Role-Shifting PKCÎ¶ Fosters Its Own Proapoptotic ... - ACS Publications

Article pubs.acs.org/jpr

Role-Shifting PKCζ Fosters Its Own Proapoptotic Destruction by Complexing with Bcl10 at the Nuclear Envelope of Human Cervical Carcinoma Cells: A Proteomic and Biochemical Study Anna Chiarini,† Maddalena Marconi,† Raffaella Pacchiana,† Ilaria Dal Prà,† Jun Wu,‡ and Ubaldo Armato*,† †

Histology & Embryology Unit, Department of Life & Reproduction Sciences, University of Verona Medical School, Verona, I-37134, Italy ‡ Proteomics Laboratory, Institute of Burns Research, Southwest Hospital, Chonqing 400038, China S Supporting Information *

ABSTRACT: Many features of deadly human cervical cancers (HCCs) still require elucidation. Among HCC-derived cell lines, here we used the C4-I one since its quantitative gene expression pattern most closely mimics invasive HCCs, including protein kinase-Cζ (PKCζ) overexpression. Via proteomic, bioinformatic, and biochemical approaches we identified 31 and 33 proteins co-immunoprecipitating with PKCζ from nuclear membranes (NMs) of, respectively, untreated or VP-16-exposed C4-I cells. Such proteins belonged to eight functional groups, whose compositions and relative sizes changed with either context. Of the 56 proteins identified, only eight were shared between the two subproteomes, including Bcl10. Surprisingly, proteins known to associate with Bcl10, like Carma1/3 and Malt1, in so-called CBM signalosomes were absent. Notably, in VP-16-treated C4-I cells, PKCζ•Bcl10 complexes increasingly accrued at NMs, where PKCζ phosphorylated Bcl10, as PKCζ also did in vitro and in cell-free systems, both processes being thwarted by interfering RNA (iRNA) PKCζ depletion. Caspase-3 was associated with PKCζ•Bcl10 complexes and proteolyzed PKCζ leading to its inactivation/destruction; both events were prevented by Bcl10 iRNA suppression. Thus, PKCζ’s molecular interactions and functional roles changed strikingly according to the untreated or apoptogen-treated cells context, and by complexing with Bcl10, PKCζ surprisingly favored its own demise, which suggests both proteins as HCCs therapeutic targets. KEYWORDS: Bcl10, caspase-3, human cervical carcinoma, nuclear envelope, PKCζ, proteomics

■

INTRODUCTION Human cervical carcinoma (HCC) is the second most frequent malignancy causing the highest number of women-related deaths worldwide.1 At present, it has a greater prevalence in developing countries, where preventive medicine is rudimentary, but also occurs in developed countries.2 Most HCCs stem from epithelial cells infected by oncogenic or high-risk types of human papillomaviruses (HPVs) that encode the E6 and E7 proteins neutralizing the anti-oncogenic pRb and p53 proteins.3−5 A persistent oncogenic HPV infection, with a heightened expression of E6 and E7 mRNAs and proteins and of p16INK4 protein,6 associates with the malignant transformation of the cervical epithelium. However, due to HPV clearance, high-risk HPV infections do not always give rise to HCCs, for the development of which other less defined additional cofactors appear to be required.7,8 On the other hand, it must be recalled that a minor fraction (10%) of HCCs is not associated with high-risk HPV infections.9 Hence, the developmental picture of HCCs is rather complex, and several molecular and pathophysiological features of HCCs remain to be clarified; this hampers the identification of early predictive markers of malignancy and the development of novel, more effective therapies. © XXXX American Chemical Society

Recently, proteomic and bioinformatic approaches have helped characterize specific differential protein expression patterns and molecular operative mechanisms in HCC bioptic samples.10 The results of 2D SDS-PAGE and MALDI-TOF/ MS analysis of the proteomes from six HCC lines (among which the C4-I cell line was not included), as compared to that of the immortalized HaCaT keratinocytes, suggested the existence of a “central core of HCC protein expression”.11 In parallel, a quantitative transcriptomics study carried out on nine HCC cell lines identified the C4-I cells as those that most closely mimic late-stage invasive in vivo cervical cancer.12 These last findings induced us to choose the C4-I cells as our experimental model in order to investigate the signaling of protein kinase C (PKC) isoforms at the nuclear envelope under growing or apoptosing conditions by way of proteomic/ bioinformatic and biochemical approaches. PKCs encompass 12 gene-related serine/threonine protein kinase isoforms playing crucial roles in gene transcription, mitotic cycle control, cell survival, differentiation, drug-elicited apoptosis, and the development and progression of tumor cells, like cytoskeletally Received: January 16, 2012

A

dx.doi.org/10.1021/pr3000464 | J. Proteome Res. XXXX, XXX, XXX−XXX

Journal of Proteome Research

Article

mediated cell polarity regulation.1,13−22 According to their activation requirements, the PKC isoforms are grouped in classical (cPKCs, i.e., α, βI, βII, and γ, all requiring calcium, diacylglycerol [DAG], and phosphatidylserine [PS]); novel (nPKCs, i.e., δ, ε, η, and ϑ, wanting DAG and PS, but not calcium); and atypical (aPKCs, i.e., ζ, and ι/λ, needing PS only).23 Each PKC isoform has unique structural properties and distinct subcellular distributions, playing specific signaling roles in each cell type and subcellular compartment.13−22 Several nPKC and aPKC isoforms are involved and cleaved by proteases, including caspases,24 in apoptosis.14 Various mitogenic or apoptotic stimuli activate or inactivate diverse PKC isoforms causing their translocation from the cytosol to ER membranes, mitochondria, cytoskeletal structures, and/or the nuclear envelope.13−15 The pathophysiologically relevant functions of the nuclear envelope are manifold, impacting upon cellular development and differentiation, as they relate to the maintenance of nuclear integrity, upkeep and control of chromatin organization, DNA replication, gene transcription, seizing of transcription factors, protection from cellular stresses, and production and activity of signaling molecules.25 Moreover, lamin B1, a nuclear lamina component, is crucial for cell viability.26 However, the role(s) of PKC isoform(s) signaling at the nuclear envelope, particularly in apoptosing cells, are poorly known. Thus, in previous works, using pyF111 cells, i.e., polyomavirus (the rodents’ HPV counterpart) infected/transformed rat embryo fibroblasts, we could establish that various PKC isoforms (e.g., βI, βII, δ) translocate to the nuclear envelope and are activated or inactivated there during etoposide (VP-16, a topoisomerase II inhