Environ. Sci. Technol. 2007, 41, 5108-5113
Response of Antibiotic Resistance Genes (ARG) to Biological Treatment in Dairy Lagoon Water RUOTING PEI,† JONGMUN CHA, KENNETH H. CARLSON, AND AMY PRUDEN* Department of Civil and Environmental Engineering, Colorado State University, Fort Collins, Colorado 80523
To explore the response of antibiotic resistance genes (ARG) to biological treatment, dairy lagoon water was incubated anaerobically or aerobically at 20 °C or 4 °C. Three conditions were compared: Antibiotic (Ab) Spiked, Ab Spiked and Killed, and Background (unamended). For Ab Spiked conditions, oxytetracycline, sulfamethoxazole, tylosin, and monensin were each added at 20 mg/L. Antibiotics and ARG were monitored using high-performance liquid chromatography/tandem mass spectrometry and quantitative real-time polymerase chain reaction, respectively. Biological degradation of antibiotics in all treatments and varied responses of different ARG was observed. Aerobic versus anaerobic treatment had no effect on tet(W), with an overall pattern of increase in the presence of antibiotics followed by decrease to initial levels. tet(O) responded differently under aerobic versus anaerobic treatment, increasing to highest levels at 4 °C under aerobic treatment and at 20 °C under anaerobic treatment before returning to initial levels. sul(I) and sul (II) showed similar patterns and increased in all Ab Spiked conditions, failing to return to initial levels at 4 °C and in some of the 20 °C treatments. ere(A) and msr(A) were lower than the other two ARG classes and remained constant in all treatments.
Introduction About one-half of the fifty million pounds of antibiotics produced each year in the United States is used for agriculture, and 90% of this is used for growth promotion (1). Significant amounts of antibiotics are excreted unaltered or as metabolites (up to 75%; 2, 3), which presents a major source of antibiotic input to the environment. These antibiotics have the potential to contribute to the spread of antibiotic resistance genes (ARG), which have recently been recognized as emerging contaminants in and of themselves (4). The spread of ARG is of significant interest considering that they impart the ability of disease-causing microorganisms to resist medical treatment. More than 70% of the bacteria that cause hospital-acquired infections have been noted to be resistant to at least one antibiotic (5). Virtually all strains of Staphylococcus aureus worldwide were susceptible to penicillin in 1941, but by the 1980s, 70-80% of * Corresponding author phone: (970) 491-8814; fax: (970) 4918671; e-mail
[email protected]. † Current address: Department of Civil and Environmental Engineering, Duke University, Durham, North Carolina 27708-0287. 5108
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 41, NO. 14, 2007
S. aureus isolates were resistant to penicillin (6). Other antibiotics, such as methicillin and other semisynthetic penicillins were successful in treating penicillin-resistant S. aureus infections until the 1980s, when methicillin resistant S. aureus (MRSA) became endemic in many hospitals (7). Since the emergence of MRSA, the glycopeptide vancomycin has been the only uniformly effective treatment for staphylococcal infections. In order to develop a comprehensive strategy to contain resistance and protect human health, a better understanding of the behavior of ARG and the various pathways by which they are spread is needed. The behavior of ARG in the aquatic environment is especially of interest, considering that relatively little is known about the routes by which ARG may be spread. Livestock waste is known to contain high levels of ARG (1, 8, 9), which may be stored in lagoons with a retention time of several months before land application of the residual as a fertilizer or soil conditioner. Well-functioning lagoons have a reduction in solids, nutrients, odor, and sludge volume, and also act as aerobic or anaerobic bioreactors decomposing organic materials. However, the effect of treatment on ARG is unknown. Recent studies have confirmed the presence of various classes of ARG in livestock lagoons (4, 10), and also a correlation between ARG and antibiotic concentrations (10). Because ARG are harbored within microbes and are selected for in the presence of antibiotics, they have the potential to actually amplify in response to treatment. Conversely, considering that ARG are organic molecules, they may also be degraded. Therefore, there is a need to develop an understanding of the effect of lagoon treatment and management on ARG and to identify effective strategies for minimizing the spread of ARG via environmental pathways. The purpose of this study was to determine the effect of biological treatment in bench-scale dairy lagoons on the levels of tetracycline (tet(W) and tet(O)), sulfonamide (sul(I) and sul(II)), and macrolide (ere(A) and msr(A)) ARG. Both aerobic/ anaerobic and temperature treatment effects were explored. Quantitative real-time polymerase chain reaction (Q-PCR) was used to monitor ARG levels with time, and highperformance liquid chromatography/tandem mass spectrometry was used to monitor antibiotics. It was expected that ARG would remain constant in controls that were killed with biocide or that were not spiked with antibiotics, but that increases or decreases would be observed in biologically active conditions spiked with antibiotics. Overall biological activity was expected to be enhanced by aerobic and higher temperature treatments. This study is the first to detail the effects of different lagoon treatment regimes on the levels of various classes of ARG.
