Regulation of Expression of N-Methylpurine DNA Glycosylase in

1098

Chem. Res. Toxicol. 1999, 12, 1098-1109

Regulation of Expression of N-Methylpurine DNA Glycosylase in Human Mammary Epithelial Cells: Role of Transcription Factor AP-2 Sonia R. Cerda, Samuel S. Chu, Pablo Garcia, Jean Chung, Jordan D. Grumet, Bayar Thimmapaya, and Sigmund A. Weitzman* Division of Hematology/Oncology, Department of Medicine, and Department of Micro/Immunology, Lurie Cancer Center, Northwestern University Medical School, Chicago, Illinois 60611 Received June 9, 1999

The DNA repair enzyme, N-methylpurine DNA glyclosylase (MPG), is overexpressed in breast cancer as compared with its expression in normal breast epithelial cells. In an effort to determine the mechanism responsible for this difference in expression, we studied rates and regulation of transcription of the MPG gene in normal (HMEC), spontaneously immortalized (MCF10A), and malignant (T47D) mammary epithelial cells. Steady state levels of MPG mRNA are 3-4-fold greater in T47D cells than in MCF10A cells. Nuclear “run-off” transcription measurements revealed MPG transcription rates to be approximately 3-fold greater in the tumor cells than in normal cells. Characterization of the MPG promoter by deletion analysis and transient transfection experiments revealed that all basal promoter activity resided between nucleotides -227 and -81 upstream from the ATG translation start site. Constructs containing this region were expressed at 4-fold greater levels when transfected into malignant T47D cells (56 × baseline) than in MCF10A cells (14 × baseline). Computer database analysis of the region of nucleotides -227 to -81 revealed multiple overlapping Sp1 consensus binding sites and two overlapping consensus AP-2 binding sites located between bases -181 and -169. Electrophoretic mobility shift assays indicated that while Sp1 bound this region of the promoter, nuclear extracts from both cell types contained equal Sp1 binding activity. In contrast, AP-2 binding activity was significantly greater in T47D cells, and Western blots confirmed increased AP-2 protein levels in these cells. Cotransfection into MCF10A cells of the MPG promoter construct and an AP-2 expression plasmid increased MPG promoter activity 2.1-fold. Cotransfection of a dominant negative mutant of AP-2 into T47D cells reduced the extent of MPG promoter-driven transcription by 50%. To investigate the functional significance of the two overlapping AP-2 consensus binding sites, each site was mutated separately. Mutation of the upstream site decreased promoter activity by 15%, but mutation of the downstream site decreased promoter activity by 45% and abolished AP-2 binding to the promoter sequence. These data suggest that AP-2 is important in regulating MPG expression in breast cancer cells, and that the increased amount of AP-2 in these cells plays a major role in directing the increased expression of MPG.

Introduction The mammalian genome is continually exposed to the action of endogenous and environmental DNA-damaging agents that can lead to mutation, chromosome damage, and cell death, contributing to carcinogenesis and aging (1). Cells respond to DNA damage with a number of cellular responses, such as cell cycle arrest, DNA repair, and/or apoptosis if damage to the DNA is too extensive. N-Alkylpurines are among the most prevalent DNA base adducts formed by environmental alkylating agents (2). These N-alkylpurines (7-methylguanine, 3-methyladenine, and 3-methylguanine) are removed by ubiquitous base excision repair processes that involve the action of various enzymes (2, 3). The first step in the N-alkylpurine repair process is catalyzed by N-methylpurine DNA * To whom correspondence should be addressed: Division of Hematology/Oncology, Department of Medicine, Northwestern University Medical School, 710 N. Fairbanks Court, Room 8524, Chicago, IL 60611. Phone: (312) 908-5284. Fax: (312) 908-5717. E-mail: [email protected].

glycosylase (MPG),1 which is responsible for the glycolytic removal of the damaged base, leading to the formation of apurinic (AP) sites that are subsequently removed by base excision repair (2, 3). If left unrepaired, these AP sites can block replication and lead to mutation (4). In addition to N-alkylpurine repair, this enzyme can repair the endogenously formed mutagenic lesions hypoxanthine (5) and 8-oxoguanine (6), and can remove cyclic etheno adducts (7, 8). Cytotoxicity of N-alkylpurines in the mammalian genome has been associated with the formation of 3-meAde bases which can block DNA replication (9-11). In fact, the enzyme is also called alkyl adenine glycosylase (AAG) (11). Furthermore, N-methylpurines in general, and more specifically 7-methylguanine, have been implicated in the aging process (12, 13). 1 Abbreviations: MPG, N-methylpurine DNA glycosylase; HMEC, human mammary epithelial cells; AP, apurinic sites; MPG-P, Nmethylpurine DNA glycosylase promoter; Luc, luciferase; SDS PAGE, sodium dodecyl sulfate-polyacrylamide electrophoresis; EMSA, electrophoretic mobility shift assay.

10.1021/tx9901027 CCC: $18.00 © 1999 American Chemical Society Published on Web 10/26/1999

Regulation of MPG Expression

Ethenoadenine, a mutagenic cyclic adduct generated from products of lipid peroxidation, is reported to be a much better substrate for MPG than the N-methylpurines for which the enzyme was named (7). The gene encoding the human N-methylpurine DNA glycosylase has been cloned (14-17) and characterized biochemically (14, 18-20) by several groups. It is expressed constitutively in all tissues (21, 22). While the level of expression of this enzyme in mammalian cells may be tissue specific (21), it is generally very low in rodent cells, which express from 6 to 30 MPG mRNA molecules per cell (23). Studies on the inducibility of this gene by DNA-damaging agents have shown either no response or a weak induction of MPG mRNA 24 and 48 h after mutagen exposure (21, 24, 25). It appears that during the multistep repair of N-alkylpurines, MPG activity may not be rate-limiting, and cells may contain this protein in excess (24). The rat MPG promoter was also not found to be significantly induced by DNA methylating agents and ionizing radiation (26). However, activity of this promoter was stimulated by UV light and the tumor promoter 12-O-tetradecanoylphorbol 13-acetate (26). More recent investigations were aimed toward determining if overexpression of MPG could give rise to an increased level of resistance to methylating agents. In these studies, the level of expression of this enzyme did not correlate with an increased level of protection against the cytotoxic and mutagenic effects of alkylating agents (22, 27-31). In fact, cells overexpressing MPG exhibited increased sensitivity to chromosomal damage and gene mutations, possibly due to an imbalance in the multistep process of DNA repair (28, 32). Engelward et al. (33) created MPG null mouse embryonic stem cells to determine the in vivo role of this enzyme. These cells were found to be more sensitive to chromosome damage and cell killing induced by methylating agents, suggesting its role in preventing alkylation-induced chromosome damage and cytotoxicity. Although MPG may have the capacity to repair such mutagenic lesions as 8-oxoguanine and hypoxanthine, thus protecting from spontaneous mutation, it has recently been demonstrated that it is not the major glycosylase for 8-oxoguanine repair in MPG deficient mice (34). It has been suggested that perhaps the balance between glycosylase activity and subsequent excision repair processes might determine cellular cytotoxicity and the level of resistance to alkylating and endogenous oxidative agents, pointing out the need for further studies of downstream repair pathways. If it is assumed that glycosylase-initiated repair depends on downstream repair pathways involving AP endonucleases, then MPG overexpression, leading to an increase in the number of AP sites not compensated by downstream repair pathways, might contribute to carcinogenesis (32). High levels of MPG have been reported in some tumors, such as HT-29 cells derived from a colon adenocarcinoma, when compared to those in other human transformed cell lines (17). Conversely, other studies found increased levels of expression of this gene in normal rat hepatocytes as compared to that in rat malignant hepatoma cell lines (26). In these studies, it was suggested that the level of expression of MPG may be dictated by various types and levels of carcinogen exposure in different tissues. Considering the proposed role of oxygen radical injury in mutagenesis and carcinogenesis (reviewed in ref 35), our group investigated expression of this enzyme in human breast cancer (36).

Chem. Res. Toxicol., Vol. 12, No. 11, 1999 1099

Levels of MPG were found consistently to be increased in breast cancer cell lines and tissues as compared to the levels in normal primary breast epithelium. To understand the molecular mechanism(s) involved in the altered expression of MPG in breast cancer, we studied transcription rates and the regulation of expression of this gene in different types of human mammary epithelial cells. These studies are described below.

