Regulation of Catalytic DNA Activities with Thermosensitive Gold

Subscriber access provided by University of Sunderland

Interface Components: Nanoparticles, Colloids, Emulsions, Surfactants, Proteins, Polymers

Regulation of Catalytic DNA Activities with Thermosensitive Gold Nanoparticle Surfaces Fengyun Li, Qi Gao, Mingjie Yang, and Weiwei Guo Langmuir, Just Accepted Manuscript • DOI: 10.1021/acs.langmuir.8b02149 • Publication Date (Web): 02 Oct 2018 Downloaded from http://pubs.acs.org on October 4, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Regulation of Catalytic DNA Activities with Thermosensitive Gold Nanoparticle Surfaces

Fengyun Li,† Qi Gao,† Mingjie Yang,† and Weiwei Guo*,†,‡ †

College of Chemistry, Research Center for Analytical Sciences, State Key

Laboratory of Medicinal Chemical Biology and Tianjin Key Laboratory of Molecular Recognition and Biosensing, Nankai University, Tianjin 300071, P. R. China ‡

Collaborative Innovation Center of Chemical Science and Engineering (Tianjin), 94

Weijin Road, Tianjin 300071, P. R. China KEYWORDS: Catalytic regulation, Poly(N-isopropylacrylamide), DNAzyme, Nano interface, Biosensing

1

ACS Paragon Plus Environment

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 32

ABSTRACT: The regulation of the activities of catalytic DNA is of great importance in many applications, especially in biosensing, controllable drug carrier and gene therapy. In this work, the surfaces of gold nanoparticles (AuNPs) are simultaneously modified with thermoresponsive polymer, poly(N-isopropylacrylamide) (pNIPAM), and catalytic DNA, to form thermosensitive catalytic DNA/pNIPAM/AuNP systems. The

thermosensitive

pNIPAM

on

the

surfaces

of

AuNPs

enables

the

temperature-controlled catalytic activities of the system in a narrow temperature range. The catalytic DNA/pNIPAM/AuNP system exhibits almost no catalytic activities at temperature below lower critical solution temperature (LCST) of pNIPAM, and become highly catalytic by rising temperature higher than LCST. Two kinds of catalytic DNA, the entropy-driven DNA catalytic network and the Mg2+-dependent DNAzyme, were chosen as model catalytic systems, and results showed that the regulation of catalytic activities for both systems were achieved efficiently. These systems may have important application potentials in future biosensing and biomedical applications.

2


Page 3 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

1. INTRODUCTION As a versatile biopolymer, DNA possesses many attractive and unique properties,1-5 including good biocompatibility, specific molecular recognition, and programmable assembly with nanometer resolution originated from precise base pairing, which make it a powerful building block for the construction of functional materials from nanometer to macroscopic scale6-8. Catalytic DNA is a kind of functional DNA with catalytic properties. The most widely used catalytic DNA are DNAzyme and enzyme-free entropy-driven system, which can catalyze a series of reactions, such as DNA or RNA cleavage9,10, DNA ligation11, small molecule decomposition12 and DNA structure rearrangement13. The unique catalytic properties and extensive catalytic actions make catalytic DNA widely applicable in biosensing14-16, disease diagnosis17 and nanostructure assembly18. The regulation of catalytic DNA activities is of great importance in many biological and therapy applications. It paves the way to modulate many cellular processes such as gene expression19, cell differentiation and metabolism20, which has potential applications in gene therapy and controlled biosensing. Moreover, owing to the specificity and structural diversity of catalytic DNA,21,22 the regulation of catalytic activities is also important in controllable drug carrier, nanomachine and nanostructure assembly. Till now, only a few strategies for the catalytic DNA activities regulation have been proposed.23 For example, Fan et al. reported the regulation of hemin/G-quadruplex activity through a dynamic DNA tetrahedral nanostructure.24

Willner’s

group

realized

the

controllability

of

Mg2+-dependent DNAzyme activity by stimuli-triggered constitutional dynamic networks of DNA nanostructures.25 However, the multiple DNA structures and ingenious structural design in the above strategies make these methods complicated and expensive, and limit their further applications. Therefore, how to realize the regulation of activities of catalytic DNA in a simple and universal way is urgently in need. Poly (N-isopropylacrylamide) (pNIPAM) is a

kind of

most studied

thermosensitive polymer that can respond to ambient temperature changes, exhibiting obvious conformational switches at lower critical solution temperature (LCST).26-28 3


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 32

pNIPAM displays a swollen, hydrophilic state at temperature below LCST, and will transform to a shrunken, hydrophobic state at temperature above LCST.29,30 What's more, with the LCST on the verge of living body temperature31, pNIPAM is suitable for many fields, such as sensing32, separation33 and drug delivery.34 Recently, pNIPAM and its derivatives are increasingly applied in the preparation of responsive nanomaterials,35,36 rendering the nanoparticles many novel properties.37 For example, Wang's group reported that by conjugating gold nanoparticles with pNIPAM and protein, modulation of protein activities on a large scale was realized by changing temperature.38,39 The previous works show the possibility of regulation the activity of system through combination with thermos-sensitive pNIPAM. In this paper, we constructed smart multifunctional nanoparticles with controllable

catalytic

activity

by

modifying

gold

nanoparticles

with

a

thermoresponsive polymer pNIPAM and a catalytic DNA. This stimuli-responsive system contained three parts: (1) pNIPAM with a mercapto group at the end, acting as thermo-responsive element that can switch between stretching hydrophilic state and shrinking hydrophobic state rapidly around the LCST; (2) catalytic DNA, two typical structures, the entropy-driven DNA catalytic system and the Mg2+-dependent nicking DNAzyme were chosen in this work;40,41 (3) gold nanoparticles (AuNPs), serving as solid matrix, which have many advantages including large surface-to-volume ratio, surface modifiability and biocompatibility.42 Regulation of catalytic DNA activities were successfully achieved in the assembled DNA/pNIPAM/AuNP systems. DNA/pNIPAM/AuNP systems showed smart responses to ambient temperature: at temperature lower than LCST, the swollen pNIPAM shielded the catalyst DNA and hindered them to catalyze the substrates. While when temperature was higher than LCST, the pNIPAM collapsed rapidly to expose the catalyst DNA, exhibiting efficient catalyzing activity to substrates.