Experimental Section Bench-Scale Lagoons. To investigate the effect of lagoon treatment on ARG, a 2 × 2 experimental design was implemented in which lagoon water was subjected to aerobic or anaerobic treatment at 20 or 4 °C. Water was collected from a dairy in northern Colorado on October 20, 2005 for the 20 °C study to represent end of summer conditions and on March 16, 2006 prior to turnover for the 4 °C study to represent winter conditions. Water was collected from two anaerobic lagoons in series, the first had a dissolved oxygen concentration of ∼1.0 mg/L in the first 10 cm and was used in the aerobic experiments, the second had a DO of 0 mg/L and was used in the anaerobic experiments. Manure from the dairy was monitored prior to this study and several antibiotics were detected, including tetracycline, sulfamethoxazole, tylosin, roxithromycin, and penicillin G, which were 10.1021/es070051x CCC: $37.00
2007 American Chemical Society Published on Web 06/08/2007
presumably used for treatment of infections, since dairies do not use growth promoters. For aerobic treatments, 8 L of lagoon water was added to 9 L reactors, operated in duplicate for each condition. The term “condition” refers to whether antibiotics were added (Ab Spiked) or not (Background) or if biocide was used (Killed). Oxytetracycline (OTC), sulfamethoxazole (SMX), tylosin (TYL), and monensin (MON) (Sigma Chemical, St. Louis, MO) were chosen to represent the tetracycline, sulfonamide, macrolide, and ionophore classes of antibiotics that are commonly used in CAFOs and have been confirmed to be present in various environmental compartments (10, 11-14). All four antibiotics were added at 20 mg/L for all Ab Spiked conditions and 50 g/L sodium azide was added to the Ab Spiked and Killed conditions to inhibit biological activity. For the Background, only the unamended lagoon water was added. Fish tank aeration pumps (Profile Aquarium air pump 4000, Taiwan) were used for aeration and mixing. For anaerobic bioreactors, all conditions were the same, except that 0.1 g/L mercuric chloride was also added to the Ab Spiked and Killed condition, because sodium azide specifically targets aerobic microorganisms. The anaerobic reactors were sealed with rubber stoppers modified with a nitrogen gas purge inlet, a sampling outlet, and a gas production monitoring outlet. The headspace of each reactor was purged with nitrogen gas for 10 min after filling. The experiments were repeated at a smaller scale for comparative purposes at a reduced temperature of 4 °C in a standard refrigerator modified with electrical outlets. One 9 L reactor was set up for each aerobic and anaerobic Ab Spiked and Ab Spiked and Killed condition. Due to space limitations in the refrigerator and because little response was expected based on the 20 °C experiments, the 4 °C Background condition was scaled-down to sixty 50 mL amber serum bottles sealed under a nitrogen headspace and ten 300 mL serum bottles aerated with the fish tank pumps. Primer Design. Primers for msr(A) (alteration of the antibiotic structure) and ere(A) (efflux pump) macrolide resistance were designed. All currently available macrolides nucleotide sequences were downloaded from the GenBank Database (http://www.ncbi.nlm.nih.gov/) and aligned with the multiple-sequence alignment program CLUSTALX 1.81 (15). Sequences within the msr(A) and ere(A) clusters were separately aligned in order to create consensus sequences for the primer design templates using FastPCR. The primer sequences were: msrA/B-FW ctggaacggttgaaacggatggc and msrA/B-RV accaccactcatactgtcggttg (143 bp amplicon); and ereA-FW atgacgtggagaacgaccag and ereA-RV ccgacaattcgggcgccctcaat (101 bp amplicon). Specificity was verified using the BLAST alignment tool (http://www.ncbi.nlm. nih.gov/blast/). To further confirm specificity, purified PCR products obtained from bioreactor DNA extract were cloned using the