Role of Water in Netropsin Binding to an A2T2 Hairpin DNA Site

Nov 25, 2013 - Ana María Blanco-Rodríguez , Hana Kvapilová , Jan Sýkora , Michael Towrie , Carlo Nervi , Giorgio Volpi , Stanislav Záliš , and A...
1 downloads 0 Views 886KB Size
Download PDF
Article pubs.acs.org/JPCB

Role of Water in Netropsin Binding to an A2T2 Hairpin DNA Site: Osmotic Stress Experiments Joseph P. Ramos,† Vu H. Le,‡ and Edwin A. Lewis*,‡ †

Department of Chemistry, Georgia State University, Atlanta, Georgia 30302, United States Department of Chemistry, Mississippi State University, Mississippi State, Mississippi 39762, United States

‡

ABSTRACT: The formation of two different minor groove complexes between netropsin and A2T2 DNA has been attributed to specific binding and hydration effects. In this study, we have examined the effect of added osmolyte (e.g., TEG or betaine) on the binding of netropsin to a hairpin DNA, d(CGCGAATTCGCGTC-TCCGCGAATTCGCG)-3, having a single A2T2 binding site. Netropsin binding to this DNA construct is described by a two fractional site model with a saturation stoichiometry of 1:1. Free energy changes, ΔGi, for formation of both complex I and complex II decrease continuously as osmolyte is added (e.g., ΔG1 decreases by 1.3 kcal/mol and ΔG2 decreases by 0.8 kcal/mol in 4 m osmolyte vs buffer). The negative ΔCp values for formation of both complexes, I and II, are largely unaffected by the addition of osmolyte. Formation of complex I is accompanied by the acquisition of 31 water molecules vs 19 waters for complex II. The most significant difference between the two osmolytes is that betaine diminishes the fractional formation of the complex II species, virtually eliminating complex II at 2 m. Addition of osmolyte or a decrease in the temperature have approximately the same effect on DNA hydration and on the thermodynamics of netropsin binding.

■

INTRODUCTION

groove have been a topic of biophysical interest for quite some time.36−49 One approach to gaining a better understanding of the effects of changes in hydration is to alter the physical properties of the solvent, which is accomplished through the use of osmotic pressure and hydrostatic pressure.17,50 Osmotic pressure is applied by using high concentrations of solutes that lower the activity of water. These cosolutes or osmolytes exert osmotic pressure on the waters bound in the vicinity of the DNA minor groove.50 The purpose of this study was to probe the role of water in minor groove binding interactions by determining the thermodynamic profiles for the binding of netropsin to DNA in both the presence and absence of two different osmolytes. Netropsin is a known minor groove binding agent with A-T pair sequence specificity and a preference for binding to A2T2rich regions of the minor groove of duplex DNA. The main focus of the present study has been to determine the influence of two different osmolytes (TEG and betaine) on the thermodynamic profiles for the binding of netropsin to a model DNA construct having a single A2T2 netropsin binding site. These studies have relied heavily on isothermal titration calorimetry (ITC) to provide accurate estimates for the values of the free energy, enthalpy, and entropy changes for formation of the netropsin/hairpin DNA complex. Using this technique,

Water is known to play a significant role in a number of biological interactions. Perhaps the most significant is the importance of the hydrophobic effect and hydrophilic surface contributions to the folding of proteins in solution.1−5 The formation of complexes between small molecules and biopolymersspecifically, proteins and nucleic acidsis obviously accompanied by changes in the hydration (or solvation) of both the free small molecule and biopolymer and the hydrated complex.6−19 It is important to understand specifically how water participates in these interactions. In DNA, there is a primary hydration layer associated with the highly negatively charged phosphate backbone of the nucleic acid. Water is also known to reside in the floor of both the major and minor grooves of duplex DNA. Both of these water DNA interactions, one being the phosphate backbone and the other being the grooves of the DNA, stabilize the overall structure of B-DNA.20−28 Previous studies have shown that a disruption of the solvent cage surrounding a nucleic acid can affect the binding affinity through the entropically favorable disordering of the solvent cage.29−35 Along with the entropic contribution, water can also mediate complexation between small molecules and DNA.6,17 Water has also been demonstrated to influence small molecule/DNA complex formation by allowing molecules to assume the “correct” shape for fitting into a binding site, thus acting as a bridge between the small molecule and nucleic acid.11−13,17−19 Complexes formed between minor groove binding agents and the DNA minor © 2013 American Chemical Society

Received: August 12, 2013 Revised: November 5, 2013 Published: November 25, 2013 15958

dx.doi.org/10.1021/jp408077m | J. Phys. Chem. B 2013, 117, 15958−15965

The Journal of Physical Chemistry B

Article

sequence and a nearest neighbor calculation of the extinction coefficient for the denatured hairpin at 298 K.52 The DNA extinction coefficient determined using this method was ε260 = 2.525 × 105 M−1 cm−1. All netropsin solutions were made using the final DLSHP buffer dialysate as the solvent. Concentrations of the netropsin titrant solutions were nominally 350 μM. The concentration of netropsin was determined using UV/vis spectroscopy and a previously published extinction coefficient of ε296 = 2.15 × 104 M−1 cm−1.53 The change in the hydration of the DNA/netropsin complex vs the hydration of the uncomplexed DNA and netropsin (ΔNw) was determined from the slope of a line calculated from the natural logarithm of the binding constant (Ki) as a function of osmolyte concentration54

we have developed thermodynamic profiles for the two different netropsin minor groove DNA binding interactions that have been observed for binding netropsin to a hairpin, DLSHP, having the sequence 5′-d(CGCGAATTCGCGTCTCCGCGAATTCGCG)-3′. Similar results (i.e. the formation of two different complexes for a single minor groove binder) have been observed for DAPI.19 In the netropsin/DLSHP system, netropsin binding is described by a two fractional site model having a saturation stoichiometry of 1:1 and with the higher affinity site exhibiting a more favorable ΔG by almost −3 kcal/mol and a less favorable ΔH by more than +6 kcal/ mol. By performing osmotic stress experiments (0 to 4 m in added osmolyte) and temperature-dependent experiments (278−318 K), we have determined the changes in hydration that accompany these small-molecule DNA interactions. We discuss the differences in the two netropsin/DLSHP binding interactions in terms of differences in hydration of the two complexes and in terms of water bound at the netropsin DNA interface.

