the reactions described herein could occur not only by exogenous electrophiles such as 1,2-NQ but also by

+1,2-NQH2-S (Cys) +1,2-NQH2-S (Cys)

a Recombinant mouse Keap1 protein was reacted with 50 μM 1,2NQH2-SAc for 30 min. The native and 1,2-NQH2-SAc-treated Keap1 was digested with trypsin and analyzed by using UPLC-MSE as described in the Experimental Procedures. Biopharmlynx, version 1.2, software (Waters) was used for baseline subtraction and smoothing, deisotoping, de novo peptide sequence identification, and database searches.

NQH2-SAc were increased (Figure 7B,C), suggesting that cellular GSH levels modulate the actions of the sulfenic acid on the signaling pathway.

■

DISCUSSION The reactivity of sulfenic acid has been well-studied in the redox regulation of protein thiols associated with cellular signaling.29 For example, Paulsen et al. showed that sulfenic acid is involved in the redox regulation of EGFR signaling, G

DOI: 10.1021/tx500416y Chem. Res. Toxicol. XXXX, XXX, XXX−XXX

Article

Chemical Research in Toxicology

Figure 5. Activation of the Nrf2−ARE pathway by 1,2-NQH2-SAc in A431 cells. (A) Time-dependent modification of cellular proteins and Nrf2 activation by 1,2-NQH2-SAc or 1,2-NQ in A431 cells. Cells were exposed to 1,2-NQH2-SAc (10 μM) or 1,2-NQ (10 μM) for 0.1 h in PBS and incubated for an additional 1, 3, or 9 h in fresh FBS-free medium. Total cell lysates were subjected to western blotting analysis with the indicated antibodies. To detect 1,2-NQ modification, SDS-PAGE without 2-mercaptoethanol and subsequent western blotting were performed. (B) Activation of Nrf2 by 1,2-NQH2-SAc. Cells were exposed to 1,2-NQH2-SAc (1, 5, 10, or 20 μM) for 0.1 h in PBS and incubated for an additional 1 h in fresh FBS-free medium (left). Cells were exposed to 1,2-NQH2-SAc (20 μM) for 0.1 h in PBS and incubated for an additional 1, 3, 6, or 12 h in fresh FBSfree medium (right). Total cell lysates were subjected to western blotting analysis with the indicated antibodies. (C) Upregulation of Nrf2 target genes by 1,2-NQH2-SAc. Cells were incubated with or without 1,2-NQH2-SAc (20 μM) for 0.1 h in PBS and incubated for an additional 1, 3, or 6 h in fresh FBS-free medium. Nrf2, HO-1, GCLC, and xCT mRNA levels were determined by real-time PCR. Each value represents the mean ± SE of three independent experiments. *p < 0.05 and **p < 0.01 compared with control.

Figure 6. Effect of PEG−CAT on Nrf2 activation caused by exposure to 1,2-NQH2-SAc or 1,2-NQ in A431 cells. Cells were pretreated with or without PEG−CAT (3000 U/mL) for 1 h, exposed to 1,2-NQH2SAc (20 or 30 μM), 1,2-NQ (20 μM), or H2O2 (2 mM) for 0.1 h in PBS, and incubated for an additional 4 or 8 h in fresh FBS-free medium. Total cell lysates were subjected to western blotting analysis with the indicated antibodies.

endogenous electrophiles. Supporting this hypothesis, our preliminary study revealed that the SH adduct of an endogenous electrophile, 8-nitro-cGMP, is also able to modify cellular proteins (Sawa et al., unpublished observations). Another example of S−S bond formation of Keap1 associated with Nrf2 activation using sodium tetrasulfide was also reported.34 Exposure of A431 cells to 1,2-NQ or 1,2-NQH2-SAc resulted in extensive chemical modification of cellular proteins in both cases, but the stability of these modifications was markedly different. A reasonable explanation for these observations is that 1,2-NQ is also able to bind basic amino acid residues through a C−N bond,5,26,35 resulting in stable protein adducts, whereas a protein thiol with a low pKa value, such as GAPDH modified by 1,2-NQ in A549 cells, undergos GSH-dependent S-transarylation associated with substantial recovery of the original protein.27 In contrast, 1,2-NQH2-SOH derived from 1,2-

