Regeneration of NADPH Coupled with HMG-CoA Reductase Activity

Aug 28, 2017 - *E-mail: [email protected]; [email protected]. Phone: +91-821-2517539. ... Phenolic Compounds Profiling of Virgin Olive Oils ...
1 downloads 3 Views 2MB Size
Download PDF
Article pubs.acs.org/JAFC

Regeneration of NADPH Coupled with HMG-CoA Reductase Activity Increases Squalene Synthesis in Saccharomyces cerevisiae Kalaivani Paramasivan†,‡ and Sarma Mutturi*,†,‡ †

Microbiology and Fermentation Technology Department, CSIR-Central Food Technological Research Institute, Mysore, India Academy of Scientific and Innovative Research, Mysore, New Delhi, India

‡

S Supporting Information *

ABSTRACT: Although overexpression of the tHMG1 gene is a well-known strategy for terpene synthesis in Saccharomyces cerevisiae, the optimal level for tHMG1p has not been established. In the present study, it was observed that two copies of the tHMG1 gene on a dual gene expression cassette improved squalene synthesis in laboratory strain by 16.8-fold in comparison to single-copy expression. It was also observed that tHMG1p is limited by its cofactor (NADPH), as the overexpression of NADPH regenerating genes’, viz., ZWF1 and POS5 (full length and without mitochondrial presequence), has led to its increased enzyme activity. Further, it was demonstrated that overexpression of full-length POS5 has improved squalene synthesis in cytosol. Finally, when tHMG1 and full-length POS5 were co-overexpressed there was a net 27.5-fold increase in squalene when compared to control strain. These results suggest novel strategies to increase squalene accumulation in S. cerevisiae. KEYWORDS: S. cerevisiae, squalene, tHMG1, ZWF1, POS5

■

INTRODUCTION

rather, it improved squalene synthesis over 30 times in yeast cells.13 During production of a terpene molecule, different researchers have overexpressed tHMG1 either on an episomal plasmid or on integrated single or multiple copies.14,15 However, the copy number of this gene during overexpression was not optimized. Reactions involving HMG-CoA reductase (HMG1) and squalene synthase (ERG9) in the sterol pathway utilize NADPH as a cofactor for squalene synthesis. NADPH is a universal electron carrier in yeast cells.16 S. cerevisiae has three different NAD kinase enzymes, namely, Utr1p, Yef1p, and Pos5p, which phosphorylate NAD+ to form NADP+ in cytoplasm and mitochondria.17 NADP+ synthesized by NAD kinases is further reduced to NADPH by NADP+-dependent dehydrogenase.18 NADPH synthesis and regeneration in yeast depends on activities of NADH kinases and NADP+-dependent dehydrogenases. NADH kinase phosphorylates NADH to form NADPH, while the dehydrogenases reduce NADP+ to form NADPH. Pos5p has the activity of both NAD kinase as well as NADH kinase; however, the latter activity is observed more.19 NADPH regeneration in the oxidative part of the pentose phosphate pathway is carried out by two key enzymes such as glucose-6-phosphate dehydrogenase (G6PD coded by ZWF1) and 6-phospho gluconate dehydrogenase. ZWF1 is a key target for increasing regeneration of cytosolic NADPH not only in S. cerevisiae but also in Corynebacterium glutamicum for amino acid production.20 Although ZWF1 and POS5 have been targeted in some studies for increased regeneration of NADPH, neither of these genes were studied exclusively for squalene improvement. Furthermore, overexpression of POS5 was carried by

Saccharomyces cerevisiae is a well-studied eukaryotic model organism for production of terpenes due to the presence of specific precursor molecules in its sterol pathway.1−3 S. cerevisiae is advantageous over its prokaryotic counterpart, E. coli, for production of terpenoids owing to its ability to express cytochrome P450 oxidase and the presence of cognate reductase enzymes.4 S. cerevisiae has been a cell factory for biosynthesis of diverse terpene molecules.5 Squalene, which is an intermediate of ergosterol pathway, is an unsaturated triterpene hydrocarbon (C30H50) and a precursor for sterol molecules in S. cerevisiae. Squalene has a demand of >1200 tonnes per year6 and has an estimated market size of $211 million USD by 2021.7 Squalene is used in the cosmetics industry as a skin moisturizer and also acts as antioxidant. In the pharmaceutical industry it is used as adjuvant for vaccines and also for drug delivery. Squalene has been shown to exhibit tumor-suppressive activity by preventing breast cancer and acts as a cardio-protective agent by reducing the serum cholesterol level.8 Further, squalene has also been used as a dietary supplement (Naziri et al. 2011).6 In most metabolic engineering studies of S. cerevisiae toward a terpene production, overexpression of HMG-CoA reductase has become imperative as it is a key regulatory enzyme in the ergosterol pathway.9 HMG-CoA reductase is present as Hmg1p and Hmg2p isomers in S. cerevisiae, among which Hmg1p contributes to at least 83% of net enzyme activity in the wildtype strain.10 Overexpression of a membrane-bound Hmg1p leads to endoplasmic reticulum membrane stacks otherwise called karmellae formation.11 To overcome the regulation caused due to the feedback inhibition by ergosterol, a truncated form of HMG-CoA reductase enzyme has been overexpressed.12 Overexpression of a truncated form of Hmg1p coding only for the catalytic domain of the protein to bypass its regulation has not increased ergosterol content as expected; © 2017 American Chemical Society

Received: Revised: Accepted: Published: 8162

June 27, 2017 August 24, 2017 August 28, 2017 August 28, 2017 DOI: 10.1021/acs.jafc.7b02945 J. Agric. Food Chem. 2017, 65, 8162−8170

Article

Journal of Agricultural and Food Chemistry Table 1. Primers, Plasmids, and Strains Used in This Study name primers tHmg1-Gal-F tHmg1-Gal-R tHmg1-pTEF-F tHmg1-pTEF-R tHmg1-pPGK-F tHmg1-pPGK-R Zwf1-F Zwf1-R Pos5-F(wM) Pos5-F (w/oM) Pos5-R plasmids pYES2-NTC pCEV-G1-Km pYGH pCTH pCPZ pCPP(wM) pCPH pCPP(w/oM) pCTHPZ pCTHPP(wM) pCTHPH pCTHPP(w/oM) strains BY4741 SK1 SK3 SK8 SK10 SK12 SK13 SK14 SK15 SK16 SK17 SK18 SK19

description CGGGATCCGACCAATTGGTGAAAACTGAAG CGGAATTCGTAACACATGGTGCTGTTGT ATAAGAATAGGCGGCCGCATGGACCAATTGGTGAAAACTGAAG CGGTCGACTAGTGTAACACATGGTGCTGTTGT CGGTCGGGATCCATGGACCAATTGGTGAAAACTGAAG ACGCGCGTCGACGTAACACATGGTGCTGTTGT CGGTCGGGATCCATGAGTGAAGGCCCCGT ACGCGCGTCGACGCCGATAAATGAATGTGCTTGC CGGTCGGGATCCACTTCCACAGTTCTCAACTCTTC CGGTCGGGATCCATGCACCATGAGTACGTTGGATTCACA ACGCGCGTCGACAGAGAATCTCATTGAATCTTTGCAT

this this this this this this this this this this this

yeast expression vector with URA selection yeast expression vector with G418 selection pYES2NT/C- PGAL1-tHmg1 pCEV-G1-Km-PTEF1-tHmg1 pCEV-G1-Km-PPGK1-Zwf1 pCEV-G1-Km-PPGK1-Pos5(wM) pCEV-G1-Km-PPGK1-tHmg1 pCEV-G1-Km-PPGK1-Pos5 (w/oM) pCEV-G1-Km-PTEF1-tHmg1-PPGK1-Zwf1 pCEV-G1-Km-PTEF1-tHmg1-PPGK1-Pos5(wM) pCEV-G1-Km-PTEF1-tHmg1-PPGK1-tHmg1 pCEV-G1-Km-PTEF1-tHmg1-PPGK1-Pos5(w/oM)

