Article pubs.acs.org/biochemistry
Role of Ca2+ in the Stability and Function of TMEM16F and 16K Kenji Ishihara,† Jun Suzuki, and Shigekazu Nagata* Biochemistry & Immunology, Immunology Frontier Research Center, Osaka University, 3-1 Yamada-oka, Suita, Osaka 565-0871, Japan S Supporting Information *
ABSTRACT: There are 10 transmembrane protein (TMEM) 16-family proteins in humans and mice. Among them, TMEM16F acts as a Ca2+-dependent phospholipid scramblase at the plasma membrane. However, how Ca2+ activates TMEM16F’s phospholipid-scramblase activity has not been elucidated. Here we found that in the presence of Ca2+, TMEM16K (whose function is unknown) directly binds Ca2+ to form a stable complex that can be detected by blue-native polyacrylamide gel electrophoresis. In the absence of Ca2+, TMEM16K and TMEM16F aggregated, suggesting that their structure is stabilized by Ca2+. Comprehensive mutagenesis of acidic residues in TMEM16K’s cytoplasmic and transmembrane regions identified five residues that are critical for binding Ca2+. These residues were well conserved between TMEM16F and 16K, and point mutations of these residues in TMEM16F reduced its ability to support Ca2+-dependent phospholipid scrambling. Our results suggest that Ca2+ binds TMEM16F directly and induces conformational changes that support its stability and function. TMEM16-family proteins can sense Ca2+. Since TMEM16A carries putative calmodulin-binding sites, it was postulated that calmodulin is involved in recognizing Ca2+.21,22 However, this possibility was ruled out; dominant-negative calmodulin did not inhibit the TMEM16A-mediated Cl−-channel activity, and calmodulin did not coimmunoprecipitate with TMEM16A.23 Meanwhile, Tien et al.24 conducted a comprehensive mutational analysis of TMEM16A’s conserved acidic residues and identified four residues that affect its Ca2+-dependent Cl−channel activity. Since these mutations modulated the ability of different divalent cations to activate TMEM16A’s Cl− -channel activity, Tien et al. postulated that these residues directly bind Ca2+.24 To elucidate the biophysical properties of the TMEM16 proteins, in this report we biochemically analyzed TMEM16F and 16K, and found that both formed a stable complex in BlueNative PAGE (BN-PAGE) when solubilized in the presence of Ca2+. A Ca2+-overlay assay showed that Ca2+ bound TMEM16K directly. By systematically mutating most of the acidic residues in TMEM16K’s intracellular and transmembrane regions and analyzing the mutants by BN-PAGE, we identified five acidic residues that are essential for Ca2+ binding. Point mutations in the corresponding residues in TMEM16F strongly reduced its ability to scramble phospholipids. These five acidic residues are present in three neighboring transmembrane segments, suggesting that Ca2+ binding stabilizes the protein by tightening interactions between transmembrane segments.
The transmembrane protein (TMEM) 16 family, also called the anoctamin (Ano) family, has 10 members in humans and mice (TMEM16A-H, J, and K; ano1-10). The ubiquitously expressed TMEM16A (Ano1) functions as a voltage- and Ca2+-activated Cl− channel.1−3 Since TMEM16B (Ano2), which is specifically expressed in the retina, also acts as a Ca2+-dependent Cl− channel, all of the TMEM16 family members were thought to be Cl− channels.4−6 In fact, several groups have reported that TMEM16F (Ano6) and various other TMEM16 proteins have this ion channel activity.7−10 We identified TMEM16F as a Ca2+-dependent phospholipid scramblase that acts at the plasma membrane.11 Mouse fetal thymocytes, platelets, osteoblasts, and Ba/F3 pro-B cells that lack TMEM16F lose the ability to scramble phospholipids in response to a Ca2+ ionophore.12−15 Humans with Scott syndrome, in which phosphatidylserine (PtdSer) is not exposed on activated platelets, carry a loss-of-function mutation in the TMEM16F gene.11,16 These findings indicated that TMEM16F is indispensable for Ca2+-dependent phospholipid scrambling. Subsequently, using in vitro reconstitution, TMEM16s from Aspergillus f umigatus and Nectria hematococca were shown to function as phospholipid scramblases.17,18 TMEM16F’s ionchannel activity was, therefore, considered to be a consequence of phospholipid translocation19 or a secondary activity triggered under certain nonphysiological conditions.20 In addition to TMEM16F, TMEM16C, 16D, 16G, and 16J function as Ca2+dependent scramblases at the plasma membrane. We recently showed that TMEM16E may function as a scramblase at the endoplasmic reticulum. On the other hand, the function of two other members (TMEM16H and 16K) is not known. TMEM16A’s function as a Cl− channel and TMEM16F’s function as a phospholipid scramblase are activated when the intracellular concentration of Ca2+ increases, indicating that the © XXXX American Chemical Society
Received: February 25, 2016 Revised: May 26, 2016
A
DOI: 10.1021/acs.biochem.6b00176 Biochemistry XXXX, XXX, XXX−XXX
Article
Biochemistry
■
EXPERIMENTAL PROCEDURES Mice, and Cell Lines. To produce TMEM16K−/− mice, we purchased the mouse ES clone Ano10tm1a(EUCOMM)Wtsi (EUCOMM), which carries a single-allele knockout in the TMEM16K gene (https://www.mousephenotype.org/data/ alleles/MGI:2143103/tm1a%28EUCOMM%29Wtsi/), from Helmholtz Zentrum München, Deutsches Forschungszentrum für Gesundheit and Umwelt. The ES cells were injected into blastocysts from ICR mice (Shimizu Laboratory Supplies), and the resultant chimeric mice were crossed with C57BL/6N mice to obtain heterozygous mice. The mice were genotyped by PCR using the wild-type specific sense primer CTAGAAAGCTAGTAAAATCCAG, the mutant-specific sense primer CACACCTCCCCCTGAACCTGAAAC, and the common antisense primer CAGCTGCTGAAGTGACTCTGTCA. All of the mice were housed in specific-pathogen-free facilities at the Kyoto University Graduate School of Medicine or the Research Institute for Microbial Diseases, Osaka University. All of the animal experiments were conducted according to protocols approved by the Kyoto University Animal Care and Use Committee and by the Animal Research Committee of the Research Institute for Microbial Diseases, Osaka University. TMEM16K−/− mouse embryonic fibroblasts (MEFs) were generated from 14.5-day-old embryos. In brief, after removing the head and visceral organs, embryos were minced and treated with trypsin for 40 min at 37 °C. The dissociated cells were then maintained in DMEM with 10% FBS (Thermo Fisher Scientific). TMEM16F−/− immortalized fetal thymocytes (IFETs)12 were maintained in RPMI1640 containing 10% FBS and 50 μM β-mercaptoethanol. TMEM16F−/− Ba/F3 cells13 were maintained in RPMI1640 containing 45 units/ml of mouse interleukin-3 and 