Experimental Procedures Reagents. Tissue and bacterial culture reagents were obtained from VWR (McGaw Park, IL), and supplements were from GIBCO-Life Technologies (Gaithersburg, MD), Sigma (St. Louis, MO), or Collaborative Research Inc. (Bedford, MA). Blottpresenting membranes used for run-off transcription assays and reagents used for labeling of probes were from Amersham (Arlington Heights, IL). Immunoblotting and gel electrophoresis reagents were from Bio-Rad Laboratories (Hercules, CA). Human recombinant Sp1 protein and the gel-shift assay kit, containing double-stranded oligodeoxynucleotides corresponding to the Sp1 and AP-2 consensus binding sequences, were purchased from Stratagene (La Jolla, CA). Double-stranded Sp1 and AP-2 oligonucleotide sequences were as follows: Sp1, 5′GATCGATCGGGGCGGGGCGATC and its complementary strand 3′-CTAGCTAGCCCCGCCCCGCTAG; and AP-2, 5′GATCGAACTGACCGCCCGCGGCCCGT and its complementary strand 3′-CTAGCTTGACTGGCGGGCGCCGGGCA. Bacterially expressed human AP-2 cell extract (1.3 mg/mL), containing 1 footprinting unit per microliter, was purchased from Promega (Madison, WI). Rabbit polyclonal antibodies to AP2-R and Sp1 proteins used for Western blotting and supershift assays were from Santa Cruz Biotechnology (Santa Cruz, CA). Single-stranded oligomers and their complementary strands used for gel-shift assays were purchased from GibcoBRL. Synthesized oligonucleotides are shown with the mutations underlined. These included the 35 bp oligonucleotides WT I (5′CCTCCACGTGGCCCGCCCCGCCCCGGGGGCGCAGC and its complementary strand 5′-CTGCGCCCCCGGGGCGGGGCGGGCCACGTGGAGGC), Mut 1 (5′-CCTCCACGTATACCGCCCCGCCCCGGGGGCGCAGC and its complementary strand 5′-CTGCGCCCCCGGGGCGGGGCGGTATACGTGGAGGC), and Mut 2 (5′-CCTCCACGTGGCCCGCCCCCTACCGGGGGCGCAGC and itscomplementarystrand5′-CTGCGCCCCCGGTAGGGGGCGGGCCACGTGGAGGC), the 46 bp oligonucleotide WT II (5′-CAGCCAGTTCCCGGCGCTCACTGCCCCCCTTCTCCCGGCTTCCGTC and its complementary strand 5′-ACGGAAGCCGGGAGAAGGGGGGCAGTGAGCGCCGGGAACTGGCTGC), and the 46 bp oligonucleotide WT III (5′-TCCCCTTCTGCGCAGGCGCCGCTCCGCCCCGGTCCTAGGGGTGCTT and its complementary strand 5′-AAGCACCCCTAGGACCGGGGCGGAGCGGCCTGCGCAGAAGGGGAC). Because the transcriptional start site of the human MPG gene is unknown to date, we have designated the first base of the ATG translation start site in exon 1 as +1 for mapping purposes. Therefore, DNA sequences of oligonucleotides correspond to regions located from base pair -190 to -156 for WT I, from base pair -159 to -114 for WT II, and from base pair -115 to -70 for WT III from the ATG start site on exon 1. Luciferase reporter plasmids and reagents used for transfection experiments were obtained from Promega. A Stratagene sitedirected mutagenesis kit was used for construction of AP-2 consensus site mutants. Mutants were sequenced to confirm their identity using an automated Perkin-Elmer model 480 sequencer. All other general reagents used in this study were from Sigma unless otherwise specified. The human cloned cDNA encoding MPG (15), kindly provided by S. Mitra (University of Texas Medical Branch, Galveston, TX), was used as a probe for run-off transcription assays. The LacZ expression vector was provided by L. Anderson (Northwestern University Cancer Center). A plasmid expressing wild-type AP-2, designated pSG5AP-2 (37, 38), and a plasmid expressing a dominant negative form of AP-2, designated pSG5-AP-2B (38, 39), were kindly

1100

Chem. Res. Toxicol., Vol. 12, No. 11, 1999

provided by M. A. Tainsky (The University of Texas M. D. Anderson Cancer Center, Houston, TX) and C. Duan (The University of Michigan, Ann Arbor, MI) (40). Cell Culture. Human mammary epithelial cells derived from surgical specimens were culled and grown as described previously (41). Human breast lines were obtained from the American Tissue Culture Collection (Rockville, MD). MCF10A cells were maintained in a 1:1 mix of Ham’s F12 and DME supplemented with 5% heat-inactivated equine serum, 500 ng/mL hydrocortisone, 20 ng/mL EGF, 100 ng/mL cholera toxin, and 0.01 mg/ mL insulin. T47D cells were cultured in RPMI medium 1640 supplemented with 0.292 mg/mL glutamine and 10% heatinactivated fetal bovine serum (FBS). Cells were passaged at near-confluence with trypsin/EDTA. In Vitro Run-Off Transcription Assays. Nuclei were prepared from subconfluent cells lysed in lysis buffer consisting of 0.3 M sucrose, 10 mM Tris (pH 7.4), 5 mM MgCl2, 0.4% NP40, and 0.5 mM DTT in chilled Corex tubes and spun at 600g at 4 °C in a clinical centrifuge. The pellet was resuspended in 100 µL of storage buffer [40% glycerol, 50 mM Tris (pH 8.0), 5 mM MgCl2, and 0.1 mM EDTA]. Nuclear preparations were incubated at room temperature for 30 min with reaction cocktail consisting of reaction mix [25 mM HEPES (pH 7.4), 2.5 mM dithiothreitol (DTT), 75 mM KCl, and 5% glycerol], triphosphate mix (0.35 mM ATP, GTP, and CTP and 0.4 µM UTP), and 25 µCi of [R-32P]UTP (Amersham). The reaction was stopped by addition of DNase I (1.0 mg/mL) and incubation at room temperature for 30 min before addition of stop buffer [2% sodium dodecyl sulfate (SDS), 7 M urea, 0.35 M LiCl, 1 mM EDTA, and 10 mM Tris (pH 8)]. Protein products were degraded by incubation for 3 h at 50 °C with the addition of 1 mg/mL proteinase K (Sigma). After incubation for 30 min on ice, RNA was pelleted by centrifugation, washed with 100% ethanol, and resuspended in 100 µL of TE (10 mM Tris and 1 mM EDTA) containing 0.5% SDS. Dot blot strips were prepared with HYBRIODOT Manifold (Life Technologies) using 0.45 µm nitrocellulose (Amersham). An MPG cDNA clone (15) was subsequently subcloned into the pGEX-3X vector (Pharmacia), and used for dot blotting. A plasmid containing a clone of the human β actin gene (pHFBA) was provided by S. Cohn (Northwestern University, Evanston, IL). The pGEX-3X vector was used as the negative control DNA. DNA was denatured with 10 N NaOH and neutralized with 2 M ammonium acetate, and 2 µg of plasmid DNA was blotted onto the membrane. Total counts were measured for labeled nuclear RNA by precipitation of 2 µL samples with cold trichloroacetic acid (TCA) and collection onto 2.5 cm glass fiber filters (Schleicher & Schuell), followed by measurement of precipitable counts by scintillation counting. Equal amounts of total counts were added to separate vials containing dot blot strips and hybridization buffer [50% formamide, 6× SSC (1× SSC being 0.15 M NaCl and 15 mM sodium citrate), 10× Denhardt’s Solution, and 0.2% SDS], and allowed to hybridize to filter-bound DNA at 42 °C for at least 72 h. Hybridized dot blot strips were washed at 65 °C once in 6× SSC and 0.2% SDS, twice in 2× SSC and 0.2% SDS, and finally once in 0.2× SSC and 0.2% SDS. Washed strips were exposed to Hyperfilm-MP (Amersham) or Phosphor Screen from Molecular Dynamics (Sunnyvale, CA). Signals were quantified by densitometry or phosphoimage analysis (Molecular Dynamics). Construction of MPG Promoter Luciferase Constructs. A cosmid genomic clone containing the MPG gene, designated CRA36 (42), was provided by D. Higgs (University of Oxford, Oxford, U.K.). Sequence analysis was performed using GCG software on the deposited sequence in the GenBank database (accession number L10752). Exon regions were identified using MAPSORT, and restriction sites were identified using MAP functions. CRA36 was amplified by transformation into XL1Blue MR supercompetent cells (Stratagene) and prepared using the Plasmid Mega Prep Kit from Qiagen (Valencia, CA). This cosmid was subsequently digested with XhoI, and the restriction digest was subjected to electrophoresis in 0.75% agarose to