Invitrogen Vickers et al., 2013 this study this study this study this study this study this study this study this study this study this study

MATa; his3Δ 1; leu2Δ 0; met15Δ 0; ura3Δ 0 yeast BY4741 harboring pYES2/NTC yeast BY4741 harboring pYGH yeast BY4741 harboring pCEV-G1-Km yeast BY4741 harboring pCTH Yeast BY4741 harboring pCPH Yeast BY4741 harboring pCPZ Yeast BY4741 harboring pCPP(wM) Yeast BY4741 harboring pCPP(w/oM) Yeast BY4741 harboring pCTHPH Yeast BY4741 harboring pCTHPZ Yeast BY4741 harboring pCTHPP(wM) Yeast BY4741 harboring pCTHPP(w/oM)

Euroscarf, SRD GmbH this study this study this study this study this study this study this study this study this study this study this study this study

study study study study study study study study study study study

Sigma-Aldrich) was used for plasmid DNA purification. PureLink Quick Gel Extraction and PCR Purification Combo Kit (#K220001, Invitrogen) was used for gel extraction and DNA purification, respectively. Strain and Vectors. The information on strains, vectors, and primers used in the present study is shown in Table 1. S. cerevisiae laboratory strain BY4741 (ATCC 201388) (Euroscarf, Germany) was kindly gifted by Prof. Ram Rajasekharan (Lipid Science Department, CSIR-CFTRI). BY4741 was maintained as glycerol stocks stored at −80 °C and subcultured on YPD (yeast extract, peptone, dextrose) agar plates. Engineered yeast strains were grown either in SD medium22 lacking uracil or with G418 wherever appropriate. Ampicillin and G418 were used at 100 and 200 μg/mL, respectively. The nitrogen source in the SD medium was either (NH4)2SO4 (5 g/L) or glutamic acid (1 g/L). E. coli DH5α was used for propagating the plasmids before transformation into yeast strains. The following expression cassettes were used for transformation in yeast cells: pYES2 (URA3, 2 μ, PGal1; Invitrogen, Bangalore); pCEV-G1-Km (kanMX, 2 μ, PTEF1, PPGK1) was obtained from Lars Nielsen and Claudia Vickers (Addgene plasmid 46813).23 Instrumental Analysis. An isocratic RP-HPLC was performed using a semi-preparative reversed-phase C-18 column (Phenomenex Kinetex, Hyderabad, India) (particle size 5 μm, 250 × 4.6 mm i.d.).

eliminating the mitochondrial presequence, assuming the fulllength expression of this gene would not enhance cytosolic NADPH.21 Hence, the aim of the present study is to address the following questions. (a) Is single-copy tHMG1 overexpression optimal for improving squalene? (b) What is the role of regeneration of cytosolic NADPH in squalene synthesis? (c) Will the Pos5p present in mitochondria affect the cytosolic squalene synthesis?

■

ref

MATERIALS AND METHODS

Chemicals. Squalene and ergosterol standards were obtained from Sigma-Aldrich (Bangalore, India). Other HPLC-grade chemicals were procured from SRL (Mumbai, India) and Qualigens (Mumbai, India). Gene amplifications were performed using Phusion high-fidelity DNA polymerase (New England Biolabs, Ipswich, MA, USA) and Taq polymerase (Sigma-Aldrich, Bangalore, India). All restriction and ligase enzymes were obtained from New England BioLabs (New England Biolabs, Ipswich, MA, USA). GenElute Plasmid Miniprep Kit (PLN70, 8163

DOI: 10.1021/acs.jafc.7b02945 J. Agric. Food Chem. 2017, 65, 8162−8170

Article

Journal of Agricultural and Food Chemistry

Figure 1. Squalene synthesis in tHMG1 overexpressed S. cerevisiae strains. (A) Comparison of BY4741 with respect to SK13, SK10, and SK12 represents the effect of single-copy overexpression of tHMG1 using promoters PGAL1, PTEF1, and PPGK1, respectively, whereas the comparison of SK16 to other engineered strains (SK10, SK12, and SK13) reveals the effect of plasmid harboring two copies tHMG1 to single copy tHMG1 on squalene. (B) Pictorial representation of gene cassettes used in the strains. The column was mounted to a HPLC unit (Shimadzu Scientific instruments, Kyoto, Japan) and maintained at 35 °C. The pump flow rate was 1.5 mL/min with 100% acetonitrile as the mobile phase. The injection volume was fixed to 20 μL. The chromatograph was coupled to a UV−vis diode array multiple wavelength detector. Detection and quantification of squalene were carried out at 195 nm. Peak identification was achieved by comparing the retention time with the authentic standards and confirmation of spectral data. The chromatograms were processed using LC solution software. Quantification was accomplished with the aid of standard curves calculated using fivepoint linear regression analysis. LC-MS was performed using a Waters Q-Tof Ultima system equipped with an electrospray ionization source (Waters, Milford, MA, USA). All samples and standards were diluted in chloroform prior sampling. The samples were injected using the autosampler (Waters 2695 separation module) into a semi-preparative reversed-phase C-18 column (Phenomenex Kinetex, Hyderabad, India) (particle size 5 μm, 250 × 4.6 mm i.d.) using isocratic elution with 100% acetonitrile as a mobile phase with a flow rate of 1.5 mL/min. The separated components were detected using a photodiode array detector (Waters 2996 PDA detector). Electrospray ionization in positive mode was used for metabolite fragmentation. The source temperature was held at 120 °C. High-resolution data was obtained in the mass range of 200− 1000 Da with a scan time of 1 s and interscan of 0.1 s using a 4 GHz TDC detector. The mass spectrum was obtained at a cone voltage of 100 V. For positive mode, the capillary voltage was set to 3.5 kV. The high-resolution data was analyzed by MassLynx 4.0 software (Waters, Milford, MA, USA). Nitrogen was used as collision gas in the collision cell. The analysis was carried out at a desolvation temperature of 350 °C, a cone gas flow of 50 L/h, and a desolvation gas flow of 500 L/h. The Q-tof was tuned in positive mode, allowing the passage of [M (410.7) + H (1) + CH3CN (41)]+. The results from LC-MS are provided in the Supporting Information (Figure S1). Gene Cloning and Construction of Strains. Template genomic DNA from BY4741 for PCR reactions was isolated using the standard glass beads method.22 PCR amplification of the tHMG1 gene from template was performed using oligonucleotides tHmg1-Gal-F and tHmg1-Gal-R with flanking restriction sites BamHI and EcoRI (Table 1). This fragment was restriction digested and ligated into pYES2/NTC to obtain pYGH. All DNA subcloning steps were performed with E. coli DH5α using standard methods as described,24 and nucleotide sequences of cloned genes were verified by sequencing (ABI-310 DNA sequencer, Applied Biosystems, CA, USA). pYGH was then introduced into the parent strains BY4741 to obtain SK3. PCR amplification of the tHMG1 gene from template was performed using oligonucleotides tHmg1-pTEF-F and tHmg1-pTEF-R with flanking restriction sites NotI and SpeI (Table 1). The fragment was restriction