10% FBS. HEK293T cells and PlatE cells25 were cultured in DMEM with 10% FBS. Antibodies and Materials. To produce a hamster monoclonal antibody (mAb) against mouse TMEM16K, the TMEM16K N-terminal region (amino-acid positions 1−197) was produced in Escherichia coli BL21 cells as a fusion protein with GST, maltose-binding protein (MBP), or polyhistidine, and was purified using glutathione-Sepharose 4B (GE Healthcare), amylose resin (New England Biolabs), or Ni-NTA agarose (Qiagen), respectively. The purified MBP-fusion protein was injected into Armenian hamsters (Oriental Yeast), and a booster immunization with His-tagged protein was injected into the footpads. Cells from the inguinal lymph nodes were fused with NSObcl‑2 mouse myeloma cells,26 and hybridomas were selected in medium containing hypoxanthine, aminopterin and thymidine. The supernatants were subjected to ELISA with the TMEM16K-GST fusion protein. Positive hybridomas were cultured in GIT medium (Nihon Seiyaku), and mAbs were purified by Protein A Sepharose (GE Healthcare). HRP-conjugated mouse anti-FLAG M2 mAb and anti-FLAG M2 Agarose were obtained from Sigma-Aldrich. Mouse anti-α-tubulin mAb and anti-Na+/K+ ATPase α mAb were obtained from Merck Millipore and Santa Cruz Biotechnology, respectively. ComplexioLyte (CL)47 and CL48 were purchased from Logopharm. Digitonin and n-dodecyl-ß-D-maltoside (DDM) were from Thermo Fisher Scientific. Calcium-45 Radionuclide was from PerkinElmer, and Fluo 4-AM was from Dojindo. Transformation of Cell Lines, and Cellular Localization of TMEM16F. Point mutations were introduced into TMEM16F and 16K by recombinant PCR27 using the
mutagenesis primers (Tables S1 and S2), and their authenticity was verified by sequencing. The full-length cDNA for TMEM16F (GenBank NM_175344) and TMEM16K (GenBank NM_133979.2) or their mutants was inserted at the EcoRI site or between the BamHI and EcoRI sites of the pMXspuro c-FLAG vector11 to express C-terminally Flag-tagged proteins. TMEM16F−/− IFETs or TMEM16K−/− MEFs were transformed by retrovirus infection. In brief, retroviruses carrying each cDNA were produced by transfecting Plat-E cells with the pMXs-puro vector, concentrated by centrifugation at 6000g for 16 h at 4 °C and used to infect IFETs or MEFs as described previously.12 Transformants were selected by culturing cells in the presence of 2 μg/mL puromycin. To transform TMEM16F−/− Ba/F3 cells, the cDNA was inserted into a pPEF-Flag vector carrying the puromycin-resistance gene in pEF-BOS-EX,28 and the vector was introduced into the cells by electroporation using NEPA21 (Nepa Gene). Stable transformants were selected by culturing in the presence of 2 μg/mL puromycin. To analyze the cellular localization, cDNA for TMEM16F or its mutants was inserted at EcoR1 site of pMXs-puro cenhanced green fluorescent protein (c-EGFP)29 to express a protein tagged with EGFP at the C-terminus. The resultant plasmids were introduced into HEK293T cells using Fugene 6 (Promega), and stable transformants, selected by culturing with 1 μg/mL puromycin, were grown on glass dishes and observed by confocal microscopy (FV-1000D; Olympus). SDS-PAGE, BN-PAGE, Two-Dimensional PAGE, and Western Blotting. To lyse cells, cells were suspended in CL48 or CL47 containing 0.5 mM CaCl2 and a mixture of protease inhibitors (cOmplete Mini, Roche Applied Science), or in lysis buffer (10 mM HEPES-NaOH pH 7.5, 150 mM NaCl, 0.5 mM CaCl2, 1 mM MgCl2 and a mixture of protease inhibitors) containing 0.5% digitonin or 1.0% DDM. After incubation for 3 h at 4 °C, the lysates were centrifuged at 17700g for 15 min at 4 °C. For SDS-PAGE, the supernatants (S-20) were incubated for 15 min at room temperature in SDS sample buffer (40 mM Tris-HCl pH 6.8, 2% SDS, 5% glycerol, 1% β-mercaptoethanol, and 0.01% bromophenol blue) and were separated by electrophoresis on a 10% polyacrylamide gel (Bio Craft). Precision Plus Protein Standards (Bio Rad) were used as molecular-weight standards. BN-PAGE was performed with the NativePAGE Bis-Tris Gel System (Thermo Fisher Scientific). In brief, the S-20 preparations were mixed with a 2/5 volume of 4× NativePAGE sample buffer and a 1/5 volume of NativePAGE 5% G-250 sample additive and were separated by electrophoresis at 4 °C at 200−250 V on a 4−16% Bis-Tris protein gel. Unstained Protein Standard (Thermo Fisher Scientific), consisting of IgM hexamer (1236 kDa), IgM pentamer (1048 kDa), apoferritin (720 and 480 kDa), Bphycoerythrin (242 kDa), lactate dehydrogenase (146 kDa), bovine serum albumin (66 kDa), and soybean trypsin inhibitor (20 kDa), was used as molecular weight markers. For twodimensional analysis (2-D PAGE), a strip was excised from the BN-PAGE gel and immersed at room temperature for 15 min in 50 mM Tris-HCl buffer (pH 6.8) containing 6 M urea, 30% glycerol, 2% SDS, and 1% DTT. The gel strip was then placed on top of the stacking gel for a 10−20% gradient gel (Bio Craft), sealed with 0.5% agarose in SDS loading buffer (25 mM Tris-HCl pH 7.9, 192 mM glycine, and 0.1% SDS), and subjected to electrophoresis. Western blotting was performed immediately after SDSPAGE or 2-D PAGE, or after incubating the BN-PAGE gel in B
DOI: 10.1021/acs.biochem.6b00176 Biochemistry XXXX, XXX, XXX−XXX
Article
Biochemistry
Figure 1. Characterization of mouse TMEM16K. (A and B) TMEM16K−/− MEFs were transformed with Flag-tagged mouse TMEM16K. Wild-type (WT), TMEM16K−/− (KO), and TMEM16K-transformed TMEM16K−/− (TR) MEFs were lysed with CL48. Protein aliquots of 5 μg for the wildtype and knockout cells, and 0.7 μg or 0.1 μg for the transformed cells were separated by SDS-PAGE (A) or BN-PAGE (B) and analyzed by Western blotting with an anti-Flag or anti-α-tubulin mAb. Sizes of the standard proteins (kDa) are shown at left. Bands indicated by * are nonspecific. (C) Cell lysates of HEK293T cells transfected with Flag-tagged TMEM16K were affinity-purified using anti-Flag M2 beads, and 5 μg of the purified protein was analyzed by two-dimensional PAGE. Proteins were transferred to a PVDF membrane and stained with SYPRO Ruby. The sizes of the standard proteins (kDa) are indicated at the top and right.
iodide (PI), and 1000-fold-diluted Cy5-labeled Annexin V (BioVision). The cells were treated with 3 μM A23187 (Sigma) at 20 °C and analyzed by flow cytometry using a FACSAria II (BD Biosciences). PI-positive cells were excluded from analysis. To analyze intracellular Ca2+, IFETs were incubated for 1 h at 37 °C with 5 μM Fluo 4-AM in RPMI, and then washed and suspended in 10 mM HEPES-NaOH buffer (pH 7.5) containing 140 mM NaCl and 5 mM CaCl2. The cells were treated for 10 min with 3 μM A23187 at 20 °C and analyzed by flow cytometry using a FACSCanto II.