2. EXPERIMENTAL SECTION Reagents

and

N-isopropylacrylamide

Materials.

(NIPAM),

2-(dodecylthiocarbonothioylthio)-2-methyl propionic acid (DDMAT), trisodium 4


Page 5 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

citrate dihydrate, hydrogen tetrachloroaurate (III) (Au 50%), hexylamine, magnesium acetate

and

sodium

DL-Dithiothreitol

chloride

(DTT),

were

purchased

ammonium

persulfate

from (APS)

Energy and

N,

Chemical. N,

N',

N'-tetramethylethylenediamine (TEMED) were purchased from Sigma-Aldrich. 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), magnesium chloride hexahydrate and 2,2'-Azobis(2-methylpropionitrile) (AIBN) were purchased from Aladdin. Tween 20, Acryl/Bis 30% solution (19:1), 6×Sucrose Gel Loading Dye I (BPB), Low MW DNA Marker-A, GenGreen and Tris-borate-EDTA (TBE) buffer (5×225 mM Tris-boric acid, 50 mM EDTA, pH 8.0) were purchased from Sangon Biotech. Co. Ltd. (Shanghai, China). All other chemical reagents were analytical grade without further purification. The oligonucleotides were synthesized and purified by Sangon Biotech. Co. Ltd. Sequences of the DNA are shown in Table 1. Ultrapure water (18.2 MΩ·cm) purified by a Milli-Q system (Millipore, Bedford, MA, USA) was used to prepare all the solutions. Table 1. Sequences of the DNA strands used in this work Name

Sequence (5'-3')

S1

Cy3-CCTACTTATCTACTACTTCG

S2

CCCTATCACCATCTACTAGTC

S3

CATGATAGGACTAGTAGATGGTGATAGGGCGAAGTAGTAGATAAGTAGG-BHQ2

T-SH

TCACCATCTACTAGTCCTATCATGTTTTT-SH

F

CCTACTTATCTACTACTTCGCCCTATCACCATCTACTAGTC

FAM-T-SH

FAM-TCACCATCTACTAGTCCTATCATGTTTTT-SH

DNA 1

SH-TTTCTCATTCAGCGATCCGGAACGGCACCCATGTTCTGTGA

DNA 2

ROX-TCACAGA TrAG GAATGAG-BHQ2

FAM-1

SH-TTTCTCATTCAGCGATCCGGAACGGCACCCATGTTCTGTGA-FAM

com-T-SH

CATGATAGGACTAGTAGATGGTGATTTTT-SH

Figure 1 shows the synthetic route of pNIPAM-SH. N-isopropyl acrylamide should be recrystallized in n-hexane before use. Compound 1 was synthesized using reversible addition-fracture chain transfer polymerization (RAFT) method, with the 5


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

details described as below.

Figure 1. Synthesis route of pNIPAM-SH. Synthesis of pNIPAM by RAFT polymerization (pNIPAM-RAFT, 1), and the synthesis of thiol-terminated pNIPAM (pNIPAM-SH, 2). NIPAM (1.02 g, 9.0 mmol), and DDMAT (8.75 mg, 0.0241 mmol) were dissolved in 1,4-dioxane (4 mL), followed by the addition of AIBN (0.8 mg, 0.0481 mmol). The solution was degassed with a gentle stream of nitrogen for 30 min at room temperature. Then the reaction was stirred under nitrogen in a pre-heated oil bath at 60 °C for 150 min. After reaction, the mixture was quenched in an ice bath. The reaction mixture was diluted with 2 mL of anhydrous tetrahydrofuran and added into cold n-hexane to obtain the light-yellow precipitate. The light-yellow precipitate was redissolved in 2 mL of anhydrous tetrahydrofuran and precipitated into n-hexane for four times. Finally, the purified products were dried under vacuum to yield compound 1 as a light yellow solid. 1H NMR (400 MHz, CDCl3) δ (ppm): 7.24-5.80 (br s,-NH), 4.00 (br s, -NCH), 2.36-0.80 (br m, backbone), 0.87 (t, -CH3 end group). Mn, NMR = 10663 g·mol-1. Compound 1 (213.3 mg, 0.02 mmol) and n-hexylamine (155.5 mg, 1.54 mmol) were dissolved in anhydrous methanol (3.86 mL). The reaction solution was degassed by bubbling with nitrogen for 30 min, and then stirred under nitrogen at room temperature for 120 min. After reaction, the mixture was evaporated in vacuum and the residue was dissolved with 2 mL of anhydrous tetrahydrofuran. The solution was added into cold diethyl ether to obtain the white precipitate. The products were precipitated three times in cold diethyl ether, collected by filtration. Finally, the 6