digested and ligated with pCEV-G1-km to obtain pCTH. PCR amplification of the tHMG1 gene from template was performed using oligonucleotides tHmg1-pPGK-F and tHmg1-pPGK-R with flanking restriction sites BamHI and SalI (Table 1). The fragment was restriction digested and ligated with pCEV-G1-km to obtain pCTH. PCR amplification of the ZWF1, POS5(wM: with Mitochondrial presequence), POS5(w/oM: without mitochondrial presequence), and tHMG1 gene from the genomic DNA template of BY4741 were performed using oligonucleotide pairs Zwf1-F, Zwf1-R; Pos5-F (wM), Pos5-R; Pos5-F (w/oM), Pos5-R and tHmg1-pPGK-F, tHmg1-pPGKR, respectively, with flanking restriction sites BamHI and SalI (Table 1). The fragments were restriction digested and ligated with pCEVG1-km to obtain pCPZ, pCPP(wM), pCPP(w/oM), and pCPH. These fragments were also inserted into pCTH to obtain pCTHPZ, pCTHPP(wM), pCTHPP(w/oM), and pCTHPH. The developed plasmids were introduced into BY4741 strain using the Sc easy Com transformation kit (Invitrogen, Bangalore, India). The plasmid maps of vectors used in the present study are provided in the Supporting Information (Figure S2). Squalene Extraction from S. cerevisiae. Positive transformants were picked and precultured in 50 mL of yeast synthetic medium at 30 °C, 180 rpm for 16 h. The inoculum from preculture was used to cultivate yeast cells with an initial OD of 0.1 in production culture at 30 °C, 180 rpm for 24 h. Cells were harvested by centrifugation to obtain cell pellets, and the supernatants were discarded. The cells were frozen at −20 °C overnight and later subjected to lyophilization at −50 °C under vacuum for 4 h. The lyophilized cells were dispersed in chloroform/methanol (2:1, v/v) mixture (∼50 mL). The dispersed cells were then subjected to sonication for a 3 s pulse for 10 cycles at 70% amplitude using sonicator (Qsonica, Newtown, CT, USA). The lysed cells were incubated under shaking condition for extraction at 30 °C, 180 rpm. Subsequently, the extract was filtered and subjected to flash evaporation at 50 °C. The samples were dispersed in chloroform solvent and subjected to high-speed centrifugation to remove debris prior to RP-HPLC analysis. To obtain the dry cell weight (DCW), cells harvested by centrifugation from the 50 mL culture were oven dried. We obtained the following relationship between OD600 and DCW per milliliter (g-DCW/mL): DCW = (OD × 0.53429) − 0.22216. All optical densities at 600 nm (OD600) measurements were taken using a Shimadzu UV-2550 spectrophotometer. All experiments were carried out in triplicate, and the experimental data represents the averages of biological triplicates. Standard deviations of the data were less than 7% among the replicates. HMG-CoA Reductase Assay. The cells were broken by vortexing with glass beads in 100 mM phosphate buffer (pH 7.0), 1% Triton X100, and 1 mM phenyl methyl sulphonyl fluoride (PMSF) following the method described in Polakowski et al. (1998).12 The supernatant 8164

DOI: 10.1021/acs.jafc.7b02945 J. Agric. Food Chem. 2017, 65, 8162−8170

Article

Journal of Agricultural and Food Chemistry Table 2. Fold Improvement in Squalene Production for Different S. cerevisiae Strainsa

a

strain

overexpressed protein

BY4741 SK3 SK10 SK12 SK13 SK14 SK15 SK16 SK17 SK18 SK19

NA tHmg1p (1X) tHmg1p (1X) tHmg1p (1X) Zwf1p Pos5p (wM) Pos5p (w/oM) tHmg1p (2X) tHmg1p and Zwf1p tHmg1p and Pos5p (wM) tHmg1p and Pos5p (w/oM)

yield (mg/g DW)

yield fold increaseb

± ± ± ± ± ± ± ± ± ± ±

NA 3 1.6 2 6.9 4.3 3.6 16.8 22.2 27.5 16.5

2.1 6.5 3.5 4.4 14.9 9.05 7.5 35.7 47.4 58.6 33

0.36 2.6 0.13 2.07 0.32 0.47 1.48 0.92 3.2 1.43 2.96

conc. (mg/L)

titer fold increaseb

± ± ± ± ± ± ± ± ± ± ±

NA 3 3 2.3 6.1 3.8 5 13.7 12.2 13.9 23

2 6.1 6.3 4.8 12.6 7.6 10 28.1 24.9 28.4 46

0.21 0.05 0.03 2.39 1.72 1.05 3.48 3 0.32 1.08 4.08

NA: Not Applicable. bWith respect to BY4741.

(2010)25 used lacZ as reporter gene to evaluate the efficiency of seven different promoters and observed that PTEF1 and PPGK1 performed similarly in glucose consumption phase and the performance of PTEF1> PPGK1 during ethanol consumption phase. These results also indicate that the performance of constitutive promoter (PTEF1) is as good as a strong inducible promoter (PGAL1). The main advantage of having a constitutive promoter such as PTEF1 is that the carbon source could be a simple sugar such as glucose instead of expensive galactose for large-scale cultivations. Polakowski et al. (1998)12 and several other researchers have established that truncated HMG-CoA (tHMG1) overexpression improved the flux toward the ergosterol synthesis in S. cerevisiae. Since then overexpression of tHMG1 has more or less become a ubiquitous target for producing terpene compounds from S. cerevisiae. In order to assay whether the overexpression of a single copy of tHMG1 (in an episomal plasmid) is optimal or suboptimal, two copies of this gene were cloned into pCEV-G1-Km to generate pCTHPH for expression studies. Therefore, strain SK16 has been generated which harbors tHMG1 under PTEF1 and PPGK1 promoters (cf. Figure 1). From Figure 1A it can be observed that there is a significant increase in the squalene concentration as well as squalene yield in SK16 strain, suggesting enhanced activity of Hmg1p. A maximum squalene titer of 28.1 mg/L and yield of 35.7 (mg/g DW) has been achieved with SK16 strain. There was 4.5- and 14-fold increase in squalene concentration in SK16 compared to that of SK10 and BY4741 strains, respectively (Table 2). Prior investigations have overexpressed tHMG1 gene either using episomal plasmids26 or by integrating this gene at a specific loci in the chromosome.27,28 Generally, S. cerevisiae harboring an episomal plasmid will usually have 10−40 plasmid copies per cell.29 In the case of commercial cultivations, expression of genes on plasmid is not preferred due to instability issues. Hence, key target genes are integrated into the chromosome. For instance, tHMG1 gene has been integrated at three different loci to enhance the rate-limiting step in the terpene biosynthesis pathway.27 In the current study, the strain harboring two copies of tHMG1 gene has led to a 4.5-fold increase in squalene yield over the strains harboring a single copy of the same gene. This suggests that even an episomal plasmid carrying a single copy of tHMG1 is suboptimal for increasing the flux toward squalene or any other terpene precursor. Hence, there is a scope for further improvement of terpene synthesis in S. cerevisiae if copy number of tHMG1 gene is targeted either by multiple integrations or by expressing multiple copies on an episomal plasmid to achieve results closer