Cerda et al. isolate the 711 and 1383 bp XhoI fragments. Fragments were purified with the QUIAquick Gel Extraction Kit (Qiagen), and subcloned into pGL2 Basic vector (Promega) that had been digested with XhoI and treated with alkaline phosphatase, per standard cloning procedures (43). A diagram of the MPG promoter region construct is shown in Figure 1. Upon identification of clones by restriction analysis, subsequent subcloning led to the construction of the deletion reporter constructs depicted in Figure 1, which were used for analysis of promoter function. Standard cloning techniques and procedures were utilized (43). Site-Directed Mutagenesis. Two different mutants (Mut 1 and Mut 2) were constructed using the QuikChange SiteDirected Mutagenesis Kit (Stratagene) so the functional significance of the two strong consensus AP-2 sites located within the human MPG basal promoter sequence, nucleotides -227 to -81, could be analyzed. These sites were identified from consensus sequences taken from Thompson et al. (44). Consensus sites for AP-2 binding were defined as conforming to the sequence GSCCCDSS, where S can be G or C and D can be any base but C (44). Underlined bases represent the two consecutive AP-2 “strong consensus” sites (44), GTGGCCCGCCCCGCCCCGGGGG and GTGGCCCGCCCCGCCCCGGGGG, respectively, located in the MPG promoter region extending between nucleotides -183 and -162. Mutations were constructed and are contained within the context of the -417 to -81 bp MPG-P basal promoter-luciferase plasmids. To confirm accuracy, both mutants were sequenced after cloning and large-scale plasmid preparation. Mut 1 altered bases -181 to -179 from GGC to ATA. This mutation was at the 5′-end of the upstream AP-2 strong consensus site, GGCCCGCC. The two primers used for oligonucleotide primer extension were 5′-GATCCACCTCCACGTATACCGCCCCGCCCCGGG-3′ and 5′-CCCGGGGCGGGGCGGTATACGTGGAGGTGGATC-3′ (Gibco). Mut 2 altered bases -171 to -169 from GCC to CTA. This mutation was at the 3′-end of the downstream AP-2 strong consensus site, GCCCCGCC. The two primers used were 5′TCCACGTGGCCCGCCCCCTACCGGGGGCGCAGC-3′ and 5′GCTGCGCCCCCGGTAGGGGGCGGGCCACGTGGA-3′ (Gibco). Transient Transfection of MCF10A and T47D Cells. T47D and MCF10A cells were seeded at a density of 5 × 105 cells in triplicate samples per group in Falcon 60 mm tissue culture dishes and were sustained in their growth medium until they were approximately 40-50% confluent. Adherent cells were cotransfected with 5 µg of reporter construct plasmid DNA and 1 µg of CMV-LacZ vector, to normalize for transfection efficiency, using SuperFect Transfection Reagent and Protocol (Qiagen). Amounts of psG5-AP-2 or psG5-AP-2B expression vectors used for cotransfection experiments are denoted in the appropriate figure legend. Negative and positive control groups were transfected, respectively, with 5 µg of promoterless reporter plasmid, pGL2 basic (Promega), or CMV-luciferase. Following a 3 h transfection period, cells were washed twice in PBS and growth medium was replaced. After a 48 h incubation period, cells were washed with PBS and lysed with 1× lysis reagent (Promega), following the manufacturer’s instructions. Luciferase activity was assayed by mixing aliquots of cell extracts with luciferin reaction mixture (Promega Luciferase Assay Kit), and emission of light was quantitated with a Microlumat luminometer. The luciferase activities were normalized for transfection efficiency with respect to ONPG activity encoded by the cotransfected CMV-LacZ plasmid. β-Gal (ONPG) Assay for Transfection Efficiency. ONPG substrate (Sigma) was prepared fresh at a concentration of 4 mg/mL in assay buffer Z [16.1 g/L Na2HPO4‚7H2O, 5.5 g/L NaH2PO4‚H2O, 0.75 g/L KCl, and 0.246 g/L MgSO4‚7H2O (pH ∼7.0)]. Reactions were carried out in duplicate samples, and the mixtures consisted of 50 µg of cell extract protein in a volume of 100 µL of buffer Z and 0.7 mL of buffer Z containing 0.27% β-mercaptoethanol. Reactions were timed upon addition of 0.16 mL of ONPG to reaction and blank tubes and the tubes placed in a 37 °C incubator for 1-3 h until yellow color develops. Tubes


Figure 1. Transcriptional activity of MPG promoter constructs. (A) Physical map of the 2.0 kb MPG promoter region and promoter-reporter plasmid constructs used for deletion analysis of the MPG genomic clone. Exon 1 is depicted as a black box. MPG constructs used for deletion analysis of the MPG promoter region are depicted as a solid black line. We have designated the first base of the ATG translation start site in exon 1 as +1 for mapping purposes. Restriction sites are denoted as follows: X, XhoI; RII, RsrI; AII, AvrII; and NsI, NsiI. The construct labeled MPG-P was used in later studies as noted elsewhere in text. (B) Luciferase activity of various reporter MPG deletion constructs (5 µg) in transiently transfected cultures of MCF10A and T47D cells. Luciferase activity was measured in cell extracts 48 h after transfection and normalized for transfection efficiency in the same cell extract with respect to β-galactosidase, encoded by the cotransfected CMV-LacZ plasmid (1 µg). Values are expressed in arbitrary units as normalized levels of luciferase activity for each construct and depicted as bar graphs, where the filled area represents the mean of three different experiments carried out in triplicate. Error bars represent the standard deviation of the mean. The significance of findings was evaluated by a Student’s t test comparing MCF10A to the T47D groups (p < 0.05 is denoted with an asterisk). No promoter activity was observed in the region between bases -1128 and -417 (not shown). were microfuged for 10 min at 14 000 rpm to pellet cell debris, and the absorbance was read at 420 nm in a spectrophotometer calibrated against blank tubes. ODs varied between 0.02 and 1. Values were used to calculate normalization factors that were

Chem. Res. Toxicol., Vol. 12, No. 11, 1999 1101 used to normalize luciferase activity to account for transfection efficiency of individual reporter plasmids. In some experiments, β-galactosidase activity was measured using a luminescent reporter system from Clontech (Palo Alto, CA). Luciferase Assay. Luciferase activity was measured using the Luciferase Assay System (Promega). Luciferase data were subsequently normalized for both the amount of protein and transfection efficiency. The amount of protein present was determined using the Bio-Rad Protein Assay. Transfection efficiency was determined using the ONPG assay for transfection efficiency as indicated above or the Luminescent β-Galactosidase Genetic Reporter System II (Clontech) to measure levels of β-galactosidase activity. Nuclear Extract Preparation and Electrophoretic Mobility Shift Assay (EMSA). Nuclear proteins were extracted from exponentially growing cultured cells according to the method of Dignam et al. (45). Total protein was determined for each sample using the Bio-Rad Protein Assay Reagent. Extracts were stored at -70 °C in extraction buffer consisting of 20 mM HEPES (pH 7.9), 0.35 M NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 25% glycerol, and protease inhibitors 5 µg/mL leupeptin, 5.0 µg/ mL aprotinin, 1 µg/mL pepstatin, and 85 µg/mL phenylmethanesulfonyl fluoride (PMSF). Duplex oligomers, described above, were prepared by heating complementary strands in 1× SSC at 95 °C for 5 min and allowing them to cool slowly to room temperature. Annealed oligonucleotides were then placed on ice, ethanol precipitated, and resuspended in TE (pH 8). Duplex oligonucleotides were radiolabeled with [R-32P]dCTP (Amersham) using Klenow DNA polymerase (Promega) in a fill-in reaction to ensure that all labeled probe was double-stranded. Labeled probes were then separated from free [R-32P]dCTP using Sephadex ProQuant G-50 micro columns from Hoefer Pharmacia Biotech (San Francisco, CA) and purified by gel electrophoresis. Binding reactions were performed according to the method of Jensen et al. (46) and included the R-32P-labeled DNA probes (1-5 ng, 20000-40000 cpm), 4 µg of poly(dI-dC), 30 µg of nuclear extract, 5 µg of BSA, 8 µL of 5× binding buffer [50 mM HEPES (pH 7.9), 5 mM dithiothreitol, 0.5% Triton, and 2.5% glycerol], 8 µL of extraction buffer (counting the nuclear extract volume), and the appropriate volume of H2O in a final volume of 40 µL. The final concentrations in the binding reaction mixture were 6 mM HEPES, 1.2 mM dithiothreitol, 0.3 mM MgCl2, 70 mM NaCl, 0.04 mM EDTA, 0.1% Triton, and 5.5% glycerol. Binding reaction mixtures were then incubated at 30 °C for 30 min. Competition experiments were performed as follows. Either a 50-fold molar excess of unlabeled specific competitor DNA or a 100-fold excess of unlabeled nonspecific competitor DNA was preincubated with nuclear extract for 30 min at room temperature before proceeding to the binding reactions. Bound products were resolved by electrophoresis through a 7% native polyacrylamide gel in 1× running buffer [50 mM Tris, 0.38 M glycine, and 2.0 mM EDTA (pH 8.5)]. Gel electrophoresis was performed at 20-25 mA. Supershift gel mobility assays were performed by preincubating the nuclear extract with 1-2 µg of specific antibody to either the Sp1 or AP-2R transcription factor (Santa Cruz Biotechnology) for 1 h before addition of labeled oligonucleotides. Binding reaction mixtures were incubated as indicated above, followed by loading onto 5% polyacrylamide gels. Gels were dried with a Bio-Rad gel dryer for 45 min at 85 °C, followed by exposure to Hyperfilm-MP (Amersham) at -70 °C, or Phosphor Screen (Molecular Dynamics). The film was then developed using an X-ray film processor (Fuji). Signals were quantified by densitometry or phosphorimage analysis (Molecular Dynamics). Western Blot Analysis. Nuclear protein in each lane (25 µg), obtained as described above, was resolved by SDS-PAGE on 12% polyacrylamide gels, transferred to nitrocellulose membranes, and processed for immunoblotting as previously described (36), using polyclonal rabbit antiserum directed against AP-2R (Santa Cruz Biotechnology) and a goat anti-rabbit IgGHRP immunoglobulin developing antibody (Santa Cruz Biotechnology). Red ponceau staining of blots was routinely per-