■

■

dln(K i) ΔNw =− d[osmolal] 55.6

(1)

RESULTS We had previously determined that the binding of netropsin to the DLSHP was best described by a model in which netropsin binds in the DNA minor groove in two different orientations or in some manner forms two different complexes.18,19,55,56 This fractional two-mode model is consistent with the observation that even though a single netropsin molecule binds to the A2T2 site in the DLSHP, there are two fractional reactions having different free energy and different enthalpy changes for complex formation. The formation of the complex II was shown in the previous studies to exhibit a lower K at all temperatures (K2 < K1) with the changes in ΔG and ΔH between complex I and complex II corresponding to the energetics of trapping one water molecule between the bound netropsin and the floor of the DNA minor groove in complex II.18,55,56 The following two equations define the two different pathways for binding netropsin in the minor groove, resulting in two different products with complex II having some trapped or bound water (b). Formation of complex I:

MATERIALS AND METHODS Materials. The double long-stem hairpin (DLSHP) oligonucleotide was obtained from Oligos Etc. (Winsville, OR). The DLSHP oligonucleotide is 28 bases long and has the following the sequence: 5′-d(CGCGAATTCGCGTCTCCGCGAATTCGCG)-3′. This oligonucleotide spontaneously folds into a stable hairpin construct with the A2T2 netropsin binding site located midway up the hairpin stem. The oligonucleotide solutions were prepared by dissolution of the oligonucleotide in MES buffer (0.01 M MES, 0.001 M EDTA, 0.02 M NaCl, pH 6.2). The osmolytes, betaine and triethylene glycol (TEG), were purchased from Sigma-Aldrich (St. Louis, MO) and were used without further purification. Osmolyte (i.e., betaine or TEG) solution concentrations were prepared by weight to achieve nominal osmolyte concentrations of 0.5, 1.0, 2.0, or 4.0 m. Netropsin was obtained from Sigma-Aldrich (St. Louis, MO), and dilute netropsin solutions were prepared by dissolution of netropsin in the dialysate obtained from exhaustive dialysis of the oligonucleotide solutions. The final osmolyte concentrations in the netropsin titrant and oligonucleotide titrate solutions were determined using a model 5560 Wescor vapor pressure osmometer (Logan, UT). Isothermal Titration Calorimetry. ITC experiments were carried out using a Microcal VP-ITC (Northhampton, MA). Titrations were done at temperatures from 278 to 318 K. Titrations involved overfilling the sample cell with ∼1.5 mL of the diluted DNA solution and adding as many as 57 injections of the dilute netropsin solution. The injection volume was nominally 5 μL. The thermograms obtained from the ITC experiments were fit using the CHASM data analysis program developed in our lab.51 ITC thermograms were fit with our “two-fractional-sites” binding model and a nonlinear regression algorithm developed in MATLAB (The MathWorks, Natick, MA). The best fit parameters ΔG1 (K1), ΔG2 (K2), ΔH1, ΔH2, −TΔS1, −TΔS2, n1, and n2 for the titration of netropsin into the DLSHP are reported in the results section below. The changes in heat capacity (ΔCp1 and ΔCp2) for formation of complexes I and II in 4 m osmolyte were obtained from the slope of ΔH plotted vs T using a simple linear regression model. Oligonucleotide concentrations for ITC experimentations were nominally 20 μM. The concentrations for all DNA solutions were verified using UV/vis spectroscopy. The DNA extinction coefficient was determined from the DLSHP

HP ·(H 2O)x + D ·(H 2O)y ↔ HP ·D ·(H 2O)z K1 = (HP ·D)/(HP)(D)

(3)

Formation of complex II: HP ·(H 2O)x + D ·(H 2O)y + b(H 2O) ↔ HP ·(H 2O)b ·D·(H 2O)w K 2 = (HP ·H 2O·D)/(HP)(D)(H 2O)b

(4)

In these equations, HP·(H2O)x represents the hydrated DNA hairpin, D·(H2O)y represents the hydrated netropsin, HP·D· (H2O)z represents the hydrated complex I, and HP· (H2O)b·D· (H2O)w represents the netropsin/DNA complex II having both (w) waters of hydration (H2O)w, and (b) bound waters (H2O)b. The only difference between the two reactions is that the second includes water as a reactant. K1 and K2 are the equilibrium constants for formation of complex I and complex II respectively, and x, y, z, and w are the waters of hydration and b is the number of trapped water molecules in complex II. The osmotic stress experiments described here employed two different osmolytes, betaine and TEG. Although the generic osmolyte effects for these two cosolutes would be 15959

dx.doi.org/10.1021/jp408077m | J. Phys. Chem. B 2013, 117, 15958−15965

The Journal of Physical Chemistry B

Article

Figure 1. Representative nonlinear regression fits of the ITC-integrated heat data for binding netropsin to the A2T2 site of DLSHP in the presence of osmolyte concentrations ranging from 0.0 to 4.0 m of (A) betaine and (B) TEG at 298 K (25 °C), (0 m, -•-; 0.5 m, -▼-; 1.0 m, -■-; 4.0 m, -▲-). The fits are shown as solid lines for the “two-fractional sites” model described by equations eq 3 and eq 4. This model is represented by two fractional sites that are constrained to have a combined stoichiometry of 1.0 mol of ligand/mol of DNA. Fits were obtained using the CHASM data analysis program developed in our laboratory.51