TOPO TA Cloning Kit (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol. For each primer set, 20 random vector inserts were sequenced to verify that they matched the target macrolide ARG. Sequencing was performed by SeqWright (Houston, TX). Real-Time Quantitative PCR (Q-PCR). DNA was extracted from 1.8 mL lagoon water samples using the Mo Bio Ultra Clean Microbial DNA isolation kit (MioBio Laboratories Inc, Carlsbad, CA). Q-PCR protocols were optimized to quantify macrolide ARG ere(A) and msr(A) using the designed primers, and sulfonamide ARG sul(I) sul(II), and tetracycline ARG tet(W) and tet(O), using previously described primers (1618). Q-PCR was performed using a ABI7300 Real-Time PCR system (Applied Biosystems, Foster City, CA) and a 25 µL reaction mixture [1× Power SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA), 0.2 µM of each primer, and 1 µL of template] with a temperature program of 15 min at 95 °C (initial denaturing and Hot Start Taq activation),
followed by 50 cycles of the following: 15 s at 95 °C; 30 s at the annealing temperature [65 °C for sul(I), 57.7 °C for sul(II), 60 °C for ere(A), 60 °C for msr(A), 60 °C for tet(W), and 50.3 °C for tet(O)]; and 30 s at 72 °C (optical window on) followed by a final dissociation stage. In order to account for the variations in overall extraction efficiency and the total bacterial community, 16S rRNA genes were quantified using a TaqMan approach as described in Suzuki et al. (19). Reactions were performed in a 25 µL reaction mixture [1× TaqMan PCR Master Mix (Applied Biosystems, Foster City, CA), 0.1 µM of each primer, 0.15 µM 16S rRNA gene TaqMan Probe, and 1 µL of template] with a temperature program of 15 min at 95 °C (initial denaturing and Hot Start Taq activation), followed by 50 cycles of the following: 15 s at 95 °C, 30 s at 53 °C, and 27 s at 72 °C (optical window on). It was found that a dilution of 1:30 (for 20 °C experiments) and 1:40 (for 4 °C experiments) eliminated PCR inhibition in Q-PCR assays. For 16S rRNA genes, a matrix inhibition test was conducted to determine a suppression factor to correct for inhibition as published in Pei et al. (18). Each ARG was quantified in three replicates in parallel with standards over 7 orders of magnitude with negative controls in every run. Quantification of Antibiotics. One milliliter of sample was placed in a 40 mL Teflon tube with 20 mL of McIlvaine buffer solution and 200 µL of 5% Na2EDTA (w/v, 1mmol in solution) to complex metals. Samples were vigorously mixed in a parallel shaker (model 4626, Lab-line instrument) for 20 min at 400 rpm followed by centrifuging at 4000 rpm (IEC Clinical Centrifuge, International Equipment Co., Needham Heights, MA) for 15 min. The supernatant was filtered using 0.2 µm glass fiber filters and cleaned using solid-phase extraction (SPE). High-performance liquid chromatography tandem mass spectrometry (HPLC/MS/MS) was used for separation and detection. Detailed information on SPE and HPLC/MS/MS is described elsewhere (20, 21). Average recovery was 98% with a limit of quantification of 0.7 µg /L. Statistics. Statistical analyses were conducted using SAS 9.0 (SAS Institute Inc, Cary, NC). The response of each ARG to different treatments and conditions in dairy lagoon water was analyzed using the Mixed Procedure, which fits a variety of mixed linear models to data. This provides the flexibility of simultaneously modeling means, variances, and covariances (22-24). Dixon’s Extreme Value Test was used to test for statistical outliers, which were rejected. For each ARG, aerobic versus anaerobic data were pooled together to determine if the responses of ARG to the two treatments were significantly different. Data from the 20 °C versus 4 °C experiments were also pooled together to determine the effect of temperature. To compare the three conditions, data from duplicate treatments were pooled together. A p-value