SDS loading buffer. Proteins in the gel were transferred to a PVDF membrane (Merck Millipore), and the membrane was probed with 0.4 μg/mL hamster anti-TMEM16K mAb in the Can Get Signal system (Toyobo), followed by HRP-conjugated goat anti-hamster Ig Ab (Jackson Immuno Research). FLAGtagged proteins were detected by 5000-fold-diluted HRP-antiFLAG mAb. Peroxidase activity was detected by Immobilon Western Chemiluminescent HRP substrate (Merck Millipore). In some cases, proteins were stained with Coomassie Brilliant Blue or SYPRO Ruby protein blot stain (Thermo Fisher Scientific). In-Gel Ca2+-Binding Assay. MEFs (1 × 107 cells) expressing Flag-tagged TMEM16K were incubated for 2.5 h at 4 °C in 1 mL of CL48 containing 1 mM CaCl2 and cOmplete mini to lyse the cells. Insoluble materials were removed by centrifugation, and the supernatant was mixed with 50 μL of anti-FLAG M2-agarose and kept at 4 °C overnight. The beads were washed with CL48 containing 1 mM CaCl2, and the bead-bound proteins were eluted with 50 μL of CL48 containing 1 mM CaCl2 and 160 ng/μL 3× FLAG peptide (Sigma-Aldrich). The Ca2+-overlay assay was performed as described30 with modifications. In brief, after BN-PAGE, the gel was soaked for 30 min at 4 °C in Buffer A (10 mM imidazole-HCl buffer pH 6.8, 60 mM KCl, and 5 mM MgCl2), incubated for 48 h at 4 °C with 3 μCi/mL 45CaCl2, washed four times at 4 °C in Buffer A for 15 min each, and exposed to an imaging plate (Storage Phosphor Screen, BAS IP MS, GE Healthcare) for 20 h at 4 °C. The signal was then scanned using a PhosphorImager (Typhoon FLA 9500; GE Healthcare). Heat Stability Determination of TMEM16F and Its Mutants. To examine the heat-sensitive aggregation of TMEM16F, Ba/F3 cells expressing Flag-TMEM16F or its mutants were lysed with CL48 containing 0.5 mM CaCl2. After insoluble materials were removed, the cell lysates (10 μg protein) were placed in 200-μL PCR tubes (Bio-Bik) with 20 μL of CL48 containing 5 mM CaCl2 or EGTA and were incubated for 10 min in a thermal cycler (Takara Bio). Aliquots (5 μg) were separated by BN-PAGE and analyzed by Western blotting with an anti-Flag mAb. PtdSer Exposure on the Cell Surface, and Intracellular Ca2+ Level. Ca2+-induced PtdSer exposure was analyzed as previously described.11 In brief, 5 × 105 IFETs were suspended in 1 mL of 10 mM HEPES-NaOH buffer (pH 7.5) containing 140 mM NaCl, 1.0 or 5.0 mM CaCl2, 5 μg/mL propidium
■
RESULTS Complex Structure of Mouse TMEM16K. We and others previously showed that TMEM16A and 16F behave as homodimers on SDS-PAGE after chemical cross-linking.31−33 However, TMEM16A and 16F often produce larger bands on SDS-PAGE. Since TMEM16K is the most abundantly expressed TMEM16-family protein in mammalian cells,12 and is also the smallest member of the mouse TMEM16 family (with 659 amino acids and a calculated Mr of 76 186), we chose to analyze the oligomeric structure of TMEM16K using BNPAGE.34 MEFs prepared from wild-type and TMEM16K−/− mice were lysed with CL48 detergent buffer containing Ca2+, and the lysates were separated by BN-PAGE or SDS-PAGE and analyzed by Western blotting with a hamster mAb against mouse TMEM16K. As shown in Figure 1, wild-type but not TMEM16K−/− MEFs produced a 68-kDa band in SDS-PAGE (Figure 1A) and a 250-kDa band in BN-PAGE (Figure 1B). Since membrane proteins are known to behave in BN-PAGE like they are at least 1.8 times larger than soluble proteins of the same mass,35 the size of the native TMEM16K was roughly estimated to be 140 kDa, suggesting that it was a homodimer or was associated with other molecules. When TMEM16K−/− MEFs were transformed with Flagtagged TMEM16K, the sizes of the exogenously expressed and endogenous TMEM16K were similar in BN-PAGE (Figure 1B). TMEM16K was exogenously expressed at a level at least 10 times greater than the endogenous protein level (Figure 1B), suggesting that TMEM16K was not associated with other proteins. To confirm this possibility, HEK293T cells transfected with the Flag-tagged TMEM16K were lysed in CL48 containing 0.5 mM Ca2+, and the TMEM16K protein was immunoprecipitated with an anti-Flag mAb and eluted with Flag-peptide in the presence of 1 mM Ca2+. When the eluted C
DOI: 10.1021/acs.biochem.6b00176 Biochemistry XXXX, XXX, XXX−XXX
Article
Biochemistry
Figure 2. Ca2+ binding to mouse TMEM16K. (A) TMEM16K−/− MEF transformants expressing Flag-tagged TMEM16K were lysed in CL47, CL48, digitonin, or DDM containing 1 mM CaCl2. After centrifugation to remove insoluble material, the lysates (5 μg proteins) were incubated for 12 h at 4 °C in the presence (+) or absence (−) of 5 mM EGTA, separated by BN-PAGE or SDS-PAGE (bottom), and analyzed by Western blotting with an anti-Flag mAb. (B) TMEM16K−/− MEFs expressing Flag-tagged TMEM16K were lysed in CL47 or CL48 containing 1 mM CaCl2, and the FlagTMEM16K was purified using anti-Flag M2 Agarose. The purified proteins (∼2 μg) were separated by BN-PAGE and were stained with Coomassie Brilliant Blue (CBB) (left) or were incubated for 48 h at 4 °C with 45Ca2+ (right). Bound 45Ca2+ was detected with the BAS system. Sizes of standard proteins are shown at right. (C) The purified TMEM16K protein (2 μg) was separated by BN-PAGE and incubated in the gel for 48 h at 4 °C with 45 Ca2+ in the presence (+) or absence (−) of 10 mM CaCl2. Bound 45Ca2+ was detected by the BAS system (right), and the proteins were stained with CBB (left). TMEM16K protein is indicated by an arrowhead.