was collected, and the cytosolic fraction was further used for determining protein concentration and HMG-CoA reductase activity. The enzyme activity was carried out using a HMG-CoA reductase assay kit from Sigma-Aldrich (St. Louis, MO, USA). Reactions were set using 20 μL of reconstituted NADPH (to obtain a final concentration of 400 μM) and 60 μL of HMG-CoA substrate solution (to obtain a final concentration of 0.3 mg/mL). The reaction was initiated either by addition of HMG-CoA reductase (concentration of 0.5−0.7 mg/mL) provided with the kit or by addition of protein extracted from the sample. The samples were mixed thoroughly prior to spectrophotometric analysis. The activity was calculated according to the manufacturer’s protocol and expressed as micromoles of NADPH oxidized per minute per milligram of protein. The protein content of the cell extracts was calculated using Bradford assay with bovine serum albumin (BSA) as a standard. Absorbance was measured at 340 nm against the blank sample using Shimadzu UV-2550 UV/vis spectrophotometer connected to a computer. The absorbance was measured every 15 s up to 5 min using a kinetic program. The A340 value gradually decreased over the time course due to the oxidation of NADPH.

■

RESULTS AND DISCUSSION Effect of Promoters and Copy Number on HMG-CoA Overexpression during Squalene Synthesis. In the present study, the effect of different promoters (both inducible and constitutive) on tHMG1 gene overexpression toward squalene synthesis has been evaluated. Toward this three of the widely used promoters PGAL1, PTEF1, and PPGK1 were selected using a 2 μm episomal plasmid vector. The expression level of tHMG1 gene from these plasmids has been indirectly measured by quantifying squalene. Quantification was carried out with HPLC, and the peak was verified using LC-MS. The LC-MS results are provided in the Supporting Information (Figure S1). The strains SK3, SK10, and SK12 harboring tHMG1 gene with P GAL1, PTEF1, and P PGK1 promoters, respectively, have significantly improved both squalene concentration and squalene yield (cf. Figure 1A) when compared to that of base strain, BY4741. A maximum squalene concentration of 6.1, 6.2, and 4.8 mg/L was observed in SK3, SK10, and SK12, respectively. A fold increase of 3.0, 3.1, and 2.3 in squalene concentration was observed in these strains when compared to that of the base strain, substantiating the efficacy of HMG-CoA reductase on sterol pathway flux (Table 2). The maximum squalene yield of 6.5 (mg/g DW) was observed in SK3, where PGAL1 was used as the promoter. The relative promoter efficiency ranking in terms of squalene titer was observed to follow PGAL1 = PTEF1 > PPGK1. This result is in accordance with Vickers et al. (2013),23 where they observed that the expression strength of PPGK1 was poor compared to PTEF1. Partow et al. 8165

DOI: 10.1021/acs.jafc.7b02945 J. Agric. Food Chem. 2017, 65, 8162−8170

Article

Journal of Agricultural and Food Chemistry to optimum. This result also shows that the overexpression of HMG-CoA reductase using two copies scavenges the NADPH in cytosol and might lower the fluxes of other anabolic reactions which require NADPH as cofactor. It has been proved that increasing the copy number of the episomal plasmid will increase the protein levels translated from it.30 Likewise, it can be concluded that expression of the same gene as multiple copies in a single cassette could also increase the protein levels. Effect of ZWF1 and POS5 Overexpression for Cofactor Improvement on Squalene Synthesis. The iMM904 genome-scale metabolic model of S. cerevisiae has been screened for NADPH synthesizing reactions which led to the identification of 18 enzymes carrying irreversible reactions for NADPH regeneration and 7 reactions involved in reversible reactions (Table S1).31 Among the 18 enzymes, 1 enzyme is present in peroxisome, 6 enzymes are in mitochondria, and 11 enzymes are present in cytoplasm. The model iMM904 has 1575 reactions among which 91 reactions involve NADPH. Out of 91 reactions, 18 reactions (irreversible) produce NADPH while 75 reactions consume NADPH which implies that NADPH is one of the important cofactors in the yeast cells (cf. Table S1). Enzymes such as cytosolic Zwf1p, Ald6p, and Idp2p contribute to the regeneration of NADPH from NADP+ in the cytosol of S. cerevisiae (cf. Table S1).32 The NADP+ required for these dehydrogenases is supplied by two key NAD kinases, Yef1p and Utr1p in the cytosol. In the case of mitochondria, the NADPH is regenerated using Pos5p, which executes both NADH kinase and NAD kinase activities; however, the former activity was found to be higher.32,33 Hence, in the present study ZWF1 and POS5 which regenerate NADPH pool in cytoplasm and mitochondria, respectively, have been overexpressed to see the effect on squalene synthesis. ZWF1 and POS5 (with mitochondrial presequence) and POS5 (without mitochondrial presequence) were overexpressed in BY4741 to generate strains SK13, SK14 and SK15, respectively. A significant increase in squalene concentration and squalene yield was observed when compared to BY4741 (Figure 2A). The squalene yields obtained from SK13, SK14, and SK15 were found to be 14.9, 9.0, and 7.5 (mg/g DW), respectively (Table 2). Owing to the stable expression of the HMG-CoA reductase under PTEF1 promoter, the PTEF1-tHMG1 cassette was combined with PPGK1ZWF1 and PPGK1-POS5 gene cassettes to form the strains, SK17, SK18, and SK19, respectively. When these strains were analyzed for squalene improvement, squalene yields of 47.4, 58.6, and 33 mg/g DCW were observed in SK17, SK18, and SK19 strains, respectively (Figure 2B). There was a 2- and 3.7fold increase in squalene concentration in SK17 and SK18 strains compared to that of SK13 and SK14, respectively. The increase in concentration and yield with respect to BY4741 was 12.2- and 22.2-fold in the case of SK17 strain and 14- and 27.4fold in the case of SK18 strain (Table 2). Interestingly, the dry cell weights (DCWs) of SK16, SK17, and SK18 were observed to be lower than all other strains (cf. Table 2). This suggests that the flux toward biomass formation is lowered whenever squalene flux was increased. Moreover, Donald et al. (1997)34 also suggests that increased squalene or farnesyldiphosphate (a presqualene intermediate) due to overexpression of tHMG1 could be cytotoxic to the cell and hence the reduced biomass. Naziri et al. (2011)35 observed a maximum squalene yield of 10.02 mg/g DCW using terbinafine and methyl jasmonate as selection pressure during cultivation of wild-type S. cerevisiae, whereas Mantzouridou and Tsimidou (2010)36 achieved a maximum yield of 18.5 mg/g DCW when HMG2 was

Figure 2. Squalene synthesis in S. cerevisiae strains with overexpression of NADPH regenerating genes. (A) Comparison among strains SK13, SK14, and SK15 indicates the effect of overexpression of ZWF1, POS5 (with mitochondrial presequence), and POS5 (without mitochondrial presequence), respectively. (B) Comparison between the strains SK17, SK18, and SK19 indicates the synergistic effect of simultaneous expression of tHMG1 and NADPH regenerating genes. Here SK17, SK18, and SK19 represents SK13, SK14, and SK15 strains, respectively, with additional tHMG1 coexpression.