Table 1. ITC-Derived Thermodynamic Parameters, ΔGi, ΔHi, and −TΔSi for the DLSHP Construct Binding Netropsin in MES buffera at a Range of Concentrations from 0 to 4 m for Both Betaine and TEG at 298 K osmolyte

(m)

betaine

0.5 1 4 0.5 1 4 0

TEG

none a

ΔG1 (kcal/mol) −11 −10.6 −9.6 −10.7 −10.4 −9.7 −11

± ± ± ± ± ± ±

0.03 0.04 0.07 0.02 0.02 0.05 0.03

ΔG2 (kcal/mol) −8.8 ± 0.04 −8.3 ± 0.05 −8.1 −8.1 −7.8 −8.6

± ± ± ±

0.01 0.02 0.02 0.04

ΔH1 (kcal/mol) −9.0 −8.3 −11.7 −6.6 −7.2 −6.6 −7.0

± ± ± ± ± ± ±

0.1 0.2 0.1 0.1 0.2 0.1 0.2

ΔH2 (kcal/mol)

−TΔS1 (kcal/mol)

−TΔS2 (kcal/mol)

−15.4 ± 0.1 −16.8 ± 0.3

−2.0 −2.3 2.1 −4.1 −3.2 −3.1 −4.0

6.6 8.5

−18.5 −19.9 −22.9 −13.6

± ± ± ±

0.2 0.4 0.4 0.2

10.4 11.8 15.1 5.0

0.1 M MES, 0.001 M EDTA, 0.02 M NaCl, pH 6.2.

The thermodynamic parameters determined for netropsin binding to DLSHP in 0−4 m betaine are summarized in Table 1. Increasing betaine concentrations result in a linear decrease in K1 and K2. Both ΔH1 and ΔH2 become increasingly more exothermic with increasing betaine concentration. Betaine dramatically influences the values of both ΔH1 and ΔH2, with the changes in the corresponding −TΔSi values compensating the changes in the enthalpy term to a large degree. Betaine progressively reduces the fraction of netropsin bound as the complex II species, with the complex II species virtually eliminated at betaine concentrations >2 m.55 At lower betaine concentrations, the thermograms are fit within experimental error using the “two fractional sites” model, with the total stoichiometry being 1:1. At zero added betaine, the relative stoichiometries for complexes I and II (at 298 K) are 0.7:1 and 0.3:1, respectively. As the betaine concentration is increased to concentrations above 2 m, the stoichiometric ratios become 1:1 and 0:1 (again, at 298 K for complexes I and II, respectively). The thermodynamic parameters determined for binding netropsin to DLSHP in 0−4 m TEG are summarized in Table 1. Increasing concentrations of TEG result in a linear decrease in K1 and K2. This result is similar to that produced by betaine. In contrast to the betaine result, ΔH1 is largely unaffected by the addition of TEG; however, values of ΔH2 become even more exothermic in TEG-containing solutions. Again, the changes brought about by TEG for both ΔH1 and ΔH2 are largely compensated for by corresponding changes in the −TΔS terms. The relative amounts of complex I and complex II do not change with increasing concentrations of TEG.

expected to be the same, there are, however, subtle differences in the effects of betaine and TEG on netropsin binding to DNA. The shape of the ITC titration curves for binding netropsin to the DLSHP in the presence of betaine are different from the titration curves observed in the absence of the osmolyte and are dependent on the betaine concentration. Typical ITC titration curves for the binding of netropsin to DLSHP obtained at 298 K and for betaine concentrations of from 0 to 4 m betaine are shown in Figure 1A, whereas typical ITC titration curves for the binding of netropsin to DLSHP obtained at 298 K and for TEG concentrations of from 0 to 4 m TEG are shown in Figure 1B. The thermogram for the titration of DLSHP with netropsin in buffer clearly shows two regions, a linear region at low molar ratios of added drug and a curved region at high drug molar ratios where the formation of complex II becomes significant. The thermograms in both betaine and TEG show the same general trends in that as the osmolyte concentration is increased, the curved region becomes less pronounced. In 4 m betaine, there is only a single complex species evident in the titration. In 4 m TEG, the curved region of the thermogram, although not lost, is significantly depressed. In 4 m TEG, it seems clear that complex I is the major species being formed (ΔH4mTEG = −6.6 kcal/mol ≈ ΔH1,buffer = −7.0 kcal/mol). In comparison, the 4 m betaine results, in which only one complex species is formed with an intermediate ΔH value (ΔH4mbetaine = −11.7 kcal/mol ≠ ΔH1,buffer = −7.0 kcal/mol), are less clear as to whether the predominant species is complex I or complex II. On the basis of the comparison ΔH values, it seems more likely that the netropsin/DNA species formed in 4 m betaine is more similar to complex I than to complex II. 15960

dx.doi.org/10.1021/jp408077m | J. Phys. Chem. B 2013, 117, 15958−15965

The Journal of Physical Chemistry B

Article

Figure 2. Representative nonlinear regression fits of the ITC-integrated heat data for binding netropsin to the A2T2 containing construct DLSHP in the presence of (A) 4.0 m betaine and (B) 4.0 m TEG at temperatures ranging from 278 to 318 K, (278 K, -•-; 288 K, -▼-; 298 K, -■-; 310 K, -▲-; 318 K, -⧫-). The fits are shown as solid lines for the “two-fractional sites” model described by equations eq 3 and eq 4. This model is represented by two fractional sites that are constrained to have a combined stoichiometry of 1.0 mol of ligand/mol of DNA. Fits were obtained using the CHASM data analysis program developed in our laboratory.51