Figure 7. Effect of pretreatment with BSO on Nrf2 activation and protein modification by 1,2-NQH2-SAc in A431 cells. (A) Cells were treated with 1 mM BSO for 24 h, and then cellular GSH content was measured by HPLC. (B) Cells were pretreated with BSO (1 mM) for 24 h, exposed to 1,2-NQH2-SAc (20 μM) for 0.1 h in PBS, and incubated for an additional 1, 3, or 6 h in fresh FBS-free medium. Total cell lysates were subjected to western blotting with the indicated antibodies. To detect 1,2-NQ-modification, SDS-PAGE without 2mercaptoethanol and subsequent western blotting were performed. (C) Cells were pretreated with BSO (1 mM) for 24 h, exposed to 1,2NQH2-SAc (20 μM) for 0.1 h in PBS, and incubated for an additional 1 or 3 h in fresh FBS-free medium. HO-1 and xCT mRNA levels were determined by real-time PCR. Each value represents the mean ± SE of three independent experiments. *p < 0.05 and **p < 0.01 compared with control.

H

DOI: 10.1021/tx500416y Chem. Res. Toxicol. XXXX, XXX, XXX−XXX

Article

Chemical Research in Toxicology

detected that incubation of 1,2-NQ with GS-SH or GS-S-SG resulted in production of sulfur adducts of 1,2-NQ (Shinkai et al., unpublished observations). Overall, our present observations suggest that an RSS-dependent 1,2-NQH2-SH adduct is readily oxidized to its sulfenic acid because of the generation of ROS through a chemical disproportionation reaction between 1,2-NQH2-SH and 1,2-NQ2-SH and that the produced 1,2NQH 2 -SOH modifies Keap1 through Cys171, thereby activating Nrf2.

■

ASSOCIATED CONTENT

S Supporting Information *

1 H NMR spectrum of 1,2-NQH2-SAc, UPLC-MSE analysis of 1,2-NQH2-SAc and its glutathione conjugate, high-resolution mass analysis of dimedone adducts, western blotting analysis of xCT and HO-1 induction, and scavenging of ROS by PEG− CAT in A431 cells. This material is available free of charge via the Internet at http://pubs.acs.org.

Figure 8. Scheme for RSS/ROS-mediated activation of Keap1−Nrf2 signaling through formation of the sulfenic acid of electrophiles.

NQH2-SAc modifies cellular proteins through an S−S bond and thus is rapidly removed by cellular GSH from the modified proteins. While we previously reported that modification sites of Keap1 by 1,2-NQ were Cys151, Cys273, and Cys288,6,36 1,2NQH2-SH was covalently bound to Cys171 of Keap1 following oxidation to 1,2-NQH2-SOH (Figure 4D). It is well-known that Cys151, Cys273, and Cys288 are highly reactive cysteine residues of Keap1, leading to Nrf2 activation,37 whereas only sulforaphane was reported to modify Cys171 of Keap1.38 Although this Cys171 is located in the BTB domain that plays a role in dimerization of Keap1 and interaction of Keap1 with Cul3 to repress Nrf2 activation,37 to our knowledge, there is no study on Nrf2 activation due to the covalent modification of Cys171. To date, Keap1 has been regarded as a sensor protein for electrophiles, activating Nrf2, which cooperatively upregulates proteins responsible for detoxification and excretion of xenobiotics.37 The current study shows that Keap1 can sense not only carbon-based electrophiles but also thiol-based sulfenic acid electrophiles, undergoing covalent modification of relatively inert cysteine residues. As a result, Nrf2 is activated without increasing its mRNA expression, and Nrf2 target genes such as HO-1, GCL, and xCT are upregulated during exposure of A431 cells to 1,2-NQH2-SAc (Figure 5C), suggesting that 1,2-NQH2-SAc-mediated Nrf2 activation is probably Keap1dependent. The thiol−disulfide exchange reaction, in which a reduced thiol such as GSH is exchanged with a disulfide, can generate a new disulfide and thiol. As shown in Figure 7, pretreatment with BSO to deplete cellular GSH enhanced and prolonged 1,2-NQH2-SOH adduct-mediated protein thiolation and Nrf2 activation, respectively, during 1,2-NQH2-SAc exposure, suggesting that GSH can modulate 1,2-NQH2SOH-dependent modification of cellular proteins, including Keap1, through formation of 1,2-NQH2-S-S-protein. We previously proposed that there are at least three metabolic fates of electrophiles consisting of (I) sulfhydration and further oxidation of the sulfur atom of electrophiles, (II) SH adduct formation of electrophiles and further reaction with electrophiles to produce bis-thio derivatives, and (III) extensive degradation without certain product formation as evaluated by LC-MS analysis.10 Among them, 1,2-NQ was classified as group II. Since these experiments were done in a cell-free system, we did not examine the reactivity of such metabolites with cultured cells in the previous study. We have recently found that CBS/ CSE mainly catalyzes production of RSS such as GS-SH and GS-S-SG rather than H2S.13 In our preliminary study, we