overexpressed along with K6R mutation in Hmg2p. Both studies resulted in a lesser squalene yield than the present study. Zhuang and Chappell (2015)37 reported a maximum squalene titer of 250 mg/L in ZXB yeast strain at the end of 12 days, which is higher than the maximum titer obtained in the present study (46 mg/L in SK19 at the end of 24 h). ZXB was derived from parental BY4741 strain having mutations for sterol uptake enhancement (EMS treatment and selection), overexpression of hamster tHMG1, deletion of ERG1 and ERG9, and finally heterologous expression of squalene synthase from Botryococcus braunii. NADPH is tightly regulated in the cell in comparison to NADH.38 Studies have been conducted to manipulate the levels of NADP/NADPH ratio in the cytosol.39 Reducing equivalents in the form of NADPH are essential for several metabolic reactions involved in the biosynthesis of cellular macromolecules.40 NADPH is a major cofactor involved in ergosterol biosynthesis and is required by HMG-CoA reductase (HMG1) and squalene synthase (ERG9) for squalene synthesis. Increased squalene content in SK-13, SK-14, and SK-15 can be correlated to the increased NADPH regeneration by overexpressing ZWF1 and POS5 genes. When overexpression of these NADPH regenerating genes was coupled to tHMG1 overexpression, as seen in strains SK-17, SK-18, and SK-19, there was a synergistic effect on squalene synthesis. This indicates that either of Hmg1p or Erg9p or both may be are limited by NADPH supply, hence improving regeneration of NADPH significantly and improved squalene yield. Overexpression of POS5 gene was more effective during such coupled coexpression and has shown 1.2-fold higher squalene yield when compared to that of ZWF1 overexpression. This could be due to the fact that NADPH regeneration is higher in POS5 overexpressed strain owing to the dual functionality of 8166

DOI: 10.1021/acs.jafc.7b02945 J. Agric. Food Chem. 2017, 65, 8162−8170

Article

Journal of Agricultural and Food Chemistry Pos5p as a NAD+ and NADH kinase. The mechanism through which it improves squalene flux has been discussed subsequently. Overexpression of ZWF1 was proven to improve lysine production in C. glutamicum.41 In the case of S. cerevisiae, ZWF1 overexpression has improved tolerance to furfural, which could be exploited for lignocellulose-based bioethanol production.42 There are very few reports on its overexpression for terpene production in S. cerevisiae. Brown et al. (2015)43 has overexpressed ZWF1 for strictosidine production, and Zhao et al. (2015)21 studied its effect on carotene production. Kwon et al. (2006)44 observed there was 6.0-fold increase in Zwf1p activity in S. cerevisiae strain when ZWF1 was overexpressed. However, NADPH levels were not elevated, indicating rapid consumption of this cofactor. In their study the regenerated NADPH was utilized by NADPH-dependent xylose reductase for converting xylose to xylitol as there was significant improvement in xylitol (86 g/L) when compared to control (71 g/L). In contrast to Zwf1p, Pos5p is localized in mitochondrial matrix and plays a key role in protection of mitochondria from oxidative stress.45 Hou et al. (2009)46 overexpressed both full-length Pos5 and Pos5Δ17 (lacking the mitochondrial target signal) in S. cerevisiae to generate cNDK (equivalent to SK15 and SK19 in the present study) and mNDK (equivalent to SK14 and SK18 in present study) strains. They observed improved NADH kinase activity in mNDK and cNDK strains when compared to reference strain and no significant changes in NAD kinase activity when cultivated aerobically using glucose as the carbon source. The rationale behind improved squalene due to POS5 overexpression is not straightforward as in the case of ZWF1. The mitochondrial membrane is impermeable to NADH and NADPH. Hence, the cofactors are restricted to their respective organelles.33 The utr1yef1 double-mutant S. cerevisiae strain showed viability implying that cytosolic NADP+ can also be supplied by Pos5p.32 Thus, supplied NADP+ can be reduced to NADPH by cytosolic dehydrogenases (Zwf1p, Ald6p, and Idp2p). However, the mechanism of NADP+ transport between cytosol and mitochondria has not been well characterized, and the function of several mitochondrial carrier proteins is yet to be uncovered.42 Furthermore, the mitochondrial transport protein Yhm2p which is involved in citrate transport to cytosol has also enhanced the NADPH in cytosol via a citrate− oxoglutarate NADPH redox shuttle between mitochondria and cytosol.45 These two findings suggest that the regeneration of NADPH (via NADH kinase) and NADP+ (via NAD kinase) inside the mitochondria could possibly enhance the NADPH pool in the cytosol. Thus, improved NADPH regeneration in the cytosol in turn could have possibly increased the rates of HMG-CoA reductase (Hmg1p) and squalene synthase (erg9p), thereby increasing the squalene flux. This could be the plausible rationale for improved squalene during overexpression of mitochondrial POS5 either in isolation or when coupled with tHMG1. Zhao et al. (2015)21 overexpressed ZWF1 and POS5 to observe improvement in carotenoid biosynthesis; however, the POS5 gene has been overexpressed without the mitochondrial presequence. Hence, the POS5 gene product was restricted only to cytoplasm. Moreover, the fold increase in the β-carotene yield was only 1.8, and in lycopene it was 1.6 when compared to that of the control strain however significant. NAD kinase activity was found to be significantly improved in the strain overexpressing POS5 in their study. However, NADH kinase activity was not assayed, which is