Page 6 of 32

Page 7 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

purified products were dried under vacuum to yield compound 2 as a white solid. Determination of phase transition temperature (LCST) of pNIPAM-SH (2). The optical transmittance of the pNIPAM-SH (2) in TAE/Mg2+ buffer (40 mM Tris-acetic acid, 1 mM EDTA, 12.5 mM Mg(Ac)2) and HEPES buffer (20 mM HEPES, 20 mM MgCl2, 500 mM NaCl) at 500 nm were measured by a UV2600 spectrophotometer with a heating rate of 0.5 °C/min controlled by a refrigerated circulator (TC 1 temperature controller). Synthesis of gold nanoparticles and the co-modification of gold nanoparticles with DNA and pNIPAM-SH (2). 13 nm gold nanoparticles were prepared by a typical sodium citrate reduction method.43 Before synthesis, all glassware used was soaked in aqua regia for 15 min, rinsed with ultrapure water, and then oven-dried at 100 °C. Generally, HAuCl4·3H2O (50 mM, 2 mL) was added to Milli-Q water (98 mL) in a round-bottom flask under stirring. After the solution was heated to reflux, sodium citrate solution (38.8 mM, 10 mL) was rapidly added to the boiling solution, the reaction color changed to burgundy finally. The reaction was allowed to reflux for another 15 min, then cooled down to room temperature and filtered through a 0.22 µm Millipore membrane filter. The nanoparticles were stored in dark at 4 °C. Before the modification, 40 µM DNA strands were treated with 4 mM DTT in phosphate buffer (50 mM, pH 8.0) for 1 h. After reduction, the DNA was purified by a Microcon (Millipore) spin filter unit (MWCO: 3 KD), then quantified by UV-vis spectrophotometer. Then, the new reduced DNA (50 µM) was added to 10 nM AuNPs containing 0.1% Tween 20, the final concentration of DNA ligand was 4.6 µM. The mixture was gently shaken overnight, then salted with 5 M NaCl for ten times to get an elevated salt concentration of 0.3 M. The mixture was aged for 12 h to achieve maximum ligand loading. The DNA functionalized nanoparticles were purified by three times centrifugation and redispersion with ultrapure water. To quantify the amount of DNA conjugated to AuNPs, FAM-labeled DNA (FAM-T-SH or FAM-1) was used to react with AuNPs with the same process. The fluorescence (FL) intensity of the supernatant solutions before and after the conjugation was measured to calculate the amount of conjugated DNA. 7


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 32

To co-functionalize the AuNPs with both DNA and pNIPAM-SH, mixtures of freshly reduced DNA and pNIPAM-SH with different molar ratios (DNA: polymer = 1:1, 1:3, 1:5, 1:9) were added into 10 nM AuNPs containing 0.1% Tween 20, the final concentrations of the ligands were 4.6 µM. Then the purification of functionalized AuNPs was same with the DNA conjugation process. Preparation of three-stranded complexes S. Strands S1, S2 and S3 for three-stranded complex S were prepared with same amount at 10 µM in 1×TAE/Mg2+ buffer (40 mM Tris-acetic acid, 1 mM EDTA, 12.5 mM Mg(Ac)2). The mixed solution was annealed at 95 °C for 15 min, then cooling to room temperature to get stable complexes S. Catalysis of T-SH/AuNP and T-SH/pNIPAM/AuNP at 33 °C and 38 °C. The three-stranded complex S (0.5 µM) was incubated in TAE/Mg2+ buffer at 33 °C and 38 °C for 10 min, then added the fuel strand F (0.6 µM) and T-SH/AuNP (0.1 µM) or T-SH/pNIPAM/AuNP (0.1 µM) to the mixture to incubate for another 1 h. The FL signal

of

the

catalytic

process

was

monitored

by

F-4600

fluorescence

spectrophotometer with the excitation and emission wavelength set at 540 nm and 565 nm, respectively. Catalysis of DNA1/AuNP and DNA1/pNIPAM/AuNP at 25 °C and 30 °C. DNA1/AuNP (0.2 µM) or DNA1/pNIPAM/AuNP (0.2 µM) was incubated in HEPES buffer at 25 °C and 30 °C for 10 min, then DNA2 (2 µM) was added to the mixture to incubate for another 2 h. After catalysis, the FL signal was monitored by F-4600 fluorescence spectrophotometer with the excitation and emission wavelength set at 580 nm and 608 nm, respectively. Characterization. Dynamic light scattering (DLS). DLS experiments were measured on a Nano ZS Zetasizer (Malvern Instruments). The hydro-dynamic diameters were acquired by the instrument software. The diameters of pNIPAM-SH (2) in TAE/Mg2+ buffer at different temperature (20 °C, 25 °C, 30 °C, 35 °C, 40 °C, 45 °C, 50 °C) were measured, and the solutions to equilibrate thermally at each temperature for 5 min prior to measurement. Transmission electron microscopy (TEM). TEM was carried out on a Tecnai G2 8


Page 9 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

F20 instrument operating at 200 kV acceleration voltage. Samples were prepared by drop-casting of dilute solutions on ultra-thin copper grids and dried at room temperature. Polyacrylamide gel electrophoresis (PAGE). PAGE was carried out on an EPS 601 electrophoresis

unit.

The

gel

consisted

of

12%

polyacrylamide

(acrylamide/bis-acrylamide = 19:1) in 1×TBE/Mg2+ buffer. After reaction, a portion (10 µL) of the reaction solution was mixed with 2 µL of 6×Sucrose Gel Loading Dye I and loaded onto the gel. The gel was run at room temperature for 4 h at 130 V in 1×TBE/Mg2+ buffer, then stained with GenGreen and imaged with a GenoSens 1860 gel analysis system (Clinx, Shanghai). UV-Vis absorption spectroscopy (UV-Vis) and FL spectroscopy. UV-vis absorption spectra were recorded with a UV2600 spectrophotometer (HITACHI) equipped with a TC 1 temperature controller (QUANTUM NORTHWEST). FL spectra were recorded by an F-4600 fluorescence spectrophotometer (HITACHI).