addition, excess nonlabeled Ca2+ (10 mM) in the binding buffer completely abolished the 45Ca2+ binding to TMEM16K (Figure 2C). These results indicated that TMEM16K directly binds Ca2+. Ca2+-Binding Sites in Mouse TMEM16K. Since our results suggested that Ca2+ binding preserved TMEM16K as a stable complex that could be detected by BN-PAGE, we looked for Ca2+-binding site(s) in mouse TMEM16K. Acidic residues such as glutamate (Glu) and aspartate (Asp) are critical for Ca2+ binding.39 An X-ray structural analysis of N. hematococca TMEM1618 showed 10 transmembrane regions with the Nand C-termini in the cytoplasm. Most of the acidic Glu and Asp residues in the putative cytoplasmic and transmembrane regions of mouse TMEM16K (a total of 57 residues) were mutagenized singly, doubly, or triply to glutamine (Gln) and asparagine (Asn), respectively. Each mutant was Flag-tagged and expressed in TMEM16K−/− MEFs. The transformed cells were lysed with CL48 in the presence of 0.5 mM Ca2+, and the lysates were treated with or without 5 mM EGTA and analyzed by BN-PAGE followed by Western blotting with an anti-Flag mAb. As shown in Figure 3B, most of the TMEM16K mutants behaved like wild-type TMEM16K in CL48, producing a distinct band around 250 kDa in the presence of Ca2+, and broad bands after EGTA treatment. However, in five of the TMEM16K single mutants (E448Q, D497N, E500Q, E529Q, and D533N), the 250-kDa band was greatly decreased or disappeared altogether; instead, these mutants migrated as broad smearing bands at a higher Mr even in the presence of Ca2+ (Figure 3B,C). Adding EGTA did not change this migration pattern. In SDS-PAGE, all of the mutant TMEM16K proteins produced a 68-kDa band with an intensity similar to that of the wild-type protein, suggesting that these mutations did not affect the solubility of the TMEM16K protein in CL48, but abolished the protein’s ability to bind Ca2+. In contrast to the behavior in CL48, these mutants showed intact 250-kDa bands in CL47 with or without Ca2+ (Figure 3D), consistent with the idea that CL47 is a mild detergent buffer in which TMEM16K can maintain its structure even in the absence of Ca2+. To determine whether these five TMEM16K mutants could bind Ca2+ at higher concentrations, transformants expressing the various TMEM16K mutants were lysed by CL48 in the presence of increasing concentrations of Ca2+ and analyzed by
sample was subjected to 2-D PAGE (BN-PAGE followed by SDS-PAGE), SYPRO Ruby staining revealed a single spot, at around 250 kDa in the BN-PAGE and around 68 kDa in the SDS-PAGE direction (Figure 1C). These results confirmed that TMEM16K exists as a homodimer under native conditions. Direct Binding of Ca2+ to Mouse TMEM16K. Ca2+ binding causes conformational changes in various proteins.36 To determine whether Ca2+ affects the conformation of TMEM16K complexes, TMEM16K−/− MEF transformants expressing Flag-tagged TMEM16K were used. Cell lysates were prepared in CL48 containing 0.5 mM Ca2+ and incubated overnight at 4 °C in the presence of 5 mM EGTA. As shown in Figure 2A, this treatment caused the 250-kDa TMEM16K protein in BN-PAGE to disappear. Instead, a broad band appeared around 480 kDa, suggesting that the TMEM16K proteins aggregated. Various detergents have different effects in stabilizing membrane proteins.37 When cells were lysed with the CL47 instead of the CL48 detergent, the native TMEM16K had a slightly larger size in BN-PAGE. Moreover, its size was not affected by overnight EGTA treatment. Since CL47 and CL48 are detergent buffers with mild and intermediate stringency,38 respectively, these results suggested that the quaternary structure of the TMEM16K complex was preserved in the mild detergent CL47 without Ca2+, while its structure was disrupted in CL48 without Ca2+. Accordingly, lysing cells with digitonin, a mild detergent, elicited an effect on TMEM16K similar to that found with CL47, whereas the effect of DDM, a slightly stronger detergent than digitonin, was similar to that of CL48 (Figure 2A). The finding that Ca2+ deprivation caused TMEM16K proteins to aggregate suggested that Ca2+ might bind TMEM16K directly. To examine this possibility, the cells were lysed with CL48 or CL47, and the Flag-tagged TMEM16K was affinity-purified with anti-Flag and separated by BN-PAGE. After electrophoresis, the gel was soaked in a Ca2+-binding buffer and incubated at 4 °C for 48 h with 45 CaCl2. As shown in Figure 2B, 45Ca2+ bound to the TMEM16K purified from CL48 lysates. On the other hand, TMEM16K recovered from the CL47-solubilized lysates could not bind Ca2+, although similar amounts of protein were recovered from the lysates solubilized with CL47 or CL48. No binding of 45Ca2+ to marker proteins was observed, indicating that 45Ca2+ specifically bound TMEM16K (Figure 2B). In D
DOI: 10.1021/acs.biochem.6b00176 Biochemistry XXXX, XXX, XXX−XXX
Article
Biochemistry
Figure 3. Screen for Ca2+-binding sites in mouse TMEM16K. (A) The amino acid sequence of mouse TMEM16K. The putative transmembrane regions, using the X-ray structure of the Nectria hematococca TMEM16 ortholog as a reference,18 are underlined; the extracellular regions are highlighted in yellow. The mutagenized acidic residues (Glu and Asp) are shown in red; the mutations that affected TMEM16K’s Ca2+-mediated stability are highlighted in green. (B) TMEM16K−/− MEF transformants expressing wild-type (WT) TMEM16K or the indicated mutants were lysed in CL48 containing 0.5 mM CaCl2. The lysates (5 μg protein) were incubated for 12 h at 4 °C in the presence (+) or absence (−) of 5 mM EGTA, separated by BN-PAGE, and analyzed by Western blotting with an anti-Flag mAb. The mutations that affected TMEM16K’s Ca2+-mediated stability are shown in red. (C) TMEM16K−/− MEF transformants expressing WT TMEM16K or the indicated mutants were lysed in CL48. The lysates (5 μg protein) were separated by BN-PAGE (top) or SDS-PAGE (bottom) and analyzed by Western blotting with an anti-Flag mAb. (D) TMEM16K−/− MEF transformants expressing the indicated TMEM16K mutants were lysed in CL47 containing 0.5 mM CaCl2. The lysates (5 μg protein) were incubated for 12 h at 4 °C in the presence (+) or absence (−) of 5 mM EGTA, separated by BN-PAGE, and analyzed by Western blotting with an anti-Flag mAb. (E) TMEM16K−/− MEF transformants expressing WT TMEM16K or the indicated mutants were lysed in CL48 containing the indicated concentration of CaCl2. The lysates (5 μg protein) were incubated at 4 °C for 12 h, separated by BN-PAGE, and analyzed by Western blotting with an anti-Flag mAb.