supposedly seen more when compared to the NAD kinase activity of Pos5p. Shi et al. (2013)47 overexpressed POS5 and ZWF1 from S. cerevisiae in C. glutamicum spp. lactofermentum to observe increased isoleucine production. They extended this study to proteomic analysis in Shi et al. (2015)48 to observe 24 differentially expressed genes in the case of POS5 overexpression and 7 differentially expressed in case of ZWF-ppnk overexpression. Prior investigations were focused on the expression of truncated POS5 gene and its influence in biochemical production.21,48 Strand et al. (2003)19 reported that even the full-length POS5 overexpression has yielded much higher protein when compared to truncated POS5, and the protein from full-length expression has accumulated only in mitochondria. To the best of our knowledge, this is the first study where we report full-length POS5 overexpression has significantly improved squalene in S. cerevisiae. We observe the squalene levels were higher in the case of strains harboring plasmid containing both HMG1 and Zwf1/Pos5, i.e., SK17, SK18, and SK19 in comparison to only Zwf1/Pos5, i.e., SK13, SK14, and SK15. This indicates that overexpression of HMG1 has served as an additional sink for the regenerated NADPH. A similar result was observed by Kwon et al. (2006)44 where expression of NADPH-requiring xylose reductase has improved xylitol production when NADPH was regenerated using overexpression of Zwf1. Hou et al. (2009)46 observes that NADPH regeneration using oxidative pentose phosphate pathway is coupled with CO2 production, whereas NADPH regeneration via POS5 is a decoupled process. Probably this could be the reason for the higher concentration of squalene in SK18 and SK19 than SK17 (Table 2). From the biomass data it is observed that the strains SK14 and SK18 had lower dry cell values (DCW) in comparison to strains SK15 and SK19. In particular, SK18 had the lowest biomass (0.48 g/L) where maximum squalene yield was observed. Here we hypothesize that in strains SK15 and SK19 the regenerated NADPH was involved in the biosynthesis of cellular macromolecules, thereby contributing to biomass. Moreover, as mentioned in Hou et al. (2009),46 as the redox cofactors are impermeable across the mitochondrial membrane, the phenotypes could vary when cytosolic and mitochondrial redox are perturbed. In Vitro HMG-CoA Reductase Assay. HMG1 contributes about 83% of the HMG-CoA reductase activity in wild-type cells, while its isomer, HMG2, contributes the remaining activity, thus indicating the significance of HMG1.10 HMG-CoA is transported to the endoplasmic reticulum where it is reduced to mevalonate by membrane-bound glycoprotein HMG-CoA reductase. The reductive cleavage of HMG-CoA to mevalonate and CoA requires two molecules of NADPH. HMG-CoA reductase activity was determined based on the reduction in absorbance at 340 nm which in turn is due to the NADPH oxidation by the catalytic subunit of HMG-CoA reductase in the presence of the substrate HMG-CoA. In the present study, the strains conferring HMG-CoA reductase activity were ascertained based on the estimation of NADPH changes as described earlier in the Materials and Methods. When compared to BY4741, the crude cell extracts of all transformants displayed significantly higher enzyme activity (cf. Figure 3). Recombinant strains, SK10 and SK12, had similar activity indicating that TEF1 and PGK1 promoter performance was almost the same, whereas SK3 strain, which harbors tHMG1 under PGAL1, showed slightly higher activity when compared to that of SK10 and SK12. Maximum increase in the reductase activity was observed in the strains SK17 and SK18 8167

DOI: 10.1021/acs.jafc.7b02945 J. Agric. Food Chem. 2017, 65, 8162−8170

Article

Journal of Agricultural and Food Chemistry

transformants using G418 antibiotic. It has been established that if ammonium sulfate is used as the nitrogen source in the growth medium for cultivation of S. cerevisiae strain harboring kanMX cassette, the resistance toward G418 is lost.23,50 The exact reason for such loss is not established; however, it was suggested that the ammonium sulfate assimilation might downregulate the reactions involved in import and activity of G418.50 Thus, when selective pressure is lost during successive generations of the cell cycle, the percentage of cells harboring plasmid will be lowered as the cells which are free of plasmids will have a higher growth rate due to selective advantage. This in turn lowers the expression of genes present on the plasmid. The very role of selective pressure (addition of G418 to the medium for present study) is to maintain the plasmid in the cell population. It was also established that if ammonium sulfate is substituted by glutamate (1 g/L) as the nitrogen the resistance to G418 was retained and therefore the selection pressure was maintained.23,50 To corroborate this reasoning experimentally, it was observed that in the strain SK10 squalene content was a meagre 1.42 mg/L when (NH4)2SO4 was used as the nitrogen source, whereas when substituting with glutamate the squalene synthesis was improved to 6.3 mg/L (cf. Figure 4A). Squalene

Figure 3. Comparison of HMG-CoA reductase activity in various S. cerevisiae strains used in the present study.

with fold increase of 10 and 11, respectively, when compared to that of BY4741 (Table 2). Strains SK17 and SK18 harbor tADH1-tHMG1-P TEF1 -P PGK1 -ZWF1-tCYC1 and tADH1tHMG1-PTEF1-PPGK1-POS5-tCYC1 cassettes, respectively, indicating the tHMG1 overexpression and NADPH regenerating ZWF1/POS5 improves the HMG-CoA reductase activity significantly in comparison to other recombinant strains. Interestingly, the SK16 strain harboring tADH1-tHMG1PTEF1-PPGK1-tHMG1-tCYC1 increased the reductase activity by 1.4-fold in comparison to SK10/SK12 and 1.2-fold in comparison to SK3, indicating that presence of two tHMG1 gene copies on a single cassette will improve its activity when compared to single copy. Hence, the strain SK16 produced more squalene in comparison to SK3, SK10, and SK12. Interestingly, ZWF1 (strain SK13) and POS5 (strain SK14) overexpression improved the HMG-CoA reductase activity by 6.5- and 5.5-fold in comparison to BY4741, suggesting HMG1 upregulation. Moreover, this fold increase is alike that of strains SK10 and SK12, indicating the same effect as that of tHMG1 overexpression. Thus, the enzyme activity results corroborate the squalene estimation results found in the earlier section. Polakowski et al. (1998)12 estimated the HMG-CoA reductase activity in the tHMG1 overexpressed strains. In their study it was observed that the episomal plasmid-based overexpression had significantly higher activity in comparison to the singlecopy integration of tHMG1. In the case of episomal expression the specific activity obtained in their study was 0.18 U/mg protein, whereas in the present study it ranged between 0.13 and 0.15 U/mg protein. The specific activity values obtained in the present study are in agreement with Polakowski et al. (1998)12 for both wild-type and tHMG1 overexpressed strains. A maximum specific activity of 0.218 U/mg protein was obtained in the strain SK18 harboring tADH1-tHMG1-PTEF1PPGK1-POS5-tCYC1 cassette. Effect of Nitrogen Sources on G418-Based Vector for tHMG1 Overexpression. Aminoglycoside 3′-phosphotransferase coded by aphA1 gene from E. coli confers aminoglycoside, G418 (Geneticin), resistance in S. cerevisiae and is a commonly implemented selection marker during transformation in S. cerevisiae.23,49,50 The kanMX module on a G418 selection cassette contains the aphA1 gene under a specific promoter and terminator. The plasmid pCEV-G1-Km used in the present study harbors kanMX module for selection of

Figure 4. Effect of medium components on squalene synthesis. (A) Effect of nitrogen source on squalene synthesis using the strain SK10 harboring kanMX cassette for conferring G418 resistance when cultivated in (NH4)2SO4 and glutamate. (B) Effect of carbon source on squalene synthesis using the SK10 having tHMG1 gene under constitutive promoter PTEF1 when cultivated in glucose and galactose.

yield and titers improved significantly, indicating the positive effect of glutamate as the nitrogen source on G418-based gene expression (cf. Figure 4A). Hence, the SD medium used for cultivation has been modified by replacing (NH4)2SO4 with glutamic acid (1 g/L) for the strains harboring plasmids with Geneticin as a selection marker for all shake-flask experiments. Vickers et al. (2013)23 provided comprehensive information on factors affecting the G418 selection, and medium pH and its composition were suggested to be key factors. 8168