RESULTS AND DISCUSSION Synthesis and thermal responsive property of pNIPAM-SH. A smart thiol-terminated pNIPAM was first synthesized by RAFT polymerization according to the recently published work.44 NIPAM was polymerized with DDMAT using AIBN as an initiator to synthesize pNIPAM-RAFT 1 (Figure 1). The Mw of pNIPAM-RAFT 1 was ~11 KD determined from NMR (Figure S1 in the supporting information). The pNIPAM-SH was prepared by reducing the thiolester in pNIPAM-RAFT 1 to a thiol group with n-hexylamine. The thermal responsive property of pNIPAM-SH was first reflected by DLS in Figure 2A, which showed the reversible change in hydrodynamic diameter from free form (Dh = 27 nm) to aggregate form (Dh = 470 nm) as a function of temperature. UV-vis absorption spectroscopy was further used to determine the lower critical solution temperature (LCST) of the polymer. Figure 2B showed the changes in transmittance of the polymer, which revealed sharp gel transition at 36 °C in TAE buffer and 27 °C in HEPES buffer. These results indicated that the prepared pNIPAM-SH had sensitive thermo-responsive behavior. 9


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 2. Thermal responsive property of pNIPAM-SH. (A) Hydrodynamic diameter (Dh) of pNIPAM-SH as a function of temperature. (B) Transmittance of pNIPAM-SH as a function of temperature (black line, TAE buffer containing 12.5 mM Mg(Ac)2; red line, HEPES buffer containing 500 mM NaCl, 20 mM MgCl2). Surface functionalization of AuNPs. The gold nanoparticles (AuNPs) were firstly prepared by reducing with sodium citrate, then the freshly reduced DNA or DNA/pNIPAM were modified to the surface of AuNPs according to Mirkin’s method.45 DLS and UV-vis spectroscopy were used to validate the surface functionalization of AuNPs. As shown in Figure 3A, the hydrodynamic diameter (Dh) of AuNPs increased obviously after modified with T-SH and pNIPAM, the size of AuNPs in aqueous solution was 18 nm and increased to 27 nm after conjugated with T-SH, then further increased to 32 nm after modified with T-SH and pNIPAM. The sizes of pNIPAM/AuNP and T-SH/pNIPAM/AuNP decreased obviously with the temperature rising from 25 °C to 45 °C, indicating the thermosensitive pNIPAM was successfully modified. As shown in Figure 3B, after surface conjugation, the maximum absorption peak exhibited slight red-shift to 521 nm and 523 nm respectively after binding of T-SH and T-SH/pNIPAM, compared with bare AuNPs at 519 nm. The above results confirmed the successful surface functionalization. The morphology of the AuNPs before and after surface modification was also investigated by TEM. As shown in Figure 3C, the synthesized AuNPs were uniform spherical with an average size of 13 nm. After covered by T-SH and pNIPAM, the T-SH and pNIPAM could provide charge and steric stabilization to the AuNPs, made them more dispersive shown in Figure 3D. 10


Page 10 of 32

Page 11 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Figure 3. (A) Particle size distribution from DLS of AuNPs (black line), T-SH/AuNP (red line), pNIPAM/AuNP (pink line, 25 °C; blue line, 45 °C) and T-SH/pNIPAM/AuNP (green line, 25 °C; navy blue line, 45 °C). (B) UV-vis absorption spectra of AuNPs (black line), T-SH/AuNP (pink line) and T-SH/pNIPAM/AuNP (blue line). (C, D) TEM images of AuNPs and T-SH/pNIPAM/AuNP. After functionalized by thermosensitive pNIPAM, the temperature responsive properties of the T-SH/pNIPAM/AuNP were investigated. UV-vis spectroscopy was used to detect the maximum absorption peak shift of T-SH/pNIPAM/AuNPs at temperature below and above LCST temperature (25 °C and 45 °C, respectively). Figure 4 showed that with the temperature rising from 25 °C to 45 °C, the absorption peak red-shifted slightly from 523 nm to 525 nm, then was back to 523 nm when the temperature dropped back to 25 °C. Besides, the assembly capacity of T-SH/pNIPAM/AuNP at a temperature above LCST (38 °C) with another AuNPs modified with complementary DNA (com-T-SH) was investigated. After incubated at 38 °C for 30 min, the DLS results and UV-vis absorption spectra in Figure S2 showed a larger hydrodynamic size centered at ca 570 nm and a red-shifted absorption peak compared with the system at 33 °C, confirmed the aggregation of AuNPs at temperature above the LCST of pNIPAM. These results confirmed that the pNIPAM 11


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

polymer endowed the T-SH/pNIPAM/AuNP system reversible thermo-responsive property, and the T-SH DNA still retained the function to identify its complementary DNA.

Figure 4. UV-vis absorption spectra of T-SH/pNIPAM/AuNP between 25 °C (T ˂ LCST, black line) and 45 °C (T ˃ LCST, red line), inset: shifts of maximum absorption wavelength between 25 °C and 45 °C. Regulation of catalytic activity of entropy-driven system. pNIPAM can change states from elongated to collapsed when rising ambient temperature, and it has been proved that the T-SH/pNIPAM/AuNP showed thermosensitive property, thus it would be possible to regulate the catalytic activity of DNA conjugated to pNIPAM/AuNP by changing temperature. We designed entropy-driven catalytic system, as illustrated in Figure 5, the S1 and S3 of the complex S were modified with a fluorescent ‘cy3’ reporter and a ‘BHQ2’ quencher, respectively. Addition of catalyst T-SH and fuel strand F to the complex S will trigger branch migration and strand displacement, leading to release the reporter for FL detection, and regenerate the T-SH for new catalysis.

12


Page 12 of 32

Page 13 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Figure 5. Schematic diagram of the entropy-driven catalytic system. As shown in Figure 6A, only negligible FL signals were observed during the 1 h reaction time for complex S, complex S + T-SH and complex S + F, demonstrated that the entropy-driven system has low background and high stability. When the fuel strand F and T-SH were added to the complex S simultaneously, the FL intensity of the system increased rapidly (Figure 6A, pink line), and the FL signal of the catalytic system increased faster and higher with the increase concentration of catalyst T-SH (Figure 6B), indicating that the T-SH could catalyze the system effectively. Electrophoresis was also used to monitor the catalysis of the system (see Figure S3), only the mixture including complex S, F and T-SH could produce the lane of reporter S1 after reaction, further verifying the high stability and catalytic efficiency of the designed entropy-driven system. After conjugated the catalyst T-SH to the surface of AuNPs, the system still has high catalytic activity (shown in Figure S4), providing the possibility to control the catalytic activity of T-SH at the surface of AuNPs.