■

AUTHOR INFORMATION

Corresponding Author

*Tel.: +81-29-853-3133; Fax: +81-29-853-2394; E-mail: [email protected]. Funding

This work was supported by a Grant-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science, and Technology of Japan no. 25220103 to Y.K.). Notes

The authors declare no competing financial interest.

■

ABBREVIATIONS BSO, L-buthionine-SR-sulfoximine; CBS, cystathionine βsynthase; CSE, cystathionine γ-lyase; GCLC, glutamate cysteine ligase catalytic subunit; HO-1, hemeoxygenase-1; HS−, hydrogen sulfide anion; 1,2-NQ, 1,2-naphthoquinone; 1,2-NQ-SH, 1,2-napthoquinone-4-thiol; 1,2-NQH2, 1,2-dihydroxynaphthalene; 1,2-NQH2-SH, 1,2-dihydroxynaphthalene-4thiol; 1,2-NQH2-SAc, 1,2-dihydroxynaphthalene-4-thioacetate; 1,2-NQ-SG, 1,2-NQ-GSH adduct; xCT, cystine transporter

■

REFERENCES

(1) Rudolph, T. K., and Freeman, B. A. (2009) Transduction of redox signaling by electrophile− protein reactions. Sci. Signaling 2, re7. (2) Sawa, T., Zaki, M. H., Okamoto, T., Akuta, T., Tokutomi, Y., Kim-Mitsuyama, S., Ihara, H., Kobayashi, A., Yamamoto, M., Fujii, S., Arimoto, H., and Akaike, T. (2007) Protein S-guanylation by the biological signal 8-nitroguanosine 3′,5′-cyclic monophosphate. Nat. Chem. Biol. 3, 727−735. (3) Cho, A. K., Di Stefano, E., Ying, Y. E., R, C., Schmitz, D., Kumagai, Y., Miguel, A. H., Eiguren-Fernandez, A., Kobayashi, T., Avol, E., and Froines, J. R. (2004) Determination of four quinones in diesel exhaust particles, SRM 1649a and atmospheric PM2.5. Aerosol Sci. Technol. 38, 68−81. (4) Kumagai, Y., Shinkai, Y., Miura, T., and Cho, A. K. (2012) The chemical biology of naphthoquinones and its environmental implications. Annu. Rev. Pharmacol. Toxicol. 52, 221−247. (5) Iwamoto, N., Sumi, D., Ishii, T., Uchida, K., Cho, A. K., Froines, J. R., and Kumagai, Y. (2007) Chemical knockdown of protein tyrosine phosphatase 1B by 1,2-naphthoquinone through covalent modification causes persistent transactivation of epidermal growth factor receptor. J. Biol. Chem. 282, 33396−33404. (6) Miura, T., Shinkai, Y., Jiang, H. Y., Iwamoto, N., Sumi, D., Taguchi, K., Yamamoto, M., Jinno, H., Tanaka-Kagawa, T., Cho, A. K., and Kumagai, Y. (2011) Initial response and cellular protection