DOI: 10.1021/acs.jafc.7b02945 J. Agric. Food Chem. 2017, 65, 8162−8170

Article

Journal of Agricultural and Food Chemistry

dihydroartemisinic acid, precursor to the antimalarial agent artemisinin. Proc. Natl. Acad. Sci. U. S. A. 2012, 109, E111−8. (2) Kampranis, S. C.; Makris, A. M. Developing a yeast cell factory for the production of terpenoids. Comput. Struct. Biotechnol. J. 2012, 3, e201210006. (3) Ignea, C.; Ioannou, E.; Georgantea, P.; Loupassaki, S.; Trikka, F. A.; Kanellis, A. K.; Makris, A. M.; Roussis, V.; Kampranis, S. C. Reconstructing the chemical diversity of labdane-type diterpene biosynthesis in yeast. Metab. Eng. 2015, 28, 91−103. (4) Ro, D.-K.; Paradise, E. M.; Ouellet, M.; Fisher, K. J.; Newman, K. L.; Ndungu, J. M.; Ho, K. a.; Eachus, R. a.; Ham, T. S.; Kirby, J.; Chang, M. C. Y.; Withers, S. T.; Shiba, Y.; Sarpong, R.; Keasling, J. D. Production of the antimalarial drug precursor artemisinic acid in engineered yeast. Nature 2006, 440, 940−3. (5) Paramasivan, K.; Mutturi, S. Progress in terpene synthesis strategies through engineering of Saccharomyces cerevisiae. Crit. Rev. Biotechnol. 2017, 1. (6) Naziri, E.; Mantzouridou, F.; Tsimidou, M. Z. Squalene resources and uses point to the potential of biotechnology. Lipid Technol. 2011, 23, 270−273. (7) http://www.marketsandmarkets.com/Market-Reports/squalenemarket-542345.html (Accessed Aug 24, 2017). (8) Spanova, M.; Daum, G. Squalene - biochemistry, molecular biology, process biotechnology, and applications. Eur. J. Lipid Sci. Technol. 2011, 113, 1299−1320. (9) Rodwell, V. W.; Nordstrom, J. L.; Mitschelen, J. J. Regulation of HMG-CoA reductase. Adv. Lipid Res. 1976, 14, 1−74. (10) Basson, M. E.; Thorsness, M.; Rine, J. Saccharomyces cerevisiae contains two functional genes encoding 3-hydroxy-3-methylglutarylcoenzyme A reductase. Proc. Natl. Acad. Sci. U. S. A. 1986, 83, 5563− 67. (11) Wright, R.; Basson, M. Increased amounts of HMG-CoA reductase induce “Karmellae”: A proliferation of stacked membrane pairs surrounding the yeast nucleus. J. Cell Biol. 1988, 107, 101−114. (12) Polakowski, T.; Stahl, U.; Lang, C. Overexpression of a cytosolic hydroxyl methyl glutaryl-CoA reductase leads to squalene accumulation in yeast. Appl. Microbiol. Biotechnol. 1998, 49, 66−71. (13) Thompson, A.; Kwak, S.; Jin, Y.-s. Squalene Production using Saccharomyces cerevisiae. i-ACES 2014, 1, 57−63. (14) Ohto, C.; Muramatsu, M.; Obata, S.; Sakuradani, E.; Shimizu, S. Overexpression of the gene encoding HMG-CoA reductase in Saccharomyces cerevisiae for production of prenyl alcohols. Appl. Microbiol. Biotechnol. 2009, 82, 837−845. (15) Liu, J.; Zhang, W.; Du, G.; Chen, J.; Zhou, J. Overproduction of geraniol by enhanced precursor supply in Saccharomyces cerevisiae. J. Biotechnol. 2013, 168, 446−451. (16) Agledal, L.; Niere, M.; Ziegler, M. The phosphate makes a difference: cellular functions of NADP. Redox Rep. 2010, 15, 2−10. (17) Shi, F.; Kawai, S.; Mori, S.; Kono, E.; Murata, K. Identification of ATP-NADH kinase isozymes and their contribution to supply of NADP(H) in Saccharomyces cerevisiae. FEBS J. 2005, 272, 3337−3349. (18) Shi, F.; Li, Z.; Sun, M.; Li, Y. Role of mitochondrial NADH kinase and NADPH supply in the respiratory chain activity of Saccharomyces cerevisiae. Acta Biochim. Biophys. Sin. 2011, 43, 989−995. (19) Strand, M. K.; Stuart, G. R.; Longley, M. J.; Graziewicz, M. A.; Dominick, O. C.; Copeland, W. C. POS5 gene of Saccharomyces cerevisiae encodes a mitochondrial NADH kinase required for stability of mitochondrial DNA. Eukaryotic Cell 2003, 2, 809−820. (20) Becker, J.; Klopprogge, C.; Herold, A.; Zelder, O.; Bolten, C. J.; Wittmann, C. Metabolic flux engineering of L-lysine production in Corynebacterium glutamicum: over expression and modification of G6P dehydrogenase. J. Biotechnol. 2007, 132, 99−109. (21) Zhao, X.; Shi, F.; Zhan, W. Overexpression of ZWF1 and POS5 improves carotenoid biosynthesis in recombinant Saccharomyces cerevisiae. Lett. Appl. Microbiol. 2015, 61, 354−360. (22) Amberg, D. C.; Burke, D. J.; Dawson, D.; Stearns, T. Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, 2005.

Similarly the carbon sources, glucose and galactose, have been evaluated for squalene production when constitutive promoter PTEF1 was utilized. When strain SK10 was cultivated on 2% glucose or 2% galactose using glutamic acid (1 g/L) as the nitrogen source, the squalene production levels were slightly higher in the case of 2% glucose when compared to 2% galactose (Figure 4B). Partow et al. (2010) reported that TEF1 is a truly constitutive promoter and is not affected by a change in the carbon source. Therefore, the results obtained are also in accordance with Partow et al. (2010).25 In conclusion, we demonstrate that single-copy episomal overexpression of tHMG1 is suboptimal for producing squalene in S. cerevisiae. We also show that NADPH-regenerating enzymes can improve squalene synthesis in S. cerevisiae when overexpressed either in isolation or in tandem with tHMG1. In the latter, the effect was highly synergistic. We also observed that full-length POS5 overexpression improved squalene in cytosol even though its protein, pos5p, localizes in mitochondria, although further studies are needed to elucidate the exact reason for this observation. Finally, we conclude that the strategies employed in the present study could be potentially applied for engineering S. cerevisiae for squalene improvement and also for other industrially relevant terpenes.

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.jafc.7b02945. LC-MS profile of squalene against a standard; plasmid maps constructed for the current study; list of reactions in S. cerevisiae involved in NADPH synthesis based on iMM904 in-silico model (PDF)

■

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]; [email protected]. Phone: +91-821-2517539. ORCID

Sarma Mutturi: 0000-0002-3251-8643 Funding

Financial support was provided by the Department of Biotechnology, India (award of research fellowship), and by the Science Engineering and Research Board (SERB), India (YSS/2014/000565). Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS The authors thank Mr. Sandeep Kumar, RGNF-JRF, for his useful comments and suggestions on cloning experiments and Director Prof. Ram Rajasekharan (Lipid Science Department, CSIR-CFTRI) for providing us the BY4741 strain and the plasmid, pYES2/NTC. The authors also acknowledge Mr. P Mukund Lakman, Central Instrumentation Facilities, CSIRCFTRI, for HPLC and LC-MS studies.