stabilize TMEM16F, MEFs transformed with Flag-tagged mouse TMEM16F were lysed with CL48 containing 0.5 mM Ca2+, and the lysates were separated by BN-PAGE or SDSPAGE and analyzed by Western blotting with an anti-Flag mAb. As shown in Figure 4B, SDS-PAGE revealed a band of around 110 kDa, while BN-PAGE revealed a distinct 480-kDa band, which may be too large to be a homodimer (see Discussion). Unlike TMEM16K, the CL48-solublized TMEM16F did not aggregate when treated overnight with 5 mM EGTA at 4 °C (Figure 4C). However, when CL48solublized TMEM16F was incubated for 10 min at increasing temperatures in the presence of 5.5 mM CaCl2, it aggregated with a Tm (melting or denaturation temperature) of about 40.1 °C (Figure 4C). Adding 5 mM EGTA to the buffer significantly reduced the Tm to about 28.3 °C, indicating that Ca2+ stabilized TMEM16F, as it did with TMEM16K.
BN-PAGE. As shown in Figure 3E, three mutants (E448Q, E529Q, and D533N) could not maintain the distinct 250-kDa structure even in the presence of 10 mM CaCl2. However, two mutants (D497N and E500Q) responded to higher Ca2+ concentrations (10 mM and 1.25 mM Ca2+, respectively) and migrated as a distinct band around 250 kDa. These results indicated that the amino acid residues Glu-448, Glu-529, and Asp-533 are essential for binding Ca2+, while Asp-497 and Glu500 may contribute less to the Ca2+ binding. Effect of Mutations in Ca 2+ -Binding Sites on TMEM16F Function. The five mouse TMEM16K amino acid residues involved in binding Ca2+ are well conserved among TMEM16-family proteins. Although TMEM16K’s Asp497 is replaced by Glu in TMEM16A and 16F, the other four acidic residues are completely conserved in mouse TMEM16A, 16F, and 16K (Figure 4A). To examine whether Ca2+ could E
DOI: 10.1021/acs.biochem.6b00176 Biochemistry XXXX, XXX, XXX−XXX
Article
Biochemistry
Figure 4. Effect of Ca2+ on TMEM16F’s scramblase activity and stability. (A) Aligned amino acid sequences of mouse TMEM16F (amino acid positions: 597−725), 16A (amino acid positions: 622−756), and 16K (amino acid positions: 420−555). The transmembrane regions 6, 7, and 8 are underlined. Amino acid residues conserved between TMEM16F, 16A, and 16K are shown in red. The putative Ca2+-binding sites predicted in Figure 3 are highlighted in green. The amino acid numbers for TMEM16F and 16K are shown above and below the alignment, respectively. (B) TMEM16F−/− Ba/F3 cells were transformed with Flag-tagged mouse TMEM16F. The TMEM16F-transformed (TR) and nontransformed (Cont) TMEM16F−/− Ba/F3 cells were lysed in CL48 containing 0.5 mM CaCl2. Aliquots (5 μg protein) were separated by SDS-PAGE (left) or BN-PAGE (right) and analyzed by Western blotting with an anti-Flag mAb and an anti-α-tubulin mAb (bottom). (C) TMEM16F−/− Ba/F3 transformants expressing Flag-tagged TMEM16F were lysed with CL48 containing 0.5 mM CaCl2. The lysates (10 μg protein) in 20 μL were adjusted to 5 mM Ca2+ or 5 mM EGTA and incubated at the indicated temperatures (25−47 °C) for 10 min. Aliquots (10 μL) of the reaction mixture were separated by BN-PAGE and analyzed by Western blotting with an anti-Flag mAb. Right: the intensity of the 480-kDa band was plotted. (D) Stable transformants of HEK293T cells expressing the EGFP-tagged wild-type (WT) or indicated mutants of mouse TMEM16F were observed by confocal microscopy. (E) TMEM16F−/− IFETs were transformed with the Flag-tagged WT TMEM16F or the indicated mutants, and the protein expression levels were determined by Western blotting with an anti-Flag mAb. As a loading control, Western blot was also carried out with anti-Na+/K+ ATPase mAb. (F) After the transformants were treated with A23187 in the presence of 1 mM or 5 mM CaCl2, PtdSer exposure was followed for 10 min by the binding of Cy5-labeled Annexin V. Exposed PtdSer was shown as mean fluorescence intensity (MFI) in flow cytometry. The A23187-induced PtdSer exposure was also examined using TMEM16F−/− IFETs in which an empty (Vec)- or TMEM16F-expression vector was introduced. In right, IFETs transformants were loaded with Fluo 4-AM and analyzed before and after A23187 (3 μM) treatment for 10 min at 20 °C in the presence of 1 mM CaCl2.
To examine whether the five acidic residues that are essential for TMEM16K’s binding of Ca2+ are also involved in TMEM16F’s Ca2+-induced phospholipid-scrambling activity, we introduced point mutations (Glu to Gln, and Asp to Asn) into the five corresponding amino acids of mouse TMEM16F. These mutations did not change TMEM16F’s cellular localization, assessed by expressing their EGFP-fusion protein in HEK293T cells (Figure 4D). These mutants were then tagged with Flag at the C-terminus and stably expressed in TMEM16F−/− IFETs.12 As shown in Figure 4E, all of the transformants expressed similar levels of the TMEM16F proteins. As reported previously,12 TMEM16F−/− IFETs did not expose PtdSer when treated with the Ca2+-ionophore A23187 in the presence of 1 mM CaCl2. TMEM16F−/− IFETs transformed with wild-type TMEM16F responded well to A23187 and exposed PtdSer. However, none of the five TMEM16F mutants induced PtdSer exposure in response to
A23187 (Figure 4F), although the intracellular Ca2+ concentrations increased similarly with A23187 treatment (Figure 4F). When the Ca2+ concentration in the assay buffer was increased to 5 mM, the transformants expressing E667Q exposed PtdSer weakly in response to A23187. These results suggested that the acidic residues at the TMEM16F transmembrane segments 6, 7, and 8 are critical for binding Ca2+ to promote phospholipid scrambling.