13


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 32

Figure 6. (A) FL kinetics studies of the catalytic reactions in TAE buffer under different conditions: black line, 0.5 µM S; red line, 0.5 µM S + 0.05 µM T-SH; blue line, 0.5 µM S + 0.6 µM F; pink line, 0.5 µM S + 0.6 µM F + 0.05 µM T-SH. (B) FL response of the complex S to different concentrations of T-SH (black line, control; red line, 0.01 µM T-SH; blue line, 0.05 µM T-SH; pink line, 0.1 µM T-SH; green line, 0.5 µM T-SH). Then, we investigated the regulation of catalytic activity of the entropy-driven system by changing the temperature. Figure 7 described the ideal catalytic regulation process. At temperature below LCST (≈ 36 °C), pNIPAM exhibited a swollen hydrated state and shielded the catalyst T-SH on AuNPs, leading to low, even none catalytic signal, which can be called ‘catalysis off’. When rising the temperature higher than LCST, pNIPAM transformed to a shrunken dehydrated state and showed no obvious effect on the catalytic activity of T-SH, and this state can be called ‘catalysis on’.

Figure 7. Scheme of regulation of catalytic activity of T-SH/pNIPAM/AuNP system by temperature. First, the FL intensities of S1 and complex S in the regulation system at different temperatures (33 °C, below LCST, and 38 °C, above LCST, respectively) were investigated, the results showed that the FL intensities of these fluorophores at different catalytic temperature were almost unchanged (Figure S5). Control experiments also showed that free pNIPAM can hardly affect the catalytic system (Figure

S6).

Then,

the

catalytic

activities

of

14


T-SH,

T-SH/AuNP

and

Page 15 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

T-SH/pNIPAM/AuNP were detected at 33 °C and 38 °C, respectively. As shown in Figure 8A, when the temperature varied from 33 °C to 38 °C, the ratio value of FL intensity at 38 °C/at 33 °C of the T-SH and T-SH/AuNP systems were almost near to the value of 1, indicated that the catalytic activities of T-SH and T-SH/AuNP were almost unaffected by temperature within this temperature variation range. Interestingly, the catalytic activities of T-SH/pNIPAM/AuNP (T-SH/pNIPAM = 1:3) at 33 °C and 38 °C differed greatly: the ratio value of FL intensity at 38 °C/at 33 °C was ca 3.0, implying three times of catalytic activity increase. Gel electrophoresis results also confirmed that, at 38 °C, a clear band corresponding to the S1 product appeared (Figure S7). These results proved that the introduction of pNIPAM onto T-SH/AuNP render the T-SH/pNIPAM/AuNP system controllable catalytically activities. To achieve the best catalytic regulation performance, the molar ratio of T-SH/pNIPAM on AuNPs was investigated (Figure 8B). The effect of the T-SH/pNIPAM molar ratio on catalytic activity regulation was studied at 33 °C and 38 °C, the results demonstrated that with the increase of T-SH/pNIPAM molar ratio (1:1, 1:3, 1:5, 1:9), the regulation effect was enhanced. When the molar ratio of T-SH/pNIPAM was 1:9, the ratio value of FL signal at 38 °C/FL signal at 33 °C reached the value of ca 7.6, implying a more than 7 times of relative catalytic activity regulation. These results indicated that this strategy could realize the regulation of catalytic activity of T-SH/pNIPAM/AuNP switched between ‘on’ and ‘off’ states.

15


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 32

Figure 8. (A) The catalytic performance representing by the ratio of FL intensity at 38 °C/FL intensity at 33 °C of the catalytic systems, including T-SH, T-SH/AuNP and T-SH/pNIPAM/AuNP on complex S, respectively; (B) The catalytic performance of the T-SH/pNIPAM/AuNP system on complex S representing by the resulting FL intensity at 38 °C/FL intensity at 33 °C of the catalytic system with different molar ratios T-SH/pNIPAM. To validate the generality of this strategy to build controllable catalytic gold nanoparticles, pNIPAM and a Mg2+-dependent nicking DNAzyme (DNA1) which can catalyze the splitting of a RNA base containing substrate DNA2 with the assist of Mg2+ were conjugated to the surface of AuNPs. The fluorophore, ROX, a fluorescent dye in the substrate DNA2 was used to indicate the catalytic process. When adding DNA1/AuNP to the DNA2 buffer solution, the DNA2 was cleaved into two fragments and the FL signal recovered quickly (Figure S8), indicated that the DNA1/AuNP has highly catalytic activity. Control experiments showed that the FL intensities of the fluorophores at the temperature range were almost unchanged, and free pNIPAM almost cannot affect the catalytic system (Figure S9, S10). The catalytic regulation of DNA1/pNIPAM/AuNP was investigated, the regulation process was described in Figure

9A

and

the

catalytic

results

of

DNA1,

DNA1/AuNP

and

DNA1/pNIPAM/AuNP (DNA1/pNIPAM = 1:5) on DNA2 at 25 °C and 30 °C were shown in Figure 9B. When the temperature rose from 25 °C to 30 °C, the catalytic activities of DNA1 and DNA1/AuNP represented by the ratio value of resulting FL signal of the respective catalytic systems at 30 °C/resulting FL signal at 25 °C were decreased to ca 0.9, however, the catalytic activity of DNA1/pNIPAM/AuNP increased

significantly

to

ca

2.3.

These

results

confirmed

that

the

temperature-regulated catalytic activity control in the designed DNAzyme system was achieved. The effect of DNA1/pNIPAM molar ratio on regulation effects was further studied, Figure 9C showed that with the increase of pNIPAM, the ability of regulation enhanced. When the molar ratio was 1:9, the catalytic activity at 30 °C exceeded 3.6 times the catalytic activity at 25 °C. All the results implied that the proposed strategy of regulating DNA catalytic activities by temperature was simple and highly effective.