1102


Table 1. Measurement of MPG Transcription Rates in Mammary Epithelial Cellsa cell line

MPG run-off data

HMEC MCF10A T47D

1 1.5 3.23

a For the nuclear run-off assay, nuclei were isolated from breast cultures grown to subconfluent levels, to ensure RNA transcription was not inhibited by growth of cells in confluency. Equal amounts of nuclear RNA extracts which had incorporated [R-32P]UTP were used to hybridize onto nitrocellulose membrane dot blotted with (1) MPG cDNA subcloned into the pGEX vector, (2) control vector DNA not containing MPG, and (3) actin DNA as a positive control. Blots were exposed to a Phosphor Screen and quantified by phosphoimage analysis (Molecular Dynamics). Within each experiment, the density of actin signals was measured and used to normalize the measurements of the MPG signals for each cell line. MPG run-off data are expressed in arbitrary units representing MPG transcription rates normalized to the actin control for each cell line. Data represent the mean of two to four determinations.

formed to verify equal loading of lanes. Blots were developed by chemiluminescence using the ECL Plus Western blotting detection system (Amersham) and autoradiographed.

Results Measurement of N-Methylpurine DNA Glycosylase Transcription Rates by Nuclear Run-Off Assays in Mammary Epithelial Cells. We have recently shown that steady-state levels of MPG mRNA are higher in human breast cancer cells than in normal mammary epithelial cells (36). To determine whether this increase was due at least in part to an increase in the amount of transcription taking place within a tumor, we assessed transcription rates using nuclear run-off assays in human normal mammary epithelial cells (HMEC) and immortalized normal (MCF10A) and malignant (T47D) breast epithelial cell lines. Nuclei were isolated from actively growing subconfluent cultures to ensure that RNA transcription was not inhibited by confluent growth in culture. Results are shown in Table 1. Densitometry analysis of nuclear RNA followed by normalization of signals to the actin internal control showed that transcription rates of MPG were 3.23-fold higher in the tumor cells, and showed that transcription rates in MCF10A cells are reasonably close to those of HMEC. Isolation and Analysis of the Basal Promoter Region of MPG in MCF10A and T47D Cells. Considering previous published analyses on the characterization and structural organization of mammalian MPG promoters (26, 37, 47, 48), we began our experiments using a 2.0 kb fragment surrounding exon 1, to identify or confirm putative regulatory elements responsible for basal activity of the gene (Figure 1A). On the basis of data from a series of transfections, all of the basal promoter activity was localized to a 146 bp region extending from bases -227 to -81 upstream from the ATG translation start site in exon 1 (Figure 1). This region overlaps the 180 bp region recently identified by Izumi et al. (48). Furthermore, we found that deletion of a 629 bp region, spanning from base 337 to base 966 (Figure 1B), restored basal promoter activity. Although this may suggest that negative regulatory elements could be contained within this region, further analysis of this region along with proper positive controls for length are required to prove this. In addition, we found no promoter activity in the region extending from base -1128 to -417

Cerda et al.

(data not shown). Computer analysis of the basal promoter region revealed no TATA or CCAAT sequence, and as described previously (17, 48), this region is highly GCrich, similar to typical housekeeping genes. Transient transfection experiments using the construct designated MPG-P (bases -417 to -81) revealed 4-fold greater promoter activity in T47D cells than in MCF10A cells (56-fold for control vs 14-fold for control), shown in Figure 1. These results demonstrate increased basal MPG promoter activity in T47D breast cancer cells. Sp1 Transcription Factor Binds to the GC-Rich Regulatory Region in the MPG Promoter. The 146 bp element containing regulatory elements essential for promoter activity of the MPG gene, spanning the region between bases -227 and -81 5′ from the ATG site in exon 1, was investigated for binding sites of transactivating factors that may contribute to the expression of this gene. Computer analysis revealed the existence of several (more than 30) overlapping Sp1 consensus sites. These overlapping Sp1 binding motifs in the GC-rich region of the MPG promoter correspond to part of the CpG island previously identified by Nicholls et al. (42), which is typical of housekeeping genes. For the purpose of performing electromobility shift assays (EMSA), this region of bases -227 to -81 was divided into three oligonucleotides, designated WT I-III (see Experimental Procedures) that spanned most of this 146 bp region, and included those regions suggested by computer analysis to contain binding sites. The oligonucleotide fragments included regions between bases -190 and -156 for oligonucleotide WT I, bases -159 and -114 for WT II, and bases -115 and -70 for WT III. Recombinant Sp1 protein specifically bound double-stranded oligonucleotides WT I-III (Figure 2, lane 2 in panels A-C). These DNA-Sp1 protein complexes were supershifted when an antibody directed against Sp1 was utilized as part of the binding reaction mixture (Figure 2, lane 3 in panels A-C). Nuclear extracts from T47D cells formed DNAnuclear protein complexes with these oligonucleotides (Figure 2, lane 4 in panels A-C), which were effectively competed out with 50-fold excess of cold specific competitor (Figure 2, lane 5 in panels A and B, less effectively competed out in panel C), but not with a 100-fold excess of nonspecific competitor (Figure 2, lane 6 in panels A-C). Although there were no significant differences in the gel shift banding patterns in oligonucleotides WT I and WT III using MCF10A and T47D cell extracts (not shown), the lower-molecular weight protein complexes formed with oligonucleotide WT II were slightly different for these cells (Figure 3A, lanes 1 and 4). Additionally, preincubation of these nuclear proteins with anti-Sp1 antibody but not with nonspecific rabbit polyclonal IgG 1 h prior to performing the binding reaction effectively inhibited the formation of the Sp1 protein complex with the GC-rich oligonucleotide II (Figure 3A, arrow on lanes 2 and 5). These results suggest that Sp1 forms part of the nuclear protein complexes bound to the 146 bp region that contains regulatory elements essential for the promoter activity of the MPG gene. Also of interest is the finding that binding of antibody to Sp1 caused a supershift in the EMSA when pure Sp1 was incubated with oligonucleotide II (Figure 2B, lane 3), but it caused an inhibition of complex formation, rather than a supershift, when incubated with nuclear extracts (Figure 3A, lanes 2 and 5). The basis for this difference in behavior is not clear at present. Sp1 binding activity was further



Figure 3. MCF10A and T47D nuclear extracts form complexes with oligonucleotide II that contain Sp1. (A) Standard EMSA reactions (see Experimental Procedures) were followed by addition of BSA (2 µg as a negative control), rabbit polyclonal anti-Sp1 antibody (1-2 µg, Sp 1Ab), or nonspecific rabbit polyclonal antiserum (NS Ab). The arrow denotes the Sp1-DNA protein complexes competed out by addition of specific anti-Sp1 antibody. (B) EMSA comparing Sp1 binding activity in nuclear extracts from MCF10A and T47D cells. EMSA was carried out as indicated in Experimental Procedures using 20 000 cpm of labeled Sp1 consensus probe and 1-2 footprinting units of recombinant human Sp1 protein, or 30 µg of nuclear extract proteins. Rabbit polyclonal antibodies, anti-Sp1 (1-2 µg, Sp 1Ab) and nonspecific (NS Ab), were used for supershift studies. Arrows denote Sp1-DNA protein complexes. Lane SC contained the cold oligonucleotide used for specific competition at a 50fold excess; lane NS contained the 25 bp oligonucleotide used for nonspecific competition at a 100-fold excess. Lane FP contained the free probe.