Table 2. ITC-Derived Thermodynamic Parameters, ΔGi, ΔHi, and -TΔSi, for the DLSHP Construct Binding Netropsin in Both 4.0 m Betaine and TEG MES Buffersa at a Range of Temperatures from 278 to 318 K osmolyte (∼ 4m)

temp (K)

betaine

278 288 298 310 318 278 288 298 310 318

TEG

a

ΔG1 (kcal/mol) −9.3 −9.3 −9.6 −11.0 −10.9 −8.6 −9.5 −9.7 −11.4 −10.2

± ± ± ± ± ± ± ± ± ±

0.1 0.1 0.2 0.2 0.3 0.2 0.2 0.2 0.2 0.2

ΔG2 (kcal/mol)

−8.4 ± 0.2 −8.3 ± 0.2 −7.6 −7.8 −8.7 −8.1

± ± ± ±

0.2 0.2 0.2 0.2

ΔH1 (kcal/mol) −6.5 −10.0 −11.7 −13.9 −15.4 −7.2 −7.5 −6.6 −8.8 −12.5

± ± ± ± ± ± ± ± ± ±

0.3 0.1 0.1 0.1 0.2 0.2 0.1 0.1 0.1 0.2

ΔH2 (kcal/mol)

−26.6 ± 0.2 −37.1 ± 0.5 −19.7 −22.9 −32.6 −40.3

± ± ± ±

0.3 0.2 0.3 0.4

−TΔS1 (kcal/mol) −2.9 0.7 2.1 2.9 4.6 −1.4 −2.1 −3.1 −2.6 2.3

−TΔS2 (kcal/mol)

18.2 28.8 12.1 15.1 23.9 32.1

4.0 m betaine or 4.0 m TEG, 0.1 M MES, 0.001 M EDTA, 0.02 M NaCl, pH 6.2.

Figure 3. Temperature dependence of the enthalpy change, ΔH1 or ΔH2, for netropsin binding to the −AATT-containing DLSHP in the presence of (A) 4.0 m betaine and (B) 4.0 m TEG. Enthalpy change of the first binding mode, ΔH1 (-■-) demonstrates a linear dependence of the enthalpy change on the temperature over the entire measurement range (278−318 K). In panel A, the second binding mode (-▲-) is not observed in 4 m betaine below 37 °C (310 K) but a much larger ΔCp2 term is noted as the steeper slope for the ΔH2 in 4 m betaine. In panel B, enthalpy change of the second binding mode, ΔH2 (-▲-), exhibits two linear regions, with a break in the slope occurring at ∼301 K in 4.0 m TEG. The intercept between two dashed lines indicated the break in heat capacity occurred 303 K observed in our previous temperature study.55

318 K. The stoichiometry at temperatures from 278 to 298 K (5−25 °C) is 1:1 for complex I formation. Again, complex II formation is not seen at these temperatures. At 310 and 318 K (37 and 45 °C), the relative stoichiometry is closer to 0.8:1 and 0.2:1 for complex 1 and complex II formation, respectively. Increasing the temperature is equivalent in these experiments to decreasing the betaine concentration. Typical ITC titration

Typical ITC titration curves for the binding of netropsin to DLSHP at a betaine concentration of 4 m and at temperatures ranging from 278 to 318 K (5−45 °C) are shown in Figure 2A. The average thermodynamic parameters for binding netropsin to DLSHP under these conditions are summarized in Table 2. Complex II formation is not seen at or below 298 K (25 °C). However, complex II formation reappears at 310 and 15961

dx.doi.org/10.1021/jp408077m | J. Phys. Chem. B 2013, 117, 15958−15965

The Journal of Physical Chemistry B

Article

curves for netropsin binding to DLSHP at a TEG concentration of 4 m and at temperatures ranging from 278 to 318 K are given in Figure 2B. The average thermodynamic parameters determined for binding netropsin to DLSHP under these conditions are also summarized in Table 2. Formation of the complex II species is observed at all temperatures above 278 K. The stoichiometry for complex I formation at 278 K (5 °C) is 1:1, and complex II formation is not seen at this temperature. The stoichiometries for formation of complexes I and II are approximately constant at all temperatures from 288 to 318 K (15 to 45 °C), with the stoichiometric ratios ranging from ∼0.9:1 to 0.7:1 for complex I and 0.1:1 to 0.3:1 for complex II. Again, increasing the temperature results in the formation of more complex II (equivalent to lowering the osmolyte concentration). In addition, both ΔH1 and ΔH2 become significantly more exothermic as the temperature is increased in either betaine or TEG. The temperature dependence of the enthalpy change, ΔH, for netropsin binding to the DLSHP construct in the presence of 4.0 m betaine is shown in Figure 3A. The enthalpy change for the first binding mode, ΔH1, exhibits a linear dependence on temperature over the measurement range of 278−318 K. The slope of the linear regression line shown corresponds to a global fit line with a slope of ΔCp1 = −0.21 kcal mol−1 K−1. The second binding mode is not observed at temperatures below 310 K in 4 m betaine. Complex II formation (observed at temperatures equal to or above 310 K) is accompanied by a significantly larger heat capacity change, ΔCp2 = −1.31 kcal mol−1 K−1. Both ΔCp1 and ΔCp2 are very similar to the values observed previously in water (ΔCp1 = −0.19 kcal mol−1 K−1 and ΔCp2 = −0.98 kcal mol−1 K−1).55 Since complex II was not observed at temperatures below 300 K, any possible break in the heat capacity curve for complex II is not accessible. The temperature dependence of the enthalpy change for netropsin binding to the DLSHP construct in the presence of 4.0 m TEG is shown in Figure 3B. The first binding mode demonstrates a linear dependence of the enthalpy change on the temperature over the measurement range of 278−318 K. The slope of the linear regression line shown corresponds to a global fit line with a slope of ΔCp1 = −0.10 kcal mol−1 K−1. In 4 m TEG, the second binding mode is also observed throughout the measurement temperature range (above 278 K); however, the plot of ΔH2 vs T consists of two linear regions having different slopes, with an apparent break point between the two linear regions at ∼300 K. The slopes of the linear regression lines for the two linear segments are ΔCp2 = −0.32 kcal mol−1 K−1 for temperatures at or below ∼300 K and ΔCp2 = −0.96 kcal mol−1 K−1 for temperatures above 298 K. With the exception of the slightly lower break temperature (300 vs 303 K), all of the ΔCp data for the TEG solutions are in excellent agreement with the water experiments. Wherever complex II formation is observed, a break is observed in the heat capacity change function at or near the isoequilibrium temperature for water.31 The equilibrium constants for both the first and second binding modes decrease as the concentration of osmolyte is increased, suggesting that there are more waters associated with the complex than with the uncomplexed DNA and netropsin.54 A plot of ln Ki vs osmolyte concentration and the linear regression lines for formation of complexes I and II is given in Figure 4. The change in hydration for formation of complex I is 31 ± 2 water molecules, and the change in hydration for formation of

Figure 4. Plot of natural log of equilibrium constants for the binding of Netropsin to DLSHP as a function of the concentrations of betaine (▲) and TEG (■). The solid line is a linear regression for the equilibrium constants of the first binding mode (K1). The dashed line is a linear regression for the equilibrium constants of the second binding mode (K2). Linear least-squares fit using equation eq 1 gives 31 ± 2 water molecules for the first binding mode and 19 ± 6 water molecules for the second binding mode.

complex II is 19 ± 6 water molecules. These changes in hydration as measured by the osmotic stress method are the same for both betaine and TEG. The change in hydration measured here for formation of complex I (31 ± 2 water molecules) is in excellent agreement with the change in change in hydration (26 ± 3 water molecules) reported by Degtyareva et al. for the binding of netropsin to a duplex DNA (5′CGCGCAATTGCGCG-3′)2 construct having a single A2T2 binding site.57 The osmotic stress experiments of Degtyareva et al. were more extensive and used four different osmolytes (acetamide, betaine, triethylene glycol, and trimethylamine Noxide) covering the range of 0.0−3.0 osmolal at 0.5 osmolal increments. The principal difference between the osmotic stress experiments of Degtyareva et al. was that netropsin forms only a single complex, complex I, with its duplex DNA construct.

■

DISCUSSION The minor groove interactions between netropsin and an AATT sequence within a hairpin (or other A2T2 containing duplex construct) are obviously much more complicated than previously thought. We had previously published studies describing the fact that two different binding modes are present and that the differences in thermodynamics, including heat capacity changes, point to a weaker binding mode in which one or more water molecules are trapped between the bound netropsin molecule (in a more linear conformation) and the floor of the DNA minor groove.18,55 Degtyareva et al. has more recently confirmed these results and demonstrated that a subtle change in the base sequences flanking the A2T2 site can eliminate the weaker binding mode.58 In an attempt to further explore the role of water in these binding processes, we repeated some of our earlier work55 as a function of osmolyte concentration. If the osmolyte effect is primarily due to reduced water activity, we would predict that at lower temperatures or at higher osmolyte concentrations, the formation of complex II (with bound or trapped water) would be decreased or even eliminated. The betaine results follow this expected trend: as the osmolyte concentration is increased, the amount of complex II formed is first decreased and then eliminated at ∼2 m. This betaine effect can be reversed by increasing the temperature. For example, complex II formation is observed in 4 m betaine at 310 K (but not at 298 K). The effect of TEG is similar, although somewhat weaker. At 298 K, complex II formation is observed even in 4 m TEG; however, 15962

