Article pubs.acs.org/JAFC
Cite This: J. Agric. Food Chem. 2017, 65, 11140−11145
Reference Gene Selection and Prednisolone Target Gene Expression in Adipose Tissues of Friesian Cattle Sara Divari,* Enrica Berio, Bartolomeo Biolatti, and Francesca Tiziana Cannizzo Department of Veterinary Science, University of Turin, Largo Braccini 2, 10095 Grugliasco, Turin, Italy ABSTRACT: Corticosteroids are frequently used in livestock production, and their use is permitted by the European Union for therapeutic purposes only. However, small doses of corticosteroids are often administered in meat-producing animals to improve zootechnical performance. Prednisolone is one of the most commonly used corticosteroids with a growth-promoting purpose in animal husbandry. This study proposes to identify a gene whose expression is significantly regulated by prednisolone in visceral and subcutaneous adipose tissues. The analysis was conducted on Friesian cattle treated with prednisolone (30 mg day−1). The reference gene expression stability and optimal number for gene expression normalization were calculated. Family with sequence similarity 107 member A (FAM107A) and pyruvate dehydrogenase kinase 4 are the prednisolone target genes identified in adipose tissue. FAM107A was downregulated by ∼2.9-fold by prednisolone in subcutaneous adipose tissue. This result suggests that FAM107A could be a possible indirect biomarker of prednisolone treatment in cattle and encourages a deeper investigation in this direction. KEYWORDS: prednisolone, gene expression, FAM107A, cattle, adipose tissue
■
INTRODUCTION In the European Union, administration of corticosteroids (CSs) in food-producing animals is licensed for therapy in human and veterinary medicine because of their anti-inflammatory and immunosuppressive properties, but the use of these drugs as growth promoters is banned.1,2 Although intense controls have been performed by sanitary authorities, these substances are frequently used in livestock production as part of “illegal anabolic cocktails”. Presumably, they are added in the feed because of their capacity to potentiate growth promoter activity of sex steroid and β-agonist molecules.3 Besides their anti-inflammatory and immunosuppressive activities, CSs are implicated in gluconeogenesis, glycogen deposition, and protein and calcium metabolism. Dexamethasone (DEX) and prednisolone (PDN) are the most employed synthetic CSs because of their marked capacity to improve animal welfare and food intake. Usually, they are administered orally at small doses, either alone or in cocktails containing different anabolic agents.4 The number of illegally treated animals is probably underestimated in Europe. The current official approach relies on the application of analytical techniques based solely on the direct detection of residues by physicochemical recognition (enzyme-linked immunosorbent assay and liquid chromatography with tandem mass spectrometry).5 Detection of DEX and PDN residues by chemical direct analysis is often not suitable because of the rapid metabolism and excretion of these molecules. In addition, to realize the growth-promoting effect, CSs are usually administered for an extended period and at dosages below the threshold of the most common analytical methods.6 Since 1988 in Italy, the Italian National Program for Residue Surveillance (PNR) has been applied to monitor food of animal origin. In 2008, the PNR introduced a histological screening © 2017 American Chemical Society
test based on thymus atrophy to identify DEX illegal treatments in cattle (circolare MINSAL n. 18128/P del 5/12/2007).7 On the other hand, PDN treatments do not induce thymus morphological alterations in beef cattle, and for these reasons, alternative detection methods are needed to identify PDN abuse in livestock production. The “omics techniques” are useful tools for evaluating the expression of several genes, enzymes, receptors, etc., in blood and serum, urine, or tissues.5 Among tissues, one of the most interesting is adipose tissue because it is a target organ of CSs8 and the biological effects of PDN treatments on lipid metabolism are still not completely understood. The actions of CSs are mediated by a specific intracellular receptor protein, the glucocorticoid receptor (GR), a member of the nuclear receptor superfamily. Following CS bonding, GR transfers inside the nucleus, binds the consensus glucocorticoidresponsive element sequence, and alters the expression of CSresponsive genes by inducing or reducing the transcription of target genes leading to the synthesis of new proteins.9 While the principal effects of CSs are mediated by transcriptional responses, the GR may also act via nongenomic mechanisms to elicit rapid cellular responses that do not require changes in gene expression.10,11 Frijters et al.12 found that administration of PDN to mice influenced the expression of genes involved in glucose metabolism, inflammation, cell cycle, and apoptosis in the liver. They identified FAM107A (family with sequence similarity 107 member A, also known as Tu3a and Drr1) that may serve as a cofactor in the transcription machinery complex, and it plays a role in regulating the cell cycle, as a novel CS-inducible Received: Revised: Accepted: Published: 11140