Figure 2. EMSA comparing binding of human Sp1 and T47D nuclear extract proteins to oligonucleotides WT I-III. EMSA was carried out as described in Experimental Procedures using 20 000 cpm of labeled oligonucleotides WT I (Probe I), WT II (Probe II), and WT III (Probe III) and 1 footprinting unit of recombinant human Sp1 or 30 µg of nuclear extract from T47D cells. Arrows denote Sp1-containing complexes and corresponding supershifts with Sp1 antibody (Sp 1Ab). Lane SC contained the cold oligonucleotide used for specific competition at a 50fold excess; lane NS contained the 25 bp oligonucleotide used for nonspecific competition at a 100 fold excess. Lane FP contained the free probe.

investigated in these cells by EMSA using a doublestranded 22-base oligonucleotide containing an Sp1

consensus binding sequence (Figure 3B). When nuclear extracts from both MCF10A and T47D cells were assessed for binding activity with respect to this oligonucleotide containing the Sp1 consensus sequence, densitometric analysis showed that Sp1 binding activity was virtually the same for both cell types (Figure 3B, lanes 3 and 6), suggesting that Sp1 binding activity is equivalent in these cells. AP-2 Binds to the Putative AP-2 Elements in the Basal MPG Promoter Regulatory Region. Within the basal promoter sequence, we identified two overlapping consensus AP-2 binding sites identical to the “strong” consensus AP-2 elements described by Thompson et al. (44). These sites were found in the region extending between bases -181 and -169 (see Experimental Procedures). With this in mind, we first investigated AP-2 binding activity in nuclear extracts from MCF10A and T47D cells, using a 32P-labeled double-stranded 26-base oligodeoxynucleotide that contains the AP-2 consensus binding sequence. Bacterially expressed human AP-2 protein formed a specific AP-2-DNA band complex (Figure 4, lane 2). Preincubation of AP-2 with anti-AP-

1104


Figure 4. EMSA comparing AP-2 binding activities in nuclear extracts from MCF10A and T47D cells. EMSA was carried out as described in Experimental Procedures using 20 000 cpm of labeled AP-2 consensus probe and 1-2 footprinting units of recombinant human AP-2 protein, or 30 µg of nuclear extract proteins. Rabbit polyclonal antibodies, anti-AP-2R (1-2 µg, AP-2 Ab) and nonspecific (NS Ab), were used for supershift studies. Arrows denote shifted and supershifted Ap-2-DNA protein complexes. Lane SC contained the cold oligonucleotide used for specific competition at a 50-fold excess; lane NS contained the 25 bp oligonucleotide used for nonspecific competition at a 100fold excess. Lane FP contained the free probe. The lower inset shows longer exposure of the region outlined in the box in the upper panel.

2R gave rise to a supershift of the AP-2-DNA band (Figure 4, lane 3). When nuclear extracts from MCF10A and T47D cells were assessed as a source of protein in this binding assay, specific AP-2-DNA complexes were formed (Figure 4, lanes 4 and 9) that were also supershifted with an antibody directed against AP-2R but not with a nonspecific rabbit antiserum (Figure 4, lanes 7 and 12 vs lane 8). The specificity of AP-2-DNA complexes was determined by performing DNA competition analysis. A 50-fold molar excess of cold AP-2 consensus oligonucleotide but not a 100-fold excess of cold nonspecific DNA competitor effectively competed out the AP2-DNA complexes (Figure 4, lanes 5 and 10 vs lanes 6 and 11). There was greater AP-2 binding activity in nuclear extracts from T47D cells than in those from MCF10A cells (depicted in the small inset). This increase in AP-2 binding activity in T47D cells correlated with a 2.5-fold increase in the amount of AP-2 protein in these cells, as determined by Western blotting (Figure 5, lane 3 vs lane 2). To examine AP-2 binding to the putative AP-2 sites in the MPG promoter, electrophoretic mobility shift assays were performed using 32P-labeled oligonucleotide I, which spans the region located between bases -196 and -150. Bacterially expressed human AP-2 protein formed a specific AP-2-DNA band complex (Figure 6, lanes 1 and 2). Preincubation of AP-2 with antiAP-2R gave rise to a supershift of the AP-2-DNA band (Figure 6, lane 3). Nuclear extracts from MCF10A and T47D cells specifically bound oligonucleotide I forming certain protein-DNA band complexes (Figure 6, lanes 4 and 7). Preincubation of these extracts with an antibody directed to AP-2R gave rise to specific band supershifts (Figure 6, lanes 6 and 9 vs lanes 5 and 8), indicating that AP-2 formed part of these DNA-protein complexes. There was a marked increase in the extent of formation

Cerda et al.

Figure 5. Western blot analysis of AP-2 protein in nuclear extracts of MCF10A and T47D cells. Total protein (25 µg) was resolved by SDS-PAGE on a 12% polyacrylamide gel, transferred to nitrocellulose membranes, and immunoblotted with rabbit polyclonal antihuman AP-2R antiserum. Bacterially expressed human AP-2R (500 ng) served as a marker in lane 1. The arrow denotes the AP-2 protein band (52 kDa).

Figure 6. MCF10A and T47D nuclear extracts form complexes with oligonucleotide WT I that contain AP-2. (A) EMSA was carried out as described in Experimental Procedures using 1-2 footprinting units of recombinant human Ap-2 protein (lanes 1-3) or 30 µg of nuclear extract proteins. Standard binding reactions (see Experimental Procedures) were followed by addition of BSA (2 µg as negative control), rabbit polyclonal antiAP-2R antibody (1-2 µg, AP-2 Ab), or nonspecific rabbit polyclonal antiserum (NS Ab). Arrows denote the AP-2-DNA protein shifted and supershifted complexes by addition of specific anti-AP-2R antibody. Panel B shows a longer exposure focusing on the upper region of EMSA to confirm the presence of a small amount of AP-2 supershifted in MCF10A extracts (lane 9 as compared to T47D extracts in lane 6).

of AP-2-DNA band complexes in T47D cells compared to that in MCF10A cells (depicted in Figure 6, lower panel, lane 6 vs lane 9). These results demonstrate that breast tumor cells exhibit an increased level of expression of AP-2 protein and enhanced binding activity to the AP-2 consensus sequences located in the region of base pairs -190 to -156 of the MPG promoter. AP-2 Contributes to Regulation of Expression of N-Methylpurine DNA Glycosylase in Mammary



Figure 8. EMSA comparing AP-2 binding to the wild-type I (WT I) and mutant oligonucleotides. EMSA was carried out as described in Experimental Procedures using 20 000 cpm of labeled WT I, Mut 1, or Mut 2 probes and 1 footprinting unit of bacterially derived human AP-2 protein. Anti-AP-2R (1-2 µg, AP-2Ab) or nonspecific (NS Ab) rabbit polyclonal antibodies were used for supershift studies. Arrows denote DNA-AP-2 protein and antibody supershift complexes. Lane FP contained the free probe.

Figure 7. AP-2 effects on the MPG promoter. (A) Effects of AP-2 on human MPG promoter activity in MCF10A cells. MCF10A cells were transiently transfected with either pGL2 basic or MPG promoter reporter construct (5 µg) and cotransfected with a human AP-2 expression plasmid pSG5-AP-2 (140 ng) or AP-2B dominant negative expression plasmid pSG5-AP2B (1200 ng). (B) Inhibition of AP-2 activity by AP-2B on MPG promoter activity in T47D cells. T47D cells were transiently transfected with MPG promoter reporter construct (5 µg) and cotransfected with AP-2B dominant negative expression plasmid pSG5-AP-2B (900 or 1200 ng). Luciferase activity was measured in cell extracts 48 h after transfection and normalized for transfection efficiency in the same cell extract with respect to β-galactosidase, encoded by the cotransfected CMV-LacZ plasmid (1 µg). The quantitative differences in AP-2 or AP-2B expression plasmids were compensated by addition of pSG5 vector alone. Values are expressed in arbitrary units as normalized levels of luciferase activity for each deletion construct and depicted as bar graphs, where the black area represents the mean of three different experiments each carried out in triplicate. Error bars represent the standard error of the mean. The significance of findings was evaluated by the Student’s t test comparing cotransfected groups to the MPG-P control group (p < 0.05 is denoted with an asterisk).

Epithelial Cells. Since AP-2 was found to bind to the putative AP-2 consensus sequences in the MPG promoter, we examined whether this transcription factor is functionally involved in regulating MPG expression in mammary epithelial cells. If AP-2 contributes to MPG transcription, then an increased level of AP-2 expression may increase MPG basal promoter activity. To investigate this, MCF10A cells were cotransfected with the MPG-P and (1) the human AP-2 expression vector, pSG5-AP-2 (40), (2) the dominant negative AP-2B expression vector, pSG5-AP-2B (40), or (3) the pSG5 vector alone (Figure 7A). Cotransfection of MPG-P with pSG5-AP2, in doses ranging from 70 to 200 ng of pSG5-AP2, resulted in increased MPG promoter activity. Peak activity of transfected pSG5-AP2 was reached at a dose of 140 ng, which

resulted in a 2.1-fold increase in MPG promoter activity (Figure 7A). While cotransfection experiments with up to 600 and 1200 ng of dominant negative AP-2B expression vector did not affect basal MPG-P activity in MCF10A cells, cotransfection of MPG-P with 600 ng of pSG5-AP-2B vector and 140 ng of pSG5-AP-2 completely abolished the AP-2-driven transactivation of the basal MPG promoter (Figure 7A). Basal luciferase activity of the promoterless reporter, pGL2 basic, was not affected by these constructs. In an effort to investigate the extent of the endogenous AP-2 induction of basal MPG promoter activity, T47D cells were cotransfected with increasing doses of the dominant negative AP-2B expression vector, pSG5-AP2-B, or the pSG5 vector alone (Figure 7B). In contrast to MCF10A cells, cotransfection with 1200 ng of dominant negative pSG5-AP-2B vector suppressed basal MPG promoter activity in T47D cells by 50%. Results from cotransfection experiments, using AP-2expressing and dominant negative vectors, suggest that AP-2 upregulates basal MPG promoter activity in T47D cells. The ability of the dominant negative AP-2B expression vector, pSG5-AP-2B, to inhibit endogenous basal MPG promoter activity in T47D cells but not MCF10A cells suggests a possible contribution of AP-2 to the constitutive overexpression of MPG in breast cancer. Regulation of MPG-P Expression through the Distal GGCCCGCC and Proximal GCCCCGCC AP-2 Consensus Sites. Since two putative AP-2 strong consensus sites were found to be present within the human MPG basal promoter sequence, we conducted studies to investigate the relative functional importance of these sites in basal MPG-P activity in MCF10A and T47D cells. For this purpose, two oligonucleotides carrying two different types of mutations in each of the two strong consensus sites, Mut 1 and Mut 2, were synthesized (see Experimental Procedures). EMSAs using 32P-labeled WT I and mutant double-stranded oligonucleotides and bacterially derived human AP-2 showed specific AP-2-DNA complex bands for WT and Mut 1 oligonucleotides (Figure 8, lanes 2 and 6). Preincubation of human AP-2 protein with anti-AP-2R but not with nonspecific rabbit immunoglobulin led to a supershift of the AP-2-DNA complex band (Figure 8, lanes 3 and 7 vs lanes 4 and 8). In contrast, mutation of the proximal AP-2 consensus site in Mut 2 completely abolished AP-2 binding (Figure 8, lane 10). Gel shifts were subsequently performed to assess binding of nuclear extracts from MCF10A and

1106


Figure 9. EMSA comparing binding of MCF10A and T47D nuclear extracts to the wild-type I and mutant oligonucleotides. EMSA was carried out as indicated in Experimental Procedures using 20 000 cpm of labeled WT I, Mut 1, or Mut 2 probes and 30 µg of nuclear extracts from MCF10A or T47D cells. Lane FP contained the free probe (note that there is more binding of WT I and Mut 1 oligonucleotides by extracts from T47D cells, but that binding of Mut 2 is approximately the same for both cell types).

T47D cells to 32P-labeled WT I and mutant doublestranded oligonucleotides (Figure 9). There was greater binding activity in nuclear extracts of T47D cells toward oligonucleotides WT I and Mut 1, while the binding activity of Mut 2 was approximately the same for both cell types. Although the DNA-nuclear protein banding patterns were somewhat similar for all three oligonucleotides that were investigated, densitometric analysis demonstrated a significantly decreased level of T47D nuclear protein binding to oligonucleotide Mut 2 (Figure 9, lane 8, as compared to lanes 2 and 5). In fact, both the qualitative and quantitative EMSA band patterns of Mut 2 are virtually identical for the two cell types. To evaluate the functional significance of these two overlapping AP-2 consensus sites within the basal MPG-P sequence, we mutated each AP-2 site in the MPG-P reporter construct of bases -417 to -81, using site-directed mutagenesis. Mutations are described in Experimental Procedures, and sequences of mutant plasmids were verified by automated DNA sequencing (Perkin-Elmer model 480 sequencer). Mutation 1 altered bases -181 to -179 from GGC to ATA in the distal AP-2 consensus site, while mutation 2 altered bases -171 to -169 from GCC to CTA in the proximal AP-2 site. Transient transfections with wild-type and mutant constructs into MCF10A and T47D cells revealed different levels of MPG promoter activity for each line (Figure 10). While mutation of the distal AP-2 consensus site in Mut 1 showed a 15% reduction in basal MPG-P activity, mutation of the proximal AP-2 consensus site in Mut 2 caused a 45% reduction in basal MPG-P activity in T47D cells only. Taken together, these results suggest a greater functional importance of the proximal consensus AP-2 site in the activity of the MPG promoter in T47D cells.

Discussion We recently showed that the steady-state levels of MPG mRNA were consistently higher in breast cancer

Cerda et al.

Figure 10. Activity of mutated MPG promoters in MCF10A and T47D cells. MCF10A cells were transiently transfected with 5 µg of either pGL2 basic or MPG promoter reporter constucts: (1) MPG-P (basal MPG promoter of bases -417 to -81), (2) Mut 1 (∆-181/-179 in the distal AP-2 consensus site); and (3) Mut 2 (∆-171/-169 in the proximal AP-2 site). Luciferase activity was measured in cell extracts 48 h after transfection and normalized for transfection efficiency in the same cell extract with respect to β-galactosidase, encoded by the cotransfected CMV-LacZ plasmid (1 µg). Values are expressed in arbitrary units as normalized levels of luciferase activity for each deletion construct and depicted as bar graphs, where the filled area represents the mean of three different experiments each carried out in triplicate. Error bars represent the standard deviation of the mean. The significance of the findings was evaluated by a Student’s t test comparing mutant groups to the basal MPG-P control group (p < 0.05 is denoted with an asterisk).

compared to normal human breast epithelium (36). In light of these findings, we became interested in the biological contribution of this DNA repair enzyme to cancer. Overall repair is thought to depend on downstream base excision repair pathways (49). Consequently, increased levels of expression of MPG might dictate the rate of formation of potentially mutagenic AP sites, which might contribute to carcinogenesis if not compensated by an increased rate of removal of the target lesion. Indeed, it was recently shown that overexpression of human MPG in yeast doubles the spontaneous mutation rate (50). To elucidate the mechansims underlying the increased level of expression of MPG in breast cancer, we performed the study presented here. We first examined whether the increase in the steadystate level of MPG mRNA observed in breast cancer was specific or a more general increase in the amount of transcription taking place within a tumor cell. Here we show that MPG transcription rates were approximately 3-fold greater in tumor cells than in normal cells (Table 1), suggesting that overexpression of this gene was at least partly due to transcriptional regulation. Although expression of MPG gene is thought to be constitutive (21, 22) and its level low in rodent cells (23), increased levels of MPG have also been reported in other human tumors (17, 31). Vickers et al. (17) identified two alternative first exons, 1 and 1a, suggesting that there may be two alternative start sites of the primary transcript that may be distributed in a tissue-specific manner [Izumi et al. (48) refer to these same exons as 1a and 1b, respectively]. Using exon 1a (17), which carries a putative nuclear localization signal (16, 17), may affect regulatory mechanism(s) of transport of the MPG protein to the nucleus. In fact, a high intensity of MPG staining was found outside of the nucleus in breast cancer cells compared to that in normal breast cells (36), which may render these tumor cells more alkylation sensitive, even if they express higher levels of active glycosylase activity. Further investigations of variations in the usage of the two exons


in certain cancers may further elucidate the mechanism(s) regulating production of MPG. In an effort to determine the mechanism responsible for this difference in expression, we studied regulation of transcription of the MPG promoter in immortalized (MCF10A) and malignant (T47D) mammary epithelial cells. Housekeeping genes are frequently associated with short stretches of unmethylated CpG-rich DNA, known as CpG islands, located at the 5′-end of their associated genes, where promoters are usually localized (17, 51). In this study, we characterized a 2.0 kb region from a human genomic clone, which contained the 25 bp exon 1 of MPG and part of its 5′-CpG island (Figure 1). This CpG-rich region does not contain a TATA or CCAAT sequence but is reported to contain a DNAse I hypersensitive site, which is usually associated with important regulatory regions, and strongly suggested that the MPG promoter sequences are localized here (17). Deletion analysis of this region (Figure 1), followed by transient transfection of various MPG promoter reporter constructs into immortalized normal (MCF10A) and malignant (T47D) cells, identified positive regulatory elements in the region between bases -227 and -81 that were responsible for the basal promoter activity of this gene. Transfection experiments showed 4-fold increased luciferase activity in T47D cells compared to that in MCF10A cells, suggesting increased basal MPG promoter activity in the tumor cells (Figure 1). Others have recently reported that the MPG promoter resides in a 180 bp sequence overlapping the region we have identified here (48). Because no promoter activity was found between exons 1 and 1a, post-transcriptional processing responsible for the formation of two discrete mRNAs was suggested (48). Computer database analysis of the region of bases -227 to -81 revealed multiple overlapping Sp1 consensus binding sites and two overlapping consensus AP-2 binding sites located between bases -181 and -169. Sp1 and AP-2 consensus binding sites have also been previously identified in MPG promoters from other mammalian species (26, 38), suggesting a role for these transcription factors in regulating human MPG gene transcription. Since both Sp1 and AP-2 are known to regulate transcription of other promoters, we addressed the potential role of these factors in regulating MPG expression in DNA binding studies. Specific binding of both Sp1 and Ap-2 transcription factors to sequences in this region was demonstrated (Figures 2, 6, and 8), suggesting a role for each in regulating transcription of the MPG promoter. However, when nuclear extract proteins from both MCF10A and T47D cells were assessed by EMSA, gel shifts indicated that while both cell types contained equal Sp1 binding activities, AP-2 protein content and binding activity were considerably greater in T47D cells than in MCF10A cells (Figures 3-6). This suggested that AP-2 might be involved in the overexpression of MPG observed in human breast cancer. Other reports have demonstrated the involvement AP-2 in overexpression of c-erB-B2 in human mammary carcinoma (52). Although previous reports have shown either no induction or very little induction of mammalian MPG gene transcription by DNA methylating agents and ionizing radiation (21, 22, 24), activity of the rat MPG promoter has been demonstrated to be inducible by UV light and the tumor promoter 12-O-tetradecanoylphorbol 13-ace-