16


Page 17 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Figure 9. (A) Schematic diagram of temperature regulated catalytic activity of DNA1/pNIPAM/AuNP system; (B) The catalytic performance representing by the FL intensity at 30 °C/the FL intensity at 25 °C of the catalytic systems, including DNA1, DNA1/AuNP and DNA1/pNIPAM/AuNP on DNA2, respectively; (C) The catalytic performance of the DNA1/pNIPAM/AuNP system on DNA2 representing by the resulting FL intensity at 30 °C/FL intensity at 25 °C under the conditions of different molar ratios of DNA1/pNIPAM. SUMMARY AND CONCLUSIONS In this work, we have constructed smart catalytic DNA/pNIPAM functionalized gold nanoparticles, which was thermo-responsive to achieve the regulation of the catalytic activities of DNA. Two DNA catalytic systems, entropy-driven catalytic system and Mg2+-DNAzyme system, were chosen as model systems to investigate the thermo-regulation of DNA/pNIPAM/AuNP system. Results showed that the catalytic activities of these two catalytic DNA in the DNA/pNIPAM/AuNP system were highly affected by the temperature. The designed systems realized the regulation of catalytic activities of DNA by changing the temperature. This method could be further applied to regulate the properties of other biological macromolecules, and will help the development of catalytic DNA based controllable biosensing, biocatalysis, gene therapy and nanostructure assembly.

17


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ASSOCIATED CONTENT Supporting information The supporting information is available free of charge on the ACS Publications website. 1

H NMR spectra of pNIPAM-RAFT and pNIPAM-SH; The sizes and UV-vis spectra of the

complex of T-SH/pNIPAM/AuNP + com-T-SH/pNIPAM/AuNP at different temperatures; PAGE results of the entropy-driven system; FL spectra of 0.5 µM complex S incubated with different solutions; FL spectra of S1, complex S and DNA 2 after incubated at different temperature; Fluorescence results of T-SH/AuNP system and DNA 1/AuNP system in the presence/absence of free pNIPAM; PAGE results of catalysis of T-SH/pNIPAM/AuNP system at different temperature; FL spectra of 2 µM DNA2 incubated with different solutions (PDF)

AUTHOR INFORMATION Corresponding Author *Phone: +86-022-83662760; E-mail: [email protected] ORCID Weiwei Guo: 0000-0002-1472-6633 Notes The authors declare no competing financial interest. ACKNOWLEDGMENTS The authors acknowledge financial support from the National Natural Science Foundation of China (No. 21505078) and the Fundamental Research Funds for Central Universities (China). REFERENCES (1) Li, X.; Liu, J.; Zhang, S. Electrochemical analysis of two analytes based on a dual-functional aptamer DNA sequence. Chem. Commun. 2010, 46, 595-597. (2) Zeraati, M.; Langley, D. B.; Schofied, P.; Moye, A. L.; Rouet, R.; Hughes, W. E.; Bryan, T. M.; Dinger, M. E.; Christ, D. I-motif DNA structures are formed in the nuclei of human cells. Nat. Chem. 2018, 10, 631-637. (3) Wang, F.; Liu, X.; Willner, I. DNA switches: from principles to applications.

Angew. Chem. Int. Ed. 2015, 54, 1098-1129. 18


Page 18 of 32

Page 19 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

(4) Lu, C.; Willner, I. Stimuli-responsive DNA-functionalized nano-/microcontainers for switchable and controlled release. Angew. Chem. Int. Ed. 2015, 54, 12212-12235. (5) Wang, L.; Ren, M.; Liang, L.; Zhang, C. Controllable fabrication of bio-bar codes for dendritically amplified sensing of human T-lymphotropic viruses. Chem. Sci. 2018, 9, 4942-4949. (6) Amodio, A.; Zhao, B.; Porchetta, A.; Idili, A.; Castronovo, M.; Fan, C.; Ricci, F. Rational design of pH-controlled DNA strand displacement. J. Am. Chem. Soc. 2014, 136, 16469-16472. (7) Lu, C.; Willner, B.; Willner, I. DNA nanotechnology: from sensing and DNA machines to drug-delivery systems. ACS Nano 2013, 7, 8320-8332. (8) Yao, D.; Song, T.; Sun, X.; Xiao, S.; Huang, F.; Liang, H. Integrating DNA-strand-displacement circuitry with self-assembly of spherical nucleic acids.

J. Am. Chem. Soc. 2015, 137, 14107-14113. (9) Sarah, R.; Liu, J. A silver DNAzyme. Anal. Chem. 2016, 88, 4014-4020. (10) Gu, H.; Furukawa, K.; Weinberg, Z.; Berenson, D. F.; Breaker, R. R. Small, highly active DNAs that hydrolyze DNA. J. Am. Chem. Soc. 2013, 135, 9121-9129. (11) Cuenoud, B.; Szostak, J. W.; A DNA metalloenzyme with DNA ligase activity.

Nature, 1995, 375, 611-614. (12) Li, T.; Wang, E.; Dong, S. Potassium-lead-switched G-quadruplexes: a new class of DNA logic gates. J. Am. Chem. Soc. 2009, 131, 15082-15083. (13) Zhang, D. Y.; Turberfield, A. J.; Yurke, B.; Winfree, E. Engineering entropy-driven reactions and networks catalyzed by DNA. Science, 2007, 318, 1121-1125. (14) Zhou, Y.; Tang, L.; Zeng, G.; Zhang, C.; Zhang, Y.; Xie, X. Current progress in biosensors for heavy metal ions based on DNAzymes/DNA molecules functionalized nanostructures: a review. Sens. Actuators, B 2016, 223, 280-294. (15) Lv, Y.; Cui, L.; Peng, R.; Zhao, Z.; Qiu, L.; Chen, H.; Cheng, J.; Zhang, X.; Tan, W. Entropy beacon: A hairpin-free DNA amplification strategy for efficient 19


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

detection of nucleic acids. Anal. Chem. 2015, 87, 11714-11720. (16) Li, F.; Wang, C.; Guo, W. Multifunctional poly-N-isopropylacrylamide/ DNAzyme microgels as highly efficient and recyclable catalysts for biosensing.