I

DOI: 10.1021/tx500416y Chem. Res. Toxicol. XXXX, XXX, XXX−XXX

Article

Chemical Research in Toxicology through the Keap1/Nrf2 system during the exposure of primary mouse hepatocytes to 1,2-naphthoquinone. Chem. Res. Toxicol. 24, 559−567. (7) Blair, I. A. (2006) Endogenous glutathione adducts. Curr. Drug Metab. 7, 853−872. (8) Hughes, M. N., Centelles, M. N., and Moore, K. P. (2009) Making and working with hydrogen sulfide: the chemistry and generation of hydrogen sulfide in vitro and its measurement in vivo: a review. Free Radical Biol. Med. 47, 1346−1353. (9) Paul, B. D., and Snyder, S. H. (2012) H2S signalling through protein sulfhydration and beyond. Nat. Rev. Mol. Cell Biol. 13, 499− 507. (10) Nishida, M., Sawa, T., Kitajima, N., Ono, K., Inoue, H., Ihara, H., Motohashi, H., Yamamoto, M., Suematsu, M., Kurose, H., van der Vliet, A., Freeman, B. A., Shibata, T., Uchida, K., Kumagai, Y., and Akaike, T. (2012) Hydrogen sulfide anion regulates redox signaling via electrophile sulfhydration. Nat. Chem. Biol. 8, 714−724. (11) Yoshida, E., Toyama, T., Shinkai, Y., Sawa, T., Akaike, T., and Kumagai, Y. (2011) Detoxification of methylmercury by hydrogen sulfide-producing enzyme in mammalian cells. Chem. Res. Toxicol. 24, 1633−1635. (12) Ono, K., Akaike, T., Sawa, T., Kumagai, Y., Wink, D. A., Tantillo, D. J., Hobbs, A. J., Nagy, P., Xian, M., Lin, J., and Fukuto, J. M. (2014) Redox chemistry and chemical biology of HS, hydropersulfides, and derived species: implications of their possible biological activity and utility. Free Radical Biol. Med. 77C, 82−94. (13) Ida, T., Sawa, T., Ihara, H., Tsuchiya, Y., Watanabe, Y., Kumagai, Y., Suematsu, M., Motohashi, H., Fujii, S., Matsunaga, T., Yamamoto, M., Ono, K., Devarie-Baez, N. O., Xian, M., Fukuto, J. M., and Akaike, T. (2014) Reactive cysteine persulfides and S-polythiolation regulate oxidative stress and redox signaling. Proc. Natl. Acad. Sci. U.S.A. 111, 7606−7611. (14) Paulsen, C. E., and Carroll, K. S. (2013) Cysteine-mediated redox signaling: chemistry, biology, and tools for discovery. Chem. Rev. 113, 4633−4679. (15) Mansuy, D., and Dansette, P. M. (2011) Sulfenic acids as reactive intermediates in xenobiotic metabolism. Arch. Biochem. Biophys. 507, 174−185. (16) Roos, G., and Messens, J. (2011) Protein sulfenic acid formation: from cellular damage to redox regulation. Free Radical Biol. Med. 51, 314−326. (17) Taguchi, K., Fujii, S., Yamano, S., Cho, A. K., Kamisuki, S., Nakai, Y., Sugawara, F., Froines, J. R., and Kumagai, Y. (2007) An approach to evaluate two-electron reduction of 9,10-phenanthraquinone and redox activity of the hydroquinone associated with oxidative stress. Free Radical Biol. Med. 43, 789−799. (18) Miura, T., and Kumagai, Y. (2010) Immunochemical method to detect proteins that undergo selective modification by 1,2naphthoquinone derived from naphthalene through metabolic activation. J. Toxicol. Sci. 35, 843−852. (19) Sun, Y., Sumi, D., and Kumagai, Y. (2006) Serine 1179 phosphorylation of endothelial nitric oxide synthase caused by 2,4,6trinitrotoluene through PI3K/Akt signaling in endothelial cells. Toxicol. Appl. Pharmacol. 214, 55−60. (20) Vignaud, C., Rakotozafy, L., Falguieres, A., Potus, J., and Nicolas, J. (2004) Separation and identification by gel filtration and high-performance liquid chromatography with UV or electrochemical detection of the disulphides produced from cysteine and glutathione oxidation. J. Chromatogr. A 1031, 125−133. (21) Kumagai, Y., Koide, S., Taguchi, K., Endo, A., Nakai, Y., Yoshikawa, T., and Shimojo, N. (2002) Oxidation of proximal protein sulfhydryls by phenanthraquinone, a component of diesel exhaust particles. Chem. Res. Toxicol. 15, 483−489. (22) Kalyanaraman, B., Darley-Usmar, V., Davies, K. J., Dennery, P. A., Forman, H. J., Grisham, M. B., Mann, G. E., Moore, K., Roberts, L. J., II, and Ischiropoulos, H. (2012) Measuring reactive oxygen and nitrogen species with fluorescent probes: challenges and limitations. Free Radical Biol. Med. 52, 1−6.