October 16, 2017 November 21, 2017 November 27, 2017 November 27, 2017 DOI: 10.1021/acs.jafc.7b04795 J. Agric. Food Chem. 2017, 65, 11140−11145
Article
Journal of Agricultural and Food Chemistry Table 1. Primer Sequences for qPCR gene symbol (RefSeq)
gene name
biological processa
sequence (5′−3′)
amplicon (bp)
ref
F: ACACCCTCAAGATTGTCAGCAA
102
25
R: TCATAAGTCCCTCCACGATGC F: GCCCCAACACAAATGGTT
95
21
R: CCCTCTTTCACCTTGCCAAAG F: GCATCCCACAGACTATTTCC
120
22
GAPDH (NM_001034034)
glyceraldehyde-3-phosphate dehydrogenase
oxidation−reduction process, glycolysis and gluconeogenesis
PPIA (NM_178320)
peptidylprolyl isomerase A
protein folding
YWHAZ (NM_174814)
tyrosine 3-monooxygenase/tryptophan 5monooxygenase activation protein, zeta polypeptide
oxidation−reduction process, signal transduction
HPRT1 (NM_001034035)
hypoxanthine phosphoribosyl-transferase I
nucleoside metabolic process
R: GCAAAGACAATGACAGACCA F: TGCTGAGGATTTGGAGAAGG
154
22
ACTB (NM_173979)
β-actin
cytoskeleton
R: CAACAGGTCGGCAAAGAACT F: CCCAGATCATGTTCGAGACC
95
23
LRP10 (NM_001100371)
LDL receptor-related protein 10
lipid metabolic process
R: GAGGCATACAGGGACAGCAC F:CCAGAGGATGAGGACGATGT
139
24
EMD (NM_203361)
emerin
transport
R: ATAGGGTTGCTGTCCCTGTG F: GCCCTCAGCTTCACTCTCAGA
100
24
PDK4 (NM_001101883)
pyruvate dehydrogenase kinase 4
phosphorylation
R: GAGGCGTTCCCGATCCTT F: AGGTGGTGTTCCCCTGAGAGT
100
25
FAM107A (NM_001083488)
family with sequence similarity 107 member A
regulation of cell growth
R: AGCCAGCGGAGCATTCC F: GGCCAGAACACAGAGAATGGA
119
26
R: CCTCCTGTGGTTCATGAGCAG a
From http://www.ebi.ac.uk/GOA/.
gene. It was upregulated in mouse liver ∼80-fold after a single acute administration of PDN, and its expression completely relies on GR dimerization.12 In 3T3-L1 mouse adipocytes, acute treatment with PDN (from 1 to 48 h) induces the regulation of known GR target genes, and genes such as FAM107A and pyruvate dehydrogenase kinase 4 (PDK4).13 The PDK4 gene encodes a key enzyme that regulates the pyruvate dehydrogenase complex whose activity is fundamental for controlling glucose homeostasis and ATP levels. Several hormone receptors, involved in pyruvate dehydrogenase complex activity, control PDK4 and PDK2 gene expression.14 In rats, a marked PDK4 gene expression increment has been observed in DEX-treated animals,15,16 suggesting that CSs are important regulators of PDK4. Because the indirect method of CS treatment detection, the histological screening test based on thymus atrophy, cannot be applied on PDN treatment, we propose to study the regulation of two CS target genes, FAM107A and PDK4, to reveal the illegal administration of PDN to cattle. Quantitative polymerase chain reaction (qPCR) was applied on visceral (VAT) and subcutaneous (SCAT) adipose tissue of PDN-treated animals. This study requires the identification of a stable reference gene (RG); therefore, we determined the optimal RG selection and stability from a panel of RGs.
■
Italy) per os for 35 days, and group C (n = 6) was the control group that received a placebo. The animals were slaughtered 6 days after the withdrawal of the drug. The experiment was authorized by the Italian Ministry of Health and the Ethics Committee of the University of Turin, and the carcasses of the treated cattle were appropriately destroyed.19 All groups of experimental animals were kept in separate 10 m × 15 m boxes and fed a diet consisting of corn silage, corn, hay, and a commercial protein supplement; water was supplied ad libitum. The animal weight gain was recorded, as previously reported by Cannizzo et al.17,18 Tissue Sampling and Processing. Thymus glands were collected, weighed, and histologically examined as previously reported by Cannizzo et al.6 Samples of both VAT and SCAT were taken from each animal during slaughtering, frozen in liquid nitrogen, and stored at −80 °C. RNA Extraction and Reverse Transcription. The total RNA from adipose tissue samples was extracted using TRI Reagent (Sigma, St. Louis, MO), according to the manufacturer’s protocol. The RNA purity and concentration were determined by ultraviolet−visible spectrophotometry. The RNA integrity [RNA quality indicator (RQI)] was verified by an automated gel electrophoresis system (Experion Instrument, Bio-Rad, Hercules, CA) with the standardsensitivity RNA analysis kit according to the manufacturer’s instructions (Bio-Rad). RQI values from 10 to 5 indicate good and medium quality of RNA; RNAs with RQI values of