■
DISCUSSION TMEM16-family members have diverse biological functions, including PtdSer exposure and Cl− channel activities.40−42 The Cl− channels control epithelial electrolyte secretion in cardiac muscle and regulate membrane potentials in the nervous system.40 Accordingly, defects in TMEM16-family proteins cause various diseases such as dystonia, muscle dystrophy, hemophilia, and ataxia.43,44 Despite these important functions, F
DOI: 10.1021/acs.biochem.6b00176 Biochemistry XXXX, XXX, XXX−XXX
Article
Biochemistry
mediated scramblase or Cl−-channel activity remains to be studied. TMEM16F and 16K maintained a stable complex in the presence of Ca2+ but aggregated in its absence, suggesting that these proteins’ tertiary structures differ in the presence or absence of Ca2+, or that Ca2+ binding induces conformational changes in them. The tertiary structure of fungal TMEM16 indicates that Ca2+ is buried inside the protein.18 The five Glu and Asp residues used for Ca2+ binding are in transmembrane segments (segments 6, 7, and 8), which are rich in hydrophobic residues. It is tempting to speculate that TMEM16 proteins without Ca2+ have an open, aggregation-prone configuration that allows them to accept Ca2+ from the cytoplasmic milieu, and that binding Ca2+ at the acidic residues in these neighboring transmembrane segments brings the proteins into a tight structure suitable for Ca2+-channel or scramblase activity. The acidic residues that strongly contribute to the Ca2+ binding are located in the eighth transmembrane segment, at the most external surface of the molecule, which may support this notion. In any event, to understand the Ca2+-induced conformational change of TMEM16F that enables it to scramble phospholipids, it will be necessary to compare the tertiary structures of TMEM16F with and without Ca2+.
the molecular mechanisms by which voltage, Ca2+, or both activate the various TMEM16 proteins are not well understood. We and others previously analyzed TMEM16A and 16F with chemical cross-linking and found that they behave as homodimers.31−33 However, Perez-Cornejo et al.45 reported that TMEM16A stoichiometrically interacts with other proteins, including proteins involved in the ezrin-radixinmoesin network. Here, using BN-PAGE followed by SDSPAGE, we found that TMEM16K existed as a homodimer and was not associated with other proteins. On the other hand, BNPAGE analysis of mouse TMEM16F showed a band with an apparent Mr of 480 kDa. Considering that membrane proteins move 1.8 times more slowly in BN-PAGE than soluble proteins,35 TMEM16F’s apparent Mr is 267 kDa, which is significantly larger than the Mr calculated for the TMEM16F homodimer (212 kDa). Thus, the possibility that TMEM16F is associated with other proteins cannot be ruled out. The X-ray structure of a fungal TMEM16 indicates that it may bind Ca2+.18 To study the Ca2+-binding activity of TMEM16 proteins, it was essential to establish a method for detecting Ca2+ binding. One method for detecting direct Ca2+ binding is a Ca2+-overlay assay, in which the protein is transferred to a membrane after SDS-PAGE.30 This assay successfully identified several Ca2+-binding proteins, including calmodulin, calreticulin, calmegin, and serum amyloid P component.30,46,47 However, we could not detect TMEM16K’s Ca2+-binding activity using this classical method.3 Many of the Ca2+-binding proteins identified using this method carry at least one EF-hand domain that seems to be resistant to the denaturing effect of SDS. In contrast, TMEM16 proteins lack an EF-hand domain, and their ability to bind Ca2+ appeared to be sensitive to SDS. To overcome this problem, we performed in-gel Ca2+-overlay assays with the native protein and found that Ca2+ bound to the TMEM16K homodimer directly. This finding was supported by Ca2+’s protective effect against TMEM16F and 16K aggregation in CL48. This method, the ingel Ca2+-overlay assay with native protein, may be applied to other putative Ca2+-binding proteins that do not have an EFhand domain. We next performed comprehensive mutational analyses of TMEM16K’s acidic residues to find Ca2+-binding sites and identified five Asp and Glu residues. Unlike wild-type TMEM16K, these mutants aggregated in the presence of Ca2+. Mutating the corresponding residues in TMEM16A (Glu to Gln, or Asp to Asn)18,24,48 and TMEM16F (this report) reduced these proteins’ Ca2+-induced Cl−-channel activity and phospholipid scrambling activity, respectively. In particular, these activities were almost completely lost, even at higher Ca2+concentrations, by mutating Glu-624, Glu-699, or Asp-703 in TMEM16F and the corresponding residues in TMEM16A, supporting the roles of these residues in binding Ca2+ directly.18 We previously postulated that a D409G mutation in TMEM16F’s first intracellular loop affects TMEM16F’s sensitivity to Ca2+,11,49 because the TMEM16F protein carrying this mutation is constitutively active. Ferrera et al.50 and Xiao et al.51,52 also reported that the N-terminal cytoplasmic region and first intracellular loop of TMEM16A contribute to its Ca2+ sensitivity in its role as a Cl− channel. On the other hand, the D409G mutation did not appear to affect TMEM16F’s heatinduced stability (data not shown), suggesting that this region may not be involved in directly binding Ca2+. How the amino acid residues in the N-terminal cytoplasmic region and first intracellular region contribute to the TMEM16 proteins’ Ca2+-
■
ASSOCIATED CONTENT
S Supporting Information *
The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.biochem.6b00176. The primer sequence to prepare the set of mutants in TMEM16K and 16F are available as Supplemental Tables 1−2 (PDF)
■
AUTHOR INFORMATION
Corresponding Author
*E-mail:
[email protected]. Present Address †
Department of Ophthalmology and Visual Sciences, Kyoto University Graduate School of Medicine, Kyoto 606-8507, Japan. Funding
This work was supported in part by Grants-in-Aid from the Japan Society for the Promotion of Science (JSPS) and from Core Research for Evolutional Science and Technology, Japan Science and Technology Corporation. Notes
The authors declare no competing financial interest.