■

REFERENCES

(1) Westfall, P. J.; Pitera, D. J.; Lenihan, J. R.; Eng, D.; Woolard, F. X.; Regentin, R.; Horning, T.; Tsuruta, H.; Melis, D. J.; Owens, A.; Fickes, S.; Diola, D.; Benjamin, K. R.; Keasling, J. D.; Leavell, M. D.; McPhee, D. J.; Renninger, N. S.; Newman, J. D.; Paddon, C. J. Production of amorphadiene in yeast, and its conversion to 8169

DOI: 10.1021/acs.jafc.7b02945 J. Agric. Food Chem. 2017, 65, 8162−8170

Article

Journal of Agricultural and Food Chemistry (23) Vickers, C. E.; Bydder, S. F.; Zhou, Y.; Nielsen, L. K. Dual gene expression cassette vectors with antibiotic selection markers for engineering in Saccharomyces cerevisiae. Microb. Cell Fact. 2013, 12, 96. (24) Sambrook, J.; Russell, D. E. Molecular cloning: a laboratory manual, 2nd ed.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, 2001. (25) Partow, S.; Siewers, V.; Bjørn, S.; Nielsen, J.; Maury, J. Characterization of different promoters for designing a new expression vector in Saccharomyces cerevisiae. Yeast 2010, 27, 955−64. (26) Li, Q.; Sun, Z.; Li, J.; Zhang, Y. Enhancing beta-carotene production in Saccharomyces cerevisiae by metabolic engineering. FEMS Microbiol. Lett. 2013, 345, 94−101. (27) Asadollahi, M. A.; Maury, J.; Schalk, M.; Clark, A.; Nielsen, J. Enhancement of farnesyl diphosphate pool as direct precursor of sesquiterpenes through metabolic engineering of the mevalonate pathway in Saccharomyces cerevisiae. Biotechnol. Bioeng. 2010, 106, 86− 96. (28) Da Silva, N. A.; Srikrishnan, S. Introduction and expression of genes for metabolic engineering applications in Saccharomyces cerevisiae. FEMS Yeast Res. 2012, 12, 197−214. (29) Romanos, M. A.; Scorer, C. A.; Clare, J. J. Foreign gene expression in yeast − a review. Yeast 1992, 8, 423−488. (30) Chen, Y.; Partow, S.; Scalcinati, G.; Siewers, V.; Nielsen, J. Enhancing the copy number of episomal plasmids in Saccharomyces cerevisiae for improved protein production. FEMS Yeast Res. 2012, 12, 598−607. (31) Mo, M. L.; Palsson, B. Ø.; Herrgård, M. J. Connecting extracellular metabolomic measurements to intracellular flux states in yeast. BMC Syst. Biol. 2009, 3, 37. (32) Miyagi, H.; Kawai, S.; Murata, K. Two sources of mitochondrial NADPH in the yeast Saccharomyces cerevisiae. J. Biol. Chem. 2009, 284, 7553−7560. (33) Outten, C. E.; Culostta, V. C. A novel NADH kinase is the mitochondrial source of NADPH in Saccharomyces cerevisiae. EMBO. J. 2003, 22, 2015−2024. (34) Donald, K. A. G.; Hampton, R. Y.; Fritz, I. B. Effects of overproduction of the catalytic domain of 3-hydroxy-3- methylglutaryl coenzyme A reductase on squalene synthesis in Saccharomyces cerevisiae. Appl. Environ. Microbiol. 1997, 63, 3341−3344. (35) Naziri, E.; Mantzouridou, F.; Tsimidou, M. Z. Enhanced squalene production by wild-type Saccharomyces cerevisiae strains using safe chemical means. J. Agric. Food Chem. 2011, 59, 9980−9989. (36) Mantzouridou, F.; Tsimidou, M. Z. Observations on squalene accumulation in Saccharomyces cerevisiae due to the manipulation of HMG2 and ERG6. FEMS Yeast Res. 2010, 10, 699−707. (37) Zhuang, X.; Chappell, J. Building terpene production platforms in yeast. Biotechnol. Bioeng. 2015, 112, 1854−1864. (38) Moreira Dos Santos, M.; Raghevendran, V.; Kötter, P.; Olsson, L.; Nielsen, J. Manipulation of malic enzyme in Saccharomyces cerevisiae for increasing NADPH production capacity aerobically in different cellular compartments. Metab. Eng. 2004, 6, 352−363. (39) Asadollahi, M. A.; Maury, J.; Patil, K. R.; Schalk, M.; Clark, A.; Nielsen, J. Enhancing sesquiterpene production in Saccharomyces cerevisiae through in silico driven metabolic engineering. Metab. Eng. 2009, 11, 328−34. (40) Grabowska, D.; Chelstowska, A. The ALD6 gene product is indispensable for providing NADPH in yeast cells lacking glucose-6phosphate dehydrogenase activity. J. Biol. Chem. 2003, 278, 13984− 13988. (41) Becker, J.; Klopprogge, C.; Herold, A.; Zelder, O.; Bolten, C. J.; Wittmann, C. Metabolic flux engineering of L-lysine production in Corynebacterium glutamicumover expression and modification of G6P dehydrogenase. J. Biotechnol. 2007, 132, 99−109. (42) Gorsich, S.; Dien, B.; Nichols, N.; Slininger, P.; Liu, Z.; Skory, C. Tolerance to furfural-induced stress is associated with pentose phosphate pathway genes ZWF1, GND1, RPE1, and TKL1 in Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol. 2006, 71, 339− 349.

(43) Brown, S.; Clastre, M.; Courdavault, V.; O’Connor, S. E. De novo production of the plant-derived alkaloid strictosidine in yeast. Proc. Natl. Acad. Sci. U. S. A. 2015, 112, 3205−10. (44) Kwon, D.-H.; Kim, M.-D.; Lee, T.-H.; Oh, Y.-J.; Ryu, Y.-W.; Seo, J.-H. Elevation of glucose 6-phosphate dehydrogenase activity increases xylitol production in recombinant Saccharomyces cerevisiae. J. Mol. Catal. B: Enzym. 2006, 43, 86−89. (45) Castegna, A.; Scarcia, P.; Agrimi, G.; Palmieri, L.; Rottensteiner, H.; Spera, I.; Germinario, L.; Palmieri, F. Identification and functional characterization of a novel mitochondrial carrier for citrate and oxoglutarate in Saccharomyces cerevisiae. J. Biol. Chem. 2010, 285, 17359−17370. (46) Hou, J.; Vemuri, G. N.; Bao, X.; Olsson, L. Impact of overexpressing NADH kinase on glucose and xylose metabolism in recombinant xylose-utilizing Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol. 2009, 82, 909−919. (47) Shi, F.; Li, K.; Huan, X.; Wang, X. Expression of NAD(H) kinase and glucose-6-phosphate dehydrogenase improve NADPH supply and L-isoleucine biosynthesis in Corynebacterium glutamicum ssp. lactofermentum. Appl. Biochem. Biotechnol. 2013, 171, 504−521. (48) Shi, F.; Li, K.; Li, Y. Comparative proteome analysis of global effect of POS5 and zwf-ppnK overexpression in l-isoleucine producing Corynebacterium glutamicum ssp. lactofermentum. Biotechnol. Lett. 2015, 37, 1063−1071. (49) Webster, T. D.; Dickson, R. C. Direct selection of Saccharomyces cerevisiae resistant to the antibiotic G418 following transformation with a DNA vector carrying the kanamycin-resistance gene of Tn903. Gene 1983, 26, 243−252. (50) Cheng, T. H.; Chang, C.-R.; Joy, P.; Yablok, S.; Gartenberg, M. R. Controlling gene expression in yeast by inducible site-specific recombination. Nucleic. Acids. Res. 2000, 28, e108−e108.

8170

DOI: 10.1021/acs.jafc.7b02945 J. Agric. Food Chem. 2017, 65, 8162−8170