tate (TPA), which has been reported to stimulate transcription by activating transcription factor AP-2 (26, 53). This finding guided us to investigate the potential role of AP-2 in regulating MPG expression. The study presented here yields several lines of evidence pointing to a role for AP-2 in regulating human MPG gene transcription. First, the AP-2-driven upregulation of MPG expression was demonstrated by cotransfection experiments with the basal MPG-P reporter construct and the AP-2 expression vector, psG5-AP2, in MCF10A cells (Figure 7A). As previously observed for the human IGFBP-5 gene (40), this AP-2 transactivation of the basal MPG promoter was completely abolished by additional cotransfection with a dominant negative inhibitor of AP-2, psG5-AP2B. Furthermore, cotransfection experiments with AP2B significantly decreased basal MPG-P activity by 50% in T47D but not in MCF10A cells (Figure 7). These results suggest that AP-2 is involved in regulating MPG gene expression. A second line of evidence points to the extent to which AP-2 played a role in controlling MPG expression. Mutation of the upstream AP-2 consensus binding site decreased promoter activity by 15%, but mutation of the downstream site decreased promoter activity by 45% in T47D cells and abolished AP-2 binding to the promoter sequence (Figures 8 and 10). A similar result was observed in studies of the AP-2 binding sites in the promoter of the human IGFBP-5 gene (40). In this study, we examine and demonstrate the role of AP-2 in the regulation of human MPG gene expression, and show that AP-2 performs this regulatory function largely through the 5′-GCCCCGCC-3′ AP-2 consensus sequence located at bases -176 to -169 of this promoter region. It would appear from our data that MPG may function in normal breast cells as the housekeeping gene that it is generally regarded to be. In these cells, its expression appears to be relatively much less dependent on AP-2. In breast cancer cells, however, AP-2 is present in larger amounts and appears to be responsible for a significant proportion of MPG expression. Because AP-2 is involved in the control of cell growth, differentiation, and development (54, 55), it will be of much interest to elucidate the AP-2 signaling events involved in neoplastic progression and in the responses of cancer cells to DNA damage.

Acknowledgment. We are indebted to Dr. Sankar Mitra (University of Texas Medical Branch) for providing us with the cloned cDNA encoding human MPG, Dr. Douglas R. Higgs (University of Oxford) for providing us with the cosmid vector CRA36 containing a genomic clone which contains all of the MPG gene, and Dr. Michael A. Tainsky (The University of Texas M. D. Anderson Cancer Center) and Dr. Cunming Duan (University of Michigan) for providing us with the AP-2 expression constructs pSG5-AP-2 and pSG5-AP-2B. We also acknowledge Dr. J. Douglas Engel, Patrick W. Turk, and Kristi A. Miller for their helpful discussion and comments. This work was supported by National Institutes of Health (NIH) Grant AG11536, U.S. Army Grant DAMD17-94-J-4466, and the Lynn Sage Cancer Research Foundation.

References (1) Friedberg, E. C., Walker, G. C., and Siede, W. (1995) DNA Repair and Mutagenesis, p 698, American Society for Microbiology, Washington, DC. (2) Lindahl, T., Sedwick, B., Sekiguchi, M., and Nakabeppu, Y. (1988) Regulation and expression of the adaptive response to alkylating agents. Annu. Rev. Biochem. 57, 133-157.

1108


(3) Wood, R. D. (1996) DNA repair in eukaryotes. Annu. Rev. Biochem. 65, 135-167. (4) Randall, S. K., Eritja, R., Kaplan, E., Petruska, J., and Goodman, M. F. (1987) Nucleotide insertion kinetics opposite abasic lesions in DNA. J. Biol. Chem. 262, 6864-6870. (5) Saparbaev, M., and Laval, J. (1994) Excision of hypoxanthine from DNA containing dIMP residues by the Escherichia coli, yeast, rat, and human alkylpurine DNA glycosylases. Proc. Natl. Acad. Sci. U.S.A. 91, 5873-5877. (6) Bessho, T., Roy, R., Yamamoto, K., Kasai, H., Nishimura, S., Tano, K., and Mitra, S. (1993) Repair of 8-hydroxyguanine in DNA by mammalian N-methylpurine-DNA glycosylase. Proc. Natl. Acad. Sci. U.S.A. 90, 8901-8904. (7) Dosanjh, M., Roy, R., Mitra, S., and Singer, B. (1994) 1,N6Ethenoadenine is preferred over 3-methyladenine as substrate by a cloned human N-methylpurine-DNA glycosylase (3-methyladenine-DNA glycosylase). Biochemistry 33, 1624-1628. (8) Dosanjh, M., Chenna, A., Kim, E., Fraenkel-Conrat, H., Samson, L., and Singer, B. (1994) All four known cyclic adducts formed in DNA by the vinyl chloride metabolite chloroacetaldehyde are released by a human DNA glycosylase. Proc. Natl. Acad. Sci. U.S.A. 91, 1024-1028. (9) Boiteux, S., Huisman, O., and Laval, J. (1984) 3-Methyladenine residues in DNA induce the SOS function sfiA in Eschericia coli. EMBO J. 3, 2569-2573. (10) Larson, K., Sahm, J., Shenkar, R., and Strauss, B. (1985) Methylation-induced blocks to in vitro DNA replication. Mutat. Res. 150, 77-84. (11) Engelward, B. P., Allan, J. M., Dreslin, A. J., Kelly, J. D., Wu, M. M., Gold, B., and Samson, L. (1998) A chemical and genetic approach together define the biological consequences of 3-methyladenine lesions in the mammalian genome. J. Biol. Chem. 273, 5412-5418. (12) Park, J. W., and Ames, B. N. (1988) 7-Methylguanine adducts in DNA are normally present at high levels and increase on aging: analysis by HPLC with electrochemical detection. Proc. Natl. Acad. Sci. U.S.A. 85, 7467-7470. (13) Gaubatz, J. W., and Tan, B. H. (1997) Introduction, distribution, and removal of 7-methylguanine in different liver chromatin fractions of young and old mice. Mutat. Res. 375, 25-35. (14) O’Connor, T. R. (1993) Purification and characterization of human 3-methyl-adenine-DNA glycosylase. Nucleic Acids Res. 21, 55615569. (15) Chakravarti, D., Ibeanu, G. C., Tano, K., and Mitra, S. (1991) Cloning and expression in Escherichia coli of a human cDNA encoding the DNA repair protein N-methylpurine-DNA glycosylase. J. Biol. Chem. 266, 15710-15715. (16) Samson, L., Derfler, B., Boosalis, M., and Call, K. (1991) Cloning and characterization of a 3-methyladenine DNA glycosylase cDNA from human cells whose gene maps chromosome 16. Proc. Natl. Acad. Sci. U.S.A. 88, 9127-9131. (17) Vickers, M. A., Vyas, P., Harris, P. C., Simmons, D. L., and Higgs, D. R. (1993) Structure of the human 3-methyladenine DNA glycosylase gene and localization close to the 16p telomere. Proc. Natl. Acad. Sci. U.S.A. 90, 3437-3441. (18) Sun, B., Latham, K. A., Dodson, M. L., and Lloyd, R. S. (1995) Studies on the catalytic mechanism of five DNA glycosylases. Probing for enzyme-DNA imino intermediates. J. Biol. Chem. 270, 19501-19508. (19) Roy, R., Kumar, A., Lee, J. C., and Mitra, S. (1996) The domains of mammalian base excision repair enzyme N-methylpurine-DNA glycosylase. Interaction, conformational change, and role in DNA binding and damage recognition. J. Biol. Chem. 271, 2369023697. (20) Roy, R., Kennel, S. J., and Mitra, S. (1996) Distinct substrate preference of human and mouse N-methylpurine-DNA glycosylases. Carcinogenesis 17, 2177-2182. (21) Mitra, S., and Kaina, B. (1993) Regulation of repair of alkylation damage in mammalian genomes. Prog. Nucleic Acid Res. Mol. Biol. 44, 109-142. (22) Grombacher, T., and Kaina, B. (1995) Constitutive expression and inducibility of O6-methylguanine-DNA methyltransferase and N-methylpurine-DNA glycosylase in rat liver cells exhibiting different status of differentiation. Biochim. Biophys. Acta 127, 63-72. (23) Roy, G., Roy, R., and Mitra, S. (1997) Quantitative reverse transcriptase polymerase chain reaction for measuring the Nmethylpurine-DNA glycosylase mRNA level in rodent cells. Anal. Biochem. 246, 45-51. (24) Laval, F. (1991) Increase of O6-methylguanine-DNA-methyltransferase and N3-methyladenine glycosylase RNA transcripts in rat hepatoma cells treated with DNA-damaging agents. Biochem. Biophys. Res. Commun. 176, 1086-1092.