(23) Kyhse-Andersen, J. (1984) Electroblotting of multiple gels: a simple apparatus without buffer tank for rapid transfer of proteins from polyacrylamide to nitrocellulose. J. Biochem. Biophys. Methods 10, 203− 209. (24) Dalle-Donne, I., Milzani, A., Gagliano, N., Colombo, R., Giustarini, D., and Rossi, R. (2008) Molecular mechanisms and potential clinical significance of S-glutathionylation. Antioxid. Redox Signaling 10, 445−473. (25) Endo, A., Sumi, D., and Kumagai, Y. (2007) 1,2Naphthoquinone disrupts the function of cAMP response elementbinding protein through covalent modification. Biochem. Biophys. Res. Commun. 361, 243−248. (26) Toyama, T., Shinkai, Y., Yazawa, A., Kakehashi, H., Kaji, T., and Kumagai, Y. (2014) Glutathione-mediated reversibility of covalent modification of ubiquitin carboxyl-terminal hydrolase L1 by 1,2naphthoquinone through Cys152, but not Lys4. Chem.−Biol. Interact. 214, 41−48. (27) Miura, T., Kakehashi, H., Shinkai, Y., Egara, Y., Hirose, R., Cho, A. K., and Kumagai, Y. (2011) GSH-mediated S-transarylation of a quinone glyceraldehyde-3-phosphate dehydrogenase conjugate. Chem. Res. Toxicol. 24, 1836−1844. (28) Itoh, K., Wakabayashi, N., Katoh, Y., Ishii, T., Igarashi, K., Engel, J. D., and Yamamoto, M. (1999) Keap1 represses nuclear activation of antioxidant responsive elements by Nrf2 through binding to the amino-terminal Neh2 domain. Genes Dev. 13, 76−86. (29) Kettenhofen, N. J., and Wood, M. J. (2010) Formation, reactivity, and detection of protein sulfenic acids. Chem. Res. Toxicol. 23, 1633−1646. (30) Paulsen, C. E., Truong, T. H., Garcia, F. J., Homann, A., Gupta, V., Leonard, S. E., and Carroll, K. S. (2012) Peroxide-dependent sulfenylation of the EGFR catalytic site enhances kinase activity. Nat. Chem. Biol. 8, 57−64. (31) Truong, T. H., and Carroll, K. S. (2012) Redox regulation of epidermal growth factor receptor signaling through cysteine oxidation. Biochemistry (Moscow) 51, 9954−9965. (32) Allen, E. M., and Mieyal, J. J. (2012) Protein-thiol oxidation and cell death: regulatory role of glutaredoxins. Antioxid. Redox Signaling 17, 1748−1763. (33) Ray, P. D., Huang, B. W., and Tsuji, Y. (2012) Reactive oxygen species (ROS) homeostasis and redox regulation in cellular signaling. Cell. Signalling 24, 981−990. (34) Koike, S., Ogasawara, Y., Shibuya, N., Kimura, H., and Ishii, K. (2013) Polysulfide exerts a protective effect against cytotoxicity caused by t-buthylhydroperoxide through Nrf2 signaling in neuroblastoma cells. FEBS Lett. 587, 3548−3555. (35) Takayama, N., Iwamoto, N., Sumi, D., Shinkai, Y., TanakaKagawa, T., Jinno, H., and Kumagai, Y. (2012) Peroxiredoxin 6 is a molecular target for 1,2-naphthoquinone, an atmospheric electrophile, in human pulmonary epithelial A549 cells. J. Toxicol. Sci. 36, 817−821. (36) Kobayashi, M., Li, L., Iwamoto, N., Nakajima-Takagi, Y., Kaneko, H., Nakayama, Y., Eguchi, M., Wada, Y., Kumagai, Y., and Yamamoto, M. (2009) The antioxidant defense system Keap1−Nrf2 comprises a multiple sensing mechanism for responding to a wide range of chemical compounds. Mol. Cell. Biol. 29, 493−502. (37) Taguchi, K., Motohashi, H., and Yamamoto, M. (2011) Molecular mechanisms of the Keap1−Nrf2 pathway in stress response and cancer evolution. Genes Cells 16, 123−140. (38) Hu, C., Eggler, A. L., Mesecar, A. D., and van Breemen, R. B. (2011) Modification of keap1 cysteine residues by sulforaphane. Chem. Res. Toxicol. 24, 515−521.

J

DOI: 10.1021/tx500416y Chem. Res. Toxicol. XXXX, XXX, XXX−XXX