■ ■
ACKNOWLEDGMENTS We thank M. Fujii for secretarial assistance. ABBREVIATIONS 2-D PAGE, two-dimentional PAGE; Ano, anoctamin; BNPAGE, blue-native PAGE; CL, ComplexioLyte; IFETs, immortalized fetal thymocytes; MBP, maltose-binding protein; MEFs, mouse embryonic fibroblasts; PtdSer, phosphatidylserine; TMEM16, transmembrane protein 16
■
REFERENCES
(1) Yang, Y., Cho, H., Koo, J., Tak, M., Cho, Y., Shim, W., Park, S., Lee, J., Lee, B., Kim, B., Raouf, R., Shin, Y., and Oh, U. (2008)
G
DOI: 10.1021/acs.biochem.6b00176 Biochemistry XXXX, XXX, XXX−XXX
Article
Biochemistry TMEM16A confers receptor-activated calcium-dependent chloride conductance. Nature 455, 1210−1215. (2) Schroeder, B., Cheng, T., Jan, Y., and Jan, L. (2008) Expression cloning of TMEM16A as a calcium-activated chloride channel subunit. Cell 134, 1019−1029. (3) Caputo, A., Caci, E., Ferrera, L., Pedemonte, N., Barsanti, C., Sondo, E., Pfeffer, U., Ravazzolo, R., Zegarra-Moran, O., and Galietta, L. (2008) TMEM16A, a membrane protein associated with calciumdependent chloride channel activity. Science 322, 590−594. (4) Hartzell, H. C., Yu, K., Xiao, Q., Chien, L. T., and Qu, Z. (2009) Anoctamin/TMEM16 family members are Ca 2+ -activated Cl − channels. J. Physiol. 587, 2127−2139. (5) Flores, C. A., Cid, L. P., Sepúlveda, F. V., and Niemeyer, M. I. (2009) TMEM16 proteins: the long awaited calcium-activated chloride channels? Braz. J. Med. Biol. Res. 42, 993−1001. (6) Galietta, L. (2009) The TMEM16 protein family: a new class of chloride channels? Biophys. J. 97, 3047−3053. (7) Schreiber, R., Uliyakina, I., Kongsuphol, P., Warth, R., Mirza, M., Martins, J., and Kunzelmann, K. (2010) Expression and function of epithelial anoctamins. J. Biol. Chem. 285, 7838−7845. (8) Shimizu, T., Iehara, T., Sato, K., Fujii, T., Sakai, H., and Okada, Y. (2013) TMEM16F is a component of a Ca2+-activated Cl− channel but not a volume-sensitive outwardly rectifying Cl− channel. Am. J. Physiol. Cell Physiol. 304, C748−759. (9) Yang, H., Kim, A., David, T., Palmer, D., Jin, T., Tien, J., Huang, F., Cheng, T., Coughlin, S. R., Jan, Y. N., and Jan, L. Y. (2012) TMEM16F forms a Ca2+-activated cation channel required for lipid scrambling in platelets during blood coagulation. Cell 151, 111−122. (10) Kunzelmann, K., Nilius, B., Owsianik, G., Schreiber, R., Ousingsawat, J., Sirianant, L., Wanitchakool, P., Bevers, E. M., and Heemskerk, J. W. M. (2014) Molecular functions of anoctamin 6 (TMEM16F): a chloride channel, cation channel, or phospholipid scramblase? Pfluegers Arch. 466, 407−414. (11) Suzuki, J., Umeda, M., Sims, P. J., and Nagata, S. (2010) Calcium-dependent phospholipid scrambling by TMEM16F. Nature 468, 834−838. (12) Suzuki, J., Fujii, T., Imao, T., Ishihara, K., Kuba, H., and Nagata, S. (2013) Calcium-dependent phospholipid scramblase activity of TMEM16 protein family members. J. Biol. Chem. 288, 13305−13316. (13) Gyobu, S., Miyata, H., Ikawa, M., Yamazaki, D., Takeshima, H., Suzuki, J., and Nagata, S. (2016) A role of TMEM16E carrying a scrambling domain in sperm motility. Mol. Cell. Biol. 36, 645−659. (14) Ehlen, H. W., Chinenkova, M., Moser, M., Munter, H. M., Krause, Y., Gross, S., Brachvogel, B., Wuelling, M., Kornak, U., and Vortkamp, A. (2013) Inactivation of Anoctamin-6/Tmem16f, a regulator of phosphatidylserine scrambling in osteoblasts, leads to decreased mineral deposition in skeletal tissues. J. Bone Miner. Res. 28, 246−259. (15) Fujii, T., Sakata, A., Nishimura, S., Eto, K., and Nagata, S. (2015) TMEM16F is required for phosphatidylserine exposure and microvesicle release in activated mouse platelets. Proc. Natl. Acad. Sci. U. S. A. 112, 12800−12805. (16) Castoldi, E., Collins, P. W., Williamson, P. L., and Bevers, E. M. (2011) Compound heterozygosity for 2 novel TMEM16F mutations in a patient with Scott syndrome. Blood 117, 4399−4400. (17) Malvezzi, M., Chalat, M., Janjusevic, R., Picollo, A., Terashima, H., Menon, A. K., and Accardi, A. (2013) Ca 2+-dependent phospholipid scrambling by a reconstituted TMEM16 ion channel. Nat. Commun. 4, 2367. (18) Brunner, J. D., Lim, N. K., Schenck, S., Duerst, A., and Dutzler, R. (2014) X-ray structure of a calcium-activated TMEM16 lipid scramblase. Nature 516, 207−212. (19) Yu, K., Whitlock, J. M., Lee, K., Ortlund, E. A., Yuan Cui, Y., and Hartzell, H. C. (2015) Identification of a lipid scrambling domain in ANO6/TMEM16F. eLife 4, e06901. (20) Scudieri, P., Caci, E., Venturini, A., Sondo, E., Pianigiani, G., Marchetti, C., Ravazzolo, R., Pagani, F., and Galietta, L. J. V. (2015) Ion channel and lipid scramblase activity associated with expression of tmem16F/ANO6 isoforms. J. Physiol. 593, 3829−3848.