Cerda et al. (25) Lefebvre, P., Zak, P., and Laval, F. (1993) Induction of O6methylguanine-DNA-methyltransferase and N3-methyladenineDNA-glycosylase in human cells exposed to DNA-damaging agents. DNA Cell Biol. 12, 233-241. (26) Grombacher, T., and Kaina, B. (1996) Isolation and analysis of inducibility of the rat N-methylpurine-DNA glycosylase promoter. DNA Cell Biol. 15, 581-588. (27) Ibeanu, G., Hartenstein, B., Dunn, W. C., Chang, L.-Y., Hofman, E., Coquerelle, T., Mitra, S., and Kaina, B. (1992) Overexpression of human DNA repair protein N-methylpurine-DNA glycosylase results in the increased removal of N-methylpurines in DNA without a concomitant increase in resistance to alkylating agents in chinese hamster ovary cells. Carcinogenesis 13, 1989-1995. (28) Kaina, B., Fritz, G., and Coquerelle, T. (1993) Contribution of O6alkylguanine and N-alkylpurines to the formation of sister chromatid exchanges, chromosomal aberrations, and gene mutations. Environ. Mol. Mutagen. 22, 283-292. (29) Yen, L., Woo, A., Christopoulopoulos, G., Batist, G., Panasci, L., Roy, R., Mitra, S., and Alaoui-Jamali, M. A. (1995) Enhanced host cell reactivation capacity and expression of DNA repair genes in human breast cancer cells resistant to bifunctional alkylating agents. Mutat. Res. 337, 179-189. (30) Damia, G., Imperatori, L., Citti, L., Mariani, L., and D’Incalci, M. (1996) 3-Methyladenine-DNA-glycosylase and O6-alkyl guanineDNA-alkyltransferase activities and sensitivity to alkylating agents in human cancer cell lines. Br. J. Cancer 73, 861-865. (31) Codegoni, A. M., Broggini, M., Pitelli, M. R., Pantarotto, M., Torri, V., Mangioni, C., and D’Incalci, M. (1997) Expression of genes of potential importance in the response to chemotherapy and DNA repair in patients with ovarian cancer. Gynecol. Oncol. 65, 130137. (32) Coquerelle, T., Dosch, J., and Kaina, B. (1995) Overexpression of N-methylpurine-DNA glycosylase in Chinese hamster ovary cells renders them more sensitive to the production of chromosomal aberrations by methylating agents: a case of imbalanced DNA repair. Mutat. Res. 336, 9-17. (33) Engelward, B. P., Dreslin, A., Christensen, J., Huszar, D., Kurahara, C., and Samson, L. (1996) Repair-deficient 3-methyladenine DNA glycosylase homozygous mutant mouse cells have increased sensitivity to alkylation-induced chromosome damage and cell killing. EMBO J. 15, 945-952. (34) Engelward, B. P., Weeda, G., Wyatt, M. D., Broekhof, J. L., de Wit, J., Donker, I., Allan, J. M., Gold, B., Hoeijmakers, J. H., and Samson, L. D. (1997) Base excision repair deficient mice lacking the Aag alkyladenine DNA glycosylase. Proc. Natl. Acad. Sci. U.S.A. 94, 13087-13092. (35) Cerda, S., and Weitzman, S. A. (1997) Influence of oxygen radical injury on DNA methylation. Mutat. Res. 386, 141-152. (36) Cerda, S. R., Turk, P. W., Thor, A. D., and Weitzman, S. A. (1998) Altered expression of the DNA repair protein, N-methylpurineDNA glycosylase (MPG) in breast cancer. FEBS Lett. 431, 1218. (37) Mitchell, P. J., Wang, C., and Tjian, R. (1987) Positive and negative regulation of transcription in vitro: enhancer-binding protein AP-2 is inhibited by SV40 T antigen. Cell 50, 847-861. (38) Kannan, P., Buettner, R., Chiao, P. J., Yim, S. O., Sarkiss, M., and Tainsky, M. A. (1994) N-ras oncogene causes AP-2 transcriptional self-interference, which leads to transformation. Genes Dev. 8, 1258-1269. (39) Buettner, R., Kannan, P., Imhof, A., Bauer, R., Yim, S. O., Glockshuber, R., Van Dyke, M. W., and Tainsky, M. A. (1993) An alternatively spliced mRNA from the AP-2 gene encodes a negative regulator of transcriptional activation by AP-2. Mol. Cell. Biol. 13, 4174-4185. (40) Duan, C., and Clemmons, D. R. (1995) Transcription factor AP-2 regulates human insulin-like growth factor binding protein-5 gene expression. J. Biol. Chem. 270, 24844-24851. (41) Bergstraesser, L. M., and Weitzman, S. A. (1993) Culture of normal and malignant primary human mammary epithelial cells in a physiological manner simulates in vivo growth patterns and allows discrimination of cell type. Cancer Res. 53, 2644-2654. (42) Nicholls, R. D., Fischel-Ghodsian, N., and Higgs, D. R. (1987) Recombination at the human R-globin gene cluster: sequence features and topological constraints. Cell 49, 369-378. (43) Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. (44) Thompson, D. A., Cronini, C. N., and Martin, F. (1994) Genomic cloning and sequence analyses of the bovine R-, βA- and βBinhibin/activin genes. Identification of transcription factor AP-2 binding sites in the 5′-flanking regions by DNase I footprinting. Eur. J. Biochem. 226, 751-764.

Regulation of MPG Expression (45) Dignam, J., Lebovitz, R. M., and Roeder, R. G. (1983) Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11, 14751489. (46) Jensen, D. E., Rich, C. B., Terpstra, A. J., Farmer, S. R., and Foster, J. A. (1995) Transcriptional regulation of the elastin gene by insulin-like growth factor-I involves disruption of Sp1 binding. Evidence for the role of Rb in mediating Sp1 binding in aortic smooth muscle cells. J. Biol. Chem. 270, 6555-6563. (47) Tatsuka, M., Ibeanu, G. C., Izume, T., Narayan, S., Ramana, C. V., Kim, N. K., Kang, W., Roy, G., and Mitra, S. (1995) Structural organization of the mouse DNA repair gene, N-methylpurine-DNA glycosylase. DNA Cell Biol. 14, 37-45. (48) Izume, T., Tatsuka, M., Tano, K., Asano, M., and Mitra, S. (1997) Molecular cloning and characterization of the promoter of the human N-methylpurine-DNA glycosylase (MPG) gene. Carcinogenesis 18, 1837-1839. (49) Wilson, D. M., III, and Thompson, L. H. (1997) Life without DNA repair. Proc. Natl. Acad. Sci. U.S.A. 94, 12754-12757. (50) Glassner, B. J., Rasmussen, L. J., Najarian, M. T., Posnick, L. M., and Samson, L. D. (1998) Generation of a strong mutator


(51) (52)

(53)

(54)

(55)

phenotype in yeast by imbalanced base excision repair. Proc. Natl. Acad. Sci. U.S.A. 95, 9997-10002. Bird, A. P. (1986) CpG-rich islands and the function of DNA methylation. Nature 321, 209-213. Bosher, J. M., Williams, T., and Hurst, H. C. (1995) The developmentally regulated transcription factor AP-2 is involved in c-erbB-2 overexpression in human mammary carcinoma. Proc. Natl. Acad. Sci. U.S.A. 92, 744-747. Imagawa, M., Chiu, R., and Karin, M. (1987) Transcription factor AP-2 mediates induction by two different signal-transduction pathways: protein kinase C and cAMP. Cell 51, 251-260. Williams, T., Admon, A., Luscher, B., and Tijian, R. (1988) Cloning and expression of AP-2, a cell-type-specific transcription factor that activates inducible enhancer elements. Genes Dev. 2, 15571569. Zhang, J., Hagopian-Donaldson, S., Serbedzija, G., Elsemore, J., Plehn-Dujowich, D., McMahon, A. P., Flavell, R. A., and Williams, T. (1996) Neural tube, skeletal and body wall defects in mice lacking transcription factor AP-2. Nature 381, 238-241.

TX9901027

Regulation of Expression of N-Methylpurine DNA Glycosylase in

Recommend Documents