Adv. Funct. Mater. 2018, 28, 1705876. (17) Liang, C.; Ma, P.; Liu, H.; Guo, X.; Yin, B.; Ye, B. Rational engineering of a dynamic, entropy-driven DNA nanomachine for intracellular microRNA imaging.

Angew. Chem. Int. Ed. 2017, 56, 9077-9081. (18) Wang, F.; Elbaz, J.; Orbach, R.; Magen, N.; Willner, I. Amplified analysis of DNA by the autonomous assembly of polymers consisting of DNAzyme wires. J.

Am. Chem. Soc. 2011, 133, 17149-17151. (19) He, Z.; Zhang, P.; Li, X.; Zhang, J.; Zhu, J. A targeted DNAzyme nanocomposite probe equipped with built-in Zn2+ arsenal for combined treatment of gene regulation and drug delivery. Sci. Rep. 2016, 6, 22737. (20) Wang, J.; Qin, H.; Wang, F.; Ren, J.; Qu, X. Metal-ion-activated DNAzymes used for regulation of telomerase activity in living cells. Chem. Eur. J. 2017, 23, 11226-11229. (21) Silverman, S. K. Catalytic DNA: scope, applications, and biochemistry of deoxyribozymes. Trends Biochem. Sci. 2016, 41, 595-609. (22) Achenbach, J. C.; Chiuman, W.; Cruz, R. P. G.; Li, Y. DNAzymes: from creation

In Vitro to application In Vivo. Curr. Pharm. Biotechnol. 2004, 5, 321-336. (23) Centola, M.; Valero, J.; Famulok, M. Allosteric control of oxidative catalysis by a DNA rotaxane nanostructure. J. Am. Chem. Soc. 2017, 139, 16044-16047. (24) Mao, X.; Simon, A. J.; Pei, H.; Shi, J.; Li, J.; Huang, Q.; Plaxcob, K. W.; Fan, C. Activity modulation and allosteric control of a scaffolded DNAzyme using a dynamic DNA nanostructure. Chem. Sci. 2016, 7, 1200-1204. (25) Wang, S.; Yue, L.; Shpilt, Z.; Cecconello, A.; Kahn, J. S.; Lehn, J. M.; Willner, I. Controlling the catalytic functions of DNAzymes within constitutional dynamic networks of DNA nanostructures. J. Am. Chem. Soc. 2017, 139, 9662-9671. (26) Hirokawa, Y.; Tanaka, T. Volume phase transition in a nonionic gel. J. Chem.

Phys. 1984, 81, 6379-6380. 20


Page 20 of 32

Page 21 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

(27) Pelton, R.; Richardson, R. Cosgrove, T.; Lvkov, R. The effects of temperature and methanol concentration on the properties of poly(N-isopropylacrylamide) at the air/solution interface. Langmuir 2001, 17, 5118-5120. (28) Honold, T.; Skrybeck, D.; Wagner, K. G.; Karg, M. Fully reversible quantitative phase transfer of gold nanoparticles using bifunctional PNIPAM ligands.

Langmuir 2017, 33, 253-261. (29) Halperin, A.; Kröger, M.; Winnik, F. M. Poly(N-isopropylacrylamide) phase diagrams: fifty years of research. Angew. Chem. Int. Ed. 2015, 54, 15342-15367. (30) Ding, T.; Valev, V. K.; Salmon, A.R.; Forman, C. J.; Smoukov, S. K.; Scherman, D. A.; Frenkel, D.; Baumberg, J. J. Light-induced actuating nanotransducers.

PNAS 2016, 113, 5503-5507. (31) Gan, T.; Guan, Y.; Zhang, Y. Thermogelable PNIPAM microgel dispersion as 3D cell scaffold: effect of syneresis. J. Mater. Chem. 2010, 20, 5937-5944. (32) Islam, M. R.; Serpe, M. J. Polymer-based devices for the label-free detection of DNA in solution: low DNA concentrations yield large signals. Anal. Bioanal.

Chem. 2014, 406, 4777-4783. (33) Kumar, A.; Kamihira, M.; Galaev, I. Y.; Mattiasson, B.; Lijima, S. Type-specific separation of animal cells in aqueous two-phase systems using antibody conjugates with temperature-sensitive polymers. Biotechnol. Bioeng. 2001, 75, 570-580. (34) Yang, X.; Luo, Y.; Xu, F.; Chen, Y. Thermosensitive mPEG-b-PA-g-pNIPAM comb block copolymer micelles: effect of hydrophilic chain length and camptothecin release behavior. Pharm. Res. 2014, 31, 291-304. (35) Zhu, M. Q.; Wang, L. Q.; Exarhos, G. J.; Li, A. D. Q. Thermosensitive gold nanoparticles. J. Am. Chem. Soc. 2004, 126, 2656-2657. (36) Han, F.; Soeriyadi, A. H.; Vivekchand, S. R. C. Simple method for tuning the optical properties of thermoresponsive plasmonic nanogels. ACS Macro Lett. 2016, 5, 626-630. (37) Jones, S. T.; Walsh-Korb, Z.; Barrow, S. J.; Henderson, S. L.; Barrio, J. D. The importance of excess poly(N-isopropylacrylamide) for the aggregation of 21


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 32

poly(N-isopropylacrylamide)-coated gold nanoparticles. ACS Nano 2016, 10, 3158-3165. (38) Liu, F.; Cui, Y.; Wang, L.; Wang, H.; Yuan, Y.; Pan, J.; Chen, H.; Yuan, L. Temperature-responsive

poly(N-isopropylacrylamide)

modified

gold

nanoparticle- protein conjugates for bioactivity modulation. ACS Appl. Mater.