dx.doi.org/10.1021/jp408077m | J. Phys. Chem. B 2013, 117, 15958−15965

The Journal of Physical Chemistry B

Article

complex II is eliminated in 4 m TEG at 278 K. Both osmolytes result in a decreased netropsin affinity for binding to the A2T2 HP site (ΔG1 is decreased in both 4 m betaine and 4 m TEG by approximately 1.4 kcal/mol, and ΔG2 is changed by as much as 0.8 kcal/mol in 4 m TEG). The thermodynamic profiles for the binding of netropsin to DNA in the presence and the absence of two different osmolytes and as a function of temperature and, in particular, the trends in the free energy, enthalpy, and entropy changes must have a common explanation. The explanation must stem at least in part from an understanding of the DNA hydration and changes in DNA hydration that accompany the binding of the netropsin molecule in the minor groove. The fact that there are fewer waters associated with complex II than complex I suggests that in complex I, netropsin may be buried more deeply in the minor groove and that more waters are required to form the complex I solvation shell. The higher affinity of the complex I interaction must result from the closer contact between netropsin and the minor groove floor. In the case of complex I formation, the high netropsin affinity results from very favorable ΔH and −TΔS terms. Betaine (4 m) results in a significantly more favorable ΔH1 and a significantly less favorable −TΔS1 term in comparison with the values for these same parameters in the absence of osmolyte or even in the presence of TEG. The value for the ΔH1 term in 4 m betaine (−11.7 kcal/mol) is more favorable than the value in buffer (−7.0 kcal/mol) and also more favorable than the value in 4 m TEG (−6.6 kcal/mol). The value for the −TΔS1 term in 4 m betaine is more unfavorable (+2.1 kcal/mol) than the value for the −TΔS1 term in buffer (−4.0 kcal/mol), whereas the value for the −TΔS1 term in 4 m TEG (−3.1 kcal/mol) is only slightly less favorable than the −TΔS1 term in buffer. In the case of complex II formation, the ΔH2 term is even more favorable than the ΔH1 term for complex I formation; however, enthalpy changes for complex II formation in either TEG or betaine are universally opposed by large unfavorable −TΔS terms. Apparently, in forming complex II, the cost of trapping water or binding netropsin in the alternative orientation is mostly entropic. In general, the thermodynamic profiles and trends observed here are consistent with (1) a thermodynamic binding model having two competitive binding modes for netropsin placement in the DNA minor groove, (2) a weaker binding mode that is energetically equivalent to a process wherein one or more water molecules are trapped between the netropsin molecule and the DNA groove floor, and (3) a reduction in the amount of complex II that is formed when the activity of water is reduced (i.e., brought about by lower temperatures or high osmolyte concentrations). The differences in the energetics for formation of complexes I and II are consistent with a larger cost in the free energy change for trapping water from betaine solutions than for trapping water from TEG solutions. Betaine increases the solvent dielectric constant and weakens the hydrogen bonding between the negatively charged DNA phosphodiester oxygen and spine water molecules. The result is that there is lower enthalpy cost to expel this water as netropsin binds, producing a concomitantly more favorable enthalpy change for binding. The more loosely bound water is high-entropy water, and there is a less favorable entropy change for the release of the DNA bound water in betaine solutions. Exactly the opposite is true for the concentrated TEG solutions in which the lower dielectric constant must result in more tightly bound water. A more rigorous analysis of these data would require a more exact description of the DNA hydrated structure, for example,

knowledge of the minor groove width and depth in these solutions or complexes.

■

CONCLUSIONS In conclusion, the data gathered in this study are consistent with those from previous studies. All evidence suggests the presence of two different modes for the interaction of netropsin with the A2T2 site in DLSHP. The energetics of complex II formation are consistent with the idea that this complex species includes one or more “trapped” water molecules. The osmolyte results have provided further evidence for this trapped water but have also provided new insight into the organization of water in the vicinity of the DNA minor groove.

■

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. Notes

The authors declare no competing financial interest.

■

REFERENCES

(1) Tanford, C. The hydrophobic effect and the organization of living matter. Science 1978, 200, 1012−1018. (2) Rose, G. D.; Geselowitz, A. R.; Lesser, G. J.; Lee, R. H.; Zehfus, M. H. Hydrophobicity of amino acid residues in globular proteins. Science 1985, 229, 834−838. (3) Onuchic, J. N.; Luthey-Schulten, Z.; Wolynes, P. G. Theory of protein folding: the energy landscape perspective. Annu. Rev. Phys. Chem. 1997, 48, 545−600. (4) Huang, D. M.; Chandler, D. Temperature and length scale dependence of hydrophobic effects and their possible implications for protein folding. Proc. Natl. Acad. Sci. U.S.A. 2000, 97, 8324−8327. (5) Semisotnov, G. V.; Rodionova, N. A.; Razgulyaev, O. I.; Uversky, V. N.; Gripas, A. F.; Gilmanshin, R. I. Study of the “molten globule” intermediate state in protein folding by a hydrophobic fluorescent probe. Biopolymers 1991, 31, 119−128. (6) Ladbury, J. E. Just add water! The effect of water on the specificity of protein−ligand binding sites and its potential application to drug design. Chem. Biol. 1996, 3, 973−980. (7) Swaminathan, C. P.; Surolia, N.; Surolia, A. Role of Water in the Specific Binding of Mannose and Mannooligosaccharides to Concanavalin A. J. Am. Chem. Soc. 1998, 120, 5153−5159. (8) Holdgate, G. A.; Tunnicliffe, A.; Ward, W. H.; Weston, S. A.; Rosenbrock, G.; Barth, P. T.; Taylor, I. W.; Pauptit, R. A.; Timms, D. The entropic penalty of ordered water accounts for weaker binding of the antibiotic novobiocin to a resistant mutant of DNA gyrase: a thermodynamic and crystallographic study. Biochemistry 1997, 36, 9663−9673. (9) Courtenay, E. S.; Capp, M. W.; Anderson, C. F.; Record, M. T., Jr. Vapor pressure osmometry studies of osmolyte−protein interactions: implications for the action of osmoprotectants in vivo and for the interpretation of “osmotic stress” experiments in vitro. Biochemistry 2000, 39, 4455−4471. (10) Schwabe, J. W. The role of water in protein−DNA interactions. Curr. Opin. Struct. Biol. 1997, 7, 126−134. (11) Pal, S. K.; Zhao, L.; Zewail, A. H. Water at DNA surfaces: ultrafast dynamics in minor groove recognition. Proc. Natl. Acad. Sci. U.S.A. 2003, 100, 8113−8118. (12) Bailly, C.; Chessari, G.; Carrasco, C.; Joubert, A.; Mann, J.; Wilson, W. D.; Neidle, S. Sequence-specific minor groove binding by bis-benzimidazoles: water molecules in ligand recognition. Nucleic Acids Res. 2003, 31, 1514−1524. (13) Breusegem, S. Y.; Sadat-Ebrahimi, S. E.; Douglas, K. T.; Bichenkova, E. V.; Clegg, R. M.; Loontiens, F. G. Experimental precedent for the need to involve the primary hydration layer of DNA in lead drug design. J. Med. Chem. 2001, 44, 2503−2506. 15963