(21) Tian, Y., Kongsuphol, P., Hug, M., Ousingsawat, J., Witzgall, R., Schreiber, R., and Kunzelmann, K. (2011) Calmodulin-dependent activation of the epithelial calcium-dependent chloride channel TMEM16A. FASEB J. 25, 1058−1068. (22) Jung, J., Nam, J. H., Park, H. W., Oh, U., Yoon, J.-H., and Lee, M. G. (2013) Dynamic modulation of ANO1/TMEM16A HCO3(−) permeability by Ca2+/calmodulin. Proc. Natl. Acad. Sci. U. S. A. 110, 360−365. (23) Yu, K., Zhu, J., Qu, Z., Cui, Y.-Y., and Hartzell, H. C. (2014) Activation of the Ano1 (TMEM16A) chloride channel by calcium is not mediated by calmodulin. J. Gen. Physiol. 143, 253−267. (24) Tien, J., Peters, C. J., Wong, X. M., Cheng, T., Jan, Y. N., Jan, L. Y., and Yang, H. (2014) A comprehensive search for calcium binding sites critical for TMEM16A calcium-activated chloride channel activity. eLife 3, e02772. (25) Morita, S., Kojima, T., and Kitamura, T. (2000) Plat-E: an efficient and stable system for transient packaging of retroviruses. Gene Ther. 7, 1063−1066. (26) Ray, S., and Diamond, B. (1994) Generation of a fusion partner to sample the repertoire of splenic B cells destined for apoptosis. Proc. Natl. Acad. Sci. U. S. A. 91, 5548−5551. (27) Higuchi, R. (1990) Recombinant PCR, In PCR Protocols: A Guide to Methods and Applications, pp 177−188, Academic Press, San Diego. (28) Murai, K., Murakami, H., and Nagata, S. (1998) Myeloidspecific transcriptional activation by murine myeloid zinc finger protein-2. Proc. Natl. Acad. Sci. U. S. A. 95, 3461−3466. (29) Suzuki, J., Denning, D. P., Imanishi, E., Horvitz, H. R., and Nagata, S. (2013) Xk-related protein 8 and CED-8 promote phosphatidylserine exposure in apoptotic cells. Science 341, 403−406. (30) Maruyama, K., Mikawa, T., and Ebashi, S. (1984) Detection of calcium binding proteins by 45Ca autoradiography on nitrocellulose membrane after sodium dodecyl sulfate gel electrophoresis. J. Biochem. 95, 511−519. (31) Sheridan, J. T., Worthington, E. N., Yu, K., Gabriel, S. E., Hartzell, H. C., and Tarran, R. (2011) Characterization of the oligomeric structure of the Ca(2+)-activated Cl− channel Ano1/ TMEM16A. J. Biol. Chem. 286, 1381−1388. (32) Suzuki, T., Suzuki, J., and Nagata, S. (2014) Functional swapping between transmembrane proteins TMEM16A and TMEM16F. J. Biol. Chem. 289, 7438−7447. (33) Terashima, H., Picollo, A., and Accardi, A. (2013) Purified TMEM16A is sufficient to form Ca2+-activated Cl- channels. Proc. Natl. Acad. Sci. U. S. A. 110, 19354−19359. (34) Wittig, I., Braun, H.-P., and Schägger, H. (2006) Blue native PAGE. Nat. Protoc. 1, 418−428. (35) Heuberger, E. H., Veenhoff, L. M., Duurkens, R. H., Friesen, R. H. E., and Poolman, B. (2002) Oligomeric state of membrane transport proteins analyzed with blue native electrophoresis and analytical ultracentrifugation. J. Mol. Biol. 317, 591−600. (36) Skelton, N. J., Kördel, J., Akke, M., Forsén, S., and Chazin, W. J. (1994) Signal transduction versus buffering activity in Ca2+-binding proteins. Nat. Struct. Biol. 1, 239−245. (37) Lee, S. C., Bennett, B. C., Hong, W.-X., Fu, Y., Baker, K. A., Marcoux, J., Robinson, C. V., Ward, A. B., Halpert, J. R., Stevens, R. C., Stout, C. D., Yeager, M. J., and Zhang, Q. (2013) Steroid-based facial amphiphiles for stabilization and crystallization of membrane proteins. Proc. Natl. Acad. Sci. U. S. A. 110, 1203−1211. (38) Schwenk, J., Harmel, N., Brechet, A., Zolles, G., Berkefeld, H., Müller, C. S., Bildl, W., Baehrens, D., Hüber, B., Kulik, A., Klöcker, N., Schulte, U., and Fakler, B. (2012) High-resolution proteomics unravel architecture and molecular diversity of native AMPA receptor complexes. Neuron 74, 621−633. (39) Pidcock, E., and Moore, G. R. (2001) Structural characteristics of protein binding sites for calcium and lanthanide ions. JBIC, J. Biol. Inorg. Chem. 6, 479−489. (40) Pedemonte, N., and Galietta, L. J. V. (2014) Structure and function of TMEM16 proteins (anoctamins). Physiol. Rev. 94, 419− 459. H
DOI: 10.1021/acs.biochem.6b00176 Biochemistry XXXX, XXX, XXX−XXX
Article
Biochemistry (41) Picollo, A., Malvezzi, M., and Accardi, A. (2015) TMEM16 proteins: unknown structure and confusing functions. J. Mol. Biol. 427, 94−105. (42) Bevers, E. M., and Williamson, P. L. (2016) Getting to the Outer Leaflet: Physiology of Phosphatidylserine Exposure at the Plasma Membrane. Physiol. Rev. 96, 605−645. (43) Nagata, S., Suzuki, J., Segawa, K., and Fujii, T. (2016) Exposure of Phosphatidylserine on the Cell Surface. Cell Death Differ. 23, 952− 961. (44) Duran, C., and Hartzell, H. C. (2011) Physiological roles and diseases of tmem16/anoctamin proteins: are they all chloride channels? Acta Pharmacol. Sin. 32, 685−692. (45) Perez-Cornejo, P., Gokhale, A., Duran, C., Cui, Y., Xiao, Q., Hartzell, H. C., and Faundez, V. (2012) Anoctamin 1 (Tmem16A) Ca2+-activated chloride channel stoichiometrically interacts with an ezrin-radixin-moesin network. Proc. Natl. Acad. Sci. U. S. A. 109, 10376−10381. (46) Naaby-Hansen, S., Diekman, A., Shetty, J., Flickinger, C. J., Westbrook, A., and Herr, J. C. (2010) Identification of calciumbinding proteins associated with the human sperm plasma membrane. Reprod. Biol. Endocrinol. 8, 6−12. (47) Watanabe, D., Yamada, K., Nishina, Y., Tajima, Y., Koshimizu, U., Nagata, A., and Nishimune, Y. (1994) Molecular cloning of a novel Ca(2+)-binding protein (calmegin) specifically expressed during male meiotic germ cell development. J. Biol. Chem. 269, 7744−7749. (48) Yu, K., Duran, C., Qu, Z., Cui, Y.-y., and Hartzell, H. C. (2012) Explaining calcium-dependent gating of anoctamin-1 chloride channels requires a revised topology. Circ. Res. 110, 990−999. (49) Segawa, K., Suzuki, J., and Nagata, S. (2011) Constitutive exposure of phosphatidylserine on viable cells. Proc. Natl. Acad. Sci. U. S. A. 108, 19246−19251. (50) Ferrera, L., Caputo, A., Ubby, I., Bussani, E., Zegarra-Moran, O., Ravazzolo, R., Pagani, F., and Galietta, L. (2009) Regulation of TMEM16A chloride channel properties by alternative splicing. J. Biol. Chem. 284, 33360−33368. (51) Xiao, Q., Yu, K., Perez-Cornejo, P., Cui, Y., Arreola, J., and Hartzell, H. C. (2011) Voltage- and calcium-dependent gating of TMEM16A/Ano1 chloride channels are physically coupled by the first intracellular loop. Proc. Natl. Acad. Sci. U. S. A. 108, 8891−8896. (52) Xiao, Q., and Cui, Y. (2014) Acidic amino acids in the first intracellular loop contribute to voltage- and calcium- dependent gating of anoctamin1/TMEM16A. PLoS One 9, e99376.
I
DOI: 10.1021/acs.biochem.6b00176 Biochemistry XXXX, XXX, XXX−XXX