Interfaces 2015, 7, 11547-11554. (39) Liu, F.; Xue, L.; Yuan, Y.; Pan, J.; Zhang, C.; Wang, H.; Brash, J. L.; Yuan, L.; Chen, H. Multifunctional nanoparticle-protein conjugates with controllable bioactivity and pH responsiveness. Nanoscale 2016, 8, 4387-4394. (40) Breaker, R. R.; Joyce, G. F. A DNA enzyme with Mg2+-dependent RNA phosphoesterase activity. Chem. Biol. 1995, 2, 655-660. (41) Zhang, D. Y.; Turberfield, A. J.; Yurke, B.; Winfree, E. Engineering entropy-driven reactions and networks catalyzed by DNA. Science 2007, 318, 1121-1125. (42) Liu, J. Adsorption of DNA onto gold nanoparticles and graphene oxide: surface science and applications. Phys. Chem. Chem. Phys. 2012, 14, 10485-10496. (43) He, X.; Zeng, T.; Li, Z.; Wang, G.; Ma, N. Catalytic molecular imaging of microRNA in living cells by DNA-programmed nanoparticle disassembly. Angew.

Chem. Int. Ed. 2016, 55, 3073-3076. (44) Wong, C. K.; Laos, A. J.; Soeriyadi, A. H.; Wiedenmann, J.; Curmi, P. M. Polymersomes prepared from thermoresponsive fluorescent protein-polymer bioconjugates: capture of and report on drug and protein payloads. Angew. Chem.

Int. Ed. 2015, 127, 5407-5412. (45) Zhang, K.; Zhu, X.; Jia, F.; Auyeung, E.; Mirkin, C. A. Temperature-activated nucleic acid nanostructures. J. Am. Chem. Soc. 2013, 135, 14102-14105. (46) Mori, T.; Umeno, D.; Maeda, M. Sequence-specific affinity precipitation of oligonucleotide using poly(N-isopropylacrylamide)-oligonucleotide conjugate.

Biotechnol. Bioeng. 2015, 72, 261-268.

22


Page 23 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

TOC Graphic

23


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 1. Synthesis route of pNIPAM-SH. 61x24mm (300 x 300 DPI)


Page 24 of 32

Page 25 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Figure 2. Thermal responsive property of pNIPAM-SH. (A) Hydrodynamic diameter (Dh) of pNIPAM-SH as a function of temperature. (B) Transmittance of pNIPAM-SH as a function of temperature (black line, TAE buffer containing 12.5 mM Mg(Ac)2; red line, HEPES buffer containing 500 mM NaCl, 20 mM MgCl2). 113x41mm (300 x 300 DPI)


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 3. (A) Particle size distribution from DLS of AuNPs (black line), T-SH/AuNP (red line), pNIPAM/AuNP (pink line, 25 °C; blue line, 45 °C) and T-SH/pNIPAM/AuNP (green line, 25 °C; navy blue line, 45 °C). (B) UV-vis absorption spectra of AuNPs (black line), T-SH/AuNP (pink line) and T-SH/pNIPAM/AuNP (blue line). (C, D) TEM images of AuNPs and T-SH/pNIPAM/AuNP. 210x143mm (300 x 300 DPI)


Page 26 of 32

Page 27 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Figure 4. UV-vis absorption spectra of T-SH/pNIPAM/AuNP between 25 °C (T ˂ LCST, black line) and 45 °C (T ˃ LCST, red line), inset: shifts of maximum absorption wavelength between 25 °C and 45 °C. 111x82mm (300 x 300 DPI)


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Schematic diagram of the entropy-driven catalytic system. 101x68mm (300 x 300 DPI)


Page 28 of 32

Page 29 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Figure 6. (A) FL kinetics studies of the catalytic reactions in TAE buffer under different conditions: black line, 0.5 µM S; red line, 0.5 µM S + 0.05 µM T-SH; blue line, 0.5 µM S + 0.6 µM F; pink line, 0.5 µM S + 0.6 µM F + 0.05 µM T-SH. (B) FL response of the complex S to different concentrations of T-SH (black line, control; red line, 0.01 µM T-SH; blue line, 0.05 µM T-SH; pink line, 0.1 µM T-SH; green line, 0.5 µM T-SH). 55x20mm (300 x 300 DPI)


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 7. Scheme of regulation of catalytic activity of T-SH/pNIPAM/AuNP system by temperature. 123x102mm (300 x 300 DPI)


Page 30 of 32

Page 31 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Figure 8. (A) The catalytic performance representing by the ratio of FL intensity at 38 °C/FL intensity at 33 °C of the catalytic systems, including T-SH, T-SH/AuNP and T-SH/pNIPAM/AuNP on complex S, respectively; (B) The catalytic performance of the T-SH/pNIPAM/AuNP system on complex S representing by the resulting FL intensity at 38 °C/FL intensity at 33 °C of the catalytic system with different molar ratios T-SH/pNIPAM. 114x44mm (300 x 300 DPI)


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 9. (A) Schematic diagram of temperature regulated catalytic activity of DNA1/pNIPAM/AuNP system; (B) The catalytic performance representing by the FL intensity at 30 °C/the FL intensity at 25 °C of the catalytic systems, including DNA1, DNA1/AuNP and DNA1/pNIPAM/AuNP on DNA2, respectively; (C) The catalytic performance of the DNA1/pNIPAM/AuNP system on DNA2 representing by the resulting FL intensity at 30 °C/FL intensity at 25 °C under the conditions of different molar ratios of DNA1/pNIPAM. 178x105mm (300 x 300 DPI)


Page 32 of 32

Regulation of Catalytic DNA Activities with Thermosensitive Gold

Recommend Documents