dx.doi.org/10.1021/jp408077m | J. Phys. Chem. B 2013, 117, 15958−15965

The Journal of Physical Chemistry B

Article

(14) Bergqvist, S.; Williams, M. A.; O’Brien, R.; Ladbury, J. E. Heat capacity effects of water molecules and ions at a protein−DNA interface. J. Mol. Biol. 2004, 336, 829−842. (15) Jayaram, B.; Jain, T. The role of water in protein−DNA recognition. Annu. Rev. Biophys. Biomol. Struct. 2004, 33, 343−361. (16) Williams, H. E.; Searle, M. S. Structure, dynamics and hydration of the nogalamycin-d(ATGCAT)2 Complex determined by NMR and molecular dynamics simulations in solution. J. Mol. Biol. 1999, 290, 699−716. (17) Kiser, J. R.; Monk, R. W.; Smalls, R. L.; Petty, J. T. Hydration changes in the association of Hoechst 33258 with DNA. Biochemistry 2005, 44, 16988−16997. (18) Freyer, M. W.; Buscaglia, R.; Cashman, D.; Hyslop, S.; Wilson, W. D.; Chaires, J. B.; Lewis, E. A. Binding of netropsin to several DNA constructs: evidence for at least two different 1:1 complexes formed from an −AATT-containing ds-DNA construct and a single minor groove binding ligand. Biophys. Chem. 2007, 126, 186−196. (19) Freyer, M. W.; Buscaglia, R.; Nguyen, B.; Wilson, W. D.; Lewis, E. A. Binding of netropsin and 4,6-diamidino-2-phenylindole to an A2T2 DNA hairpin: a comparison of biophysical techniques. Anal. Biochem. 2006, 355, 259−266. (20) Drew, H. R.; Dickerson, R. E. Structure of a B-DNA dodecamer. III. Geometry of hydration. J. Mol. Biol. 1981, 151, 535−556. (21) Pal, S. K.; Zewail, A. H. Dynamics of water in biological recognition. Chem. Rev. 2004, 104, 2099−2123. (22) Chalikian, T. V.; Breslauer, K. J. Volumetric properties of nucleic acids. Biopolymers 1998, 48, 264−280. (23) Tereshko, V.; Minasov, G.; Egli, M. A “hydrat-ion” spine in a BDNA minor groove. J. Am. Chem. Soc. 1999, 121, 3590−3595. (24) Hamelberg, D.; Williams, L. D.; Wilson, W. D. Effect of a neutralized phosphate backbone on the minor groove of B-DNA: molecular dynamics simulation studies. Nucleic Acids Res. 2002, 30, 3615−3623. (25) Liepinsh, E.; Leupin, W.; Otting, G. Hydration of DNA in aqueous solution: NMR evidence for a kinetic destabilization of the minor groove hydration of d-(TTAA)2 versus d-(AATT)2 segments. Nucleic Acids Res. 1994, 22, 2249−2254. (26) Hamelberg, D.; Williams, L. D.; Wilson, W. D. Influence of the dynamic positions of cations on the structure of the DNA minor groove: sequence-dependent effects. J. Am. Chem. Soc. 2001, 123, 7745−7755. (27) Westhof, E. Water: an integral part of nucleic acid structure. Annu. Rev. Biophys. Biophys. Chem. 1988, 17, 125−144. (28) Young, M. A.; Jayaram, B.; Beveridge, D. L. Intrusion of counterions into the spine of hydration in the minor groove of BDNA: fractional occupancy of electronegative pockets. J. Am. Chem. Soc. 1997, 119, 59−69. (29) Haq, I. Thermodynamics of drug-DNA interactions. Arch. Biochem. Biophys. 2002, 403, 1−15. (30) Cooper, A.; Johnson, C. M.; Lakey, J. H.; Nöllmann, M. Heat does not come in different colours: entropy-enthalpy compensation, free energy windows, quantum confinement, pressure perturbation calorimetry, solvation and the multiple causes of heat capacity effects in biomolecular interactions. Biophys. Chem. 2001, 93, 215−230. (31) Dunitz, J. D. Win some, lose some: enthalpy−entropy compensation in weak intermolecular interactions. Chem. Biol. 1995, 2, 709−712. (32) Chervenak, M. C.; Toone, E. J. A direct measure of the contribution of solvent reorganization to the enthalpy of ligand binding. J. Am. Chem. Soc. 1994, 116, 10533−10539. (33) Chaires, J. B. A thermodynamic signature for drug-DNA binding mode. Arch. Biochem. Biophys. 2006, 453, 26−31. (34) Hyun, K. M.; Choi, S. D.; Lee, S.; Kim, S. K. Can energy transfer be an indicator for DNA intercalation? Biochim. Biophys. Acta 1997, 1334, 312−316. (35) Chaires, J. B. Analysis and interpretation of ligand-DNA binding isotherms. Methods. Enzymol. 2001, 340, 3−22.

(36) Zimmer, C. Effects of the antibiotics netropsin and distamycin A on the structure and function of nucleic acids. Prog. Nucleic Acid Res. Mol. Biol. 1975, 15, 285−318. (37) Luck, G.; Triebel, H.; Waring, M.; Zimmer, C. Conformation dependent binding of netropsin and distamycin to DNA and DNA model polymers. Nucleic Acids Res. 1974, 1, 503−530. (38) Pilch, D. S.; Kirolos, M. A.; Liu, X.; Plum, G. E.; Breslauer, K. J. Berenil (1,3-bis(4′-amidinophenyl)triazene) binding to DNA duplexes and to a RNA duplex: evidence for both intercalative and minor groove binding properties. Biochemistry 1995, 34, 9962−9976. (39) Sriram, M.; van der Marel, G. A.; Roelen, H. L.; van Boom, J. H.; Wang, A. H. Structural consequences of a carcinogenic alkylation lesion on DNA: effect of O6-ethylguanine on the molecular structure of the d(CGC(e6G)AATTCGCG)-netropsin complex. Biochemistry 1992, 31, 11823−11834. (40) Coll, M.; Aymami, J.; van der Marel, G. A.; van Boom, J. H.; Rich, A.; Wang, A. H. Molecular structure of the netropsind(CGCGATATCGCG) complex: DNA conformation in an alternating AT segment. Biochemistry 1989, 28, 310−320. (41) Kopka, M. L.; Yoon, C.; Goodsell, D.; Pjura, P.; Dickerson, R. E. The molecular origin of DNA-drug specificity in netropsin and distamycin. Proc. Natl. Acad. Sci. U.S.A. 1985, 82, 1376−1380. (42) Goodsell, D. S.; Kopka, M. L.; Dickerson, R. E. Refinement of netropsin bound to DNA: bias and feedback in electron density map interpretation. Biochemistry 1995, 34, 4983−4993. (43) Wang, L.; Kumar, A.; Boykin, D. W.; Bailly, C.; Wilson, W. D. Comparative thermodynamics for monomer and dimer sequencedependent binding of a heterocyclic dication in the DNA minor groove. J. Mol. Biol. 2002, 317, 361−374. (44) Marky, L. A.; Breslauer, K. J. Origins of netropsin binding affinity and specificity: correlations of thermodynamic and structural data. Proc. Natl. Acad. Sci. U.S.A. 1987, 84, 4359−4363. (45) Patel, D. J. Antibiotic−DNA interactions: intermolecular nuclear Overhauser effects in the netropsin−d(C-G-C-G-A-A-T-T-C-G-C-G) complex in solution. Proc. Natl. Acad. Sci. U.S.A. 1982, 79, 6424−6428. (46) Nguyen, B.; Hamelberg, D.; Bailly, C.; Colson, P.; Stanek, J.; Brun, R.; Neidle, S.; Wilson, W. D. Characterization of a novel DNA minor-groove complex. Biophys. J. 2004, 86, 1028−1041. (47) Neidle, S. DNA minor-groove recognition by small molecules. Nat. Prod. Rep. 2001, 18, 291−309. (48) Haq, I.; Ladbury, J. E.; Chowdhry, B. Z.; Jenkins, T. C.; Chaires, J. B. Specific binding of hoechst 33258 to the d(CGCAAATTTGCG)2 duplex: calorimetric and spectroscopic studies. J. Mol. Biol. 1997, 271, 244−257. (49) Wartell, R. M.; Larson, J. E.; Wells, R. D. Netropsin. A specific probe for A-T regions of duplex deoxyribonucleic acid. J. Biol. Chem. 1974, 249, 6719−6731. (50) Robinson, C. R.; Sligar, S. G. Hydrostatic and osmotic pressure as tools to study macromolecular recognition. Methods. Enzymol. 1995, 259, 395−427. (51) Le, V. H.; Buscaglia, R.; Chaires, J. B.; Lewis, E. A. Modeling Complex Equilibria in ITC Experiments: Thermodynamic Parameters Estimation for a Three Binding Site Model. Anal. Biochem. 2012, 434, 233−241. (52) Cantor, C. R.; Warshaw, M. M.; Shapiro, H. Oligonucleotide interactions. 3. Circular dichroism studies of the conformation of deoxyoligonucleotides. Biopolymers 1970, 9, 1059−77. (53) Tanious, F. A.; Wilson, W. D.; Patrick, D. A.; Tidwell, R. R.; Colson, P.; Houssier, C.; Tardy, C.; Bailly, C. Sequence-dependent binding of bis-amidine carbazole dications to DNA. Eur. J. Biochem. 2001, 268, 3455−3464. (54) Parsegian, V. A.; Rand, R. P.; Rau, D. C. Macromolecules and water: probing with osmotic stress. Methods Enzymol. 1995, 259, 43− 94. (55) Freyer, M. W.; Buscaglia, R.; Hollingsworth, A.; Ramos, J.; Blynn, M.; Pratt, R.; Wilson, W. D.; Lewis, E. A. Break in the heat capacity change at 303 K for complex binding of netropsin to AATT containing hairpin DNA constructs. Biophys. J. 2007, 92, 2516−2522. 15964

dx.doi.org/10.1021/jp408077m | J. Phys. Chem. B 2013, 117, 15958−15965

The Journal of Physical Chemistry B

Article

(56) Lewis, E. A.; Munde, M.; Wang, S.; Rettig, M.; Le, V.; Machha, V.; Wilson, W. D. Complexity in the binding of minor groove agents: netropsin has two thermodynamically different DNA binding modes at a single site. Nucleic Acids Res. 2011, 39, 9649−9658. (57) Degtyareva, N. N.; Wallace, B. D.; Bryant, A. R.; Loo, K. M.; Petty, J. T. Hydration changes accompanying the binding of minor groove ligands with DNA. Biophysics 2007, 92, 959−965. (58) Degtyareva, N. N.; Fresia, M. J.; Petty, J. T. DNA conformational effects on the interaction of netropsin with a-tract sequences. Biochemistry 2007, 46, 15136−15143.

15965

dx.doi.org/10.1021/jp408077m | J. Phys. Chem. B 2013, 117, 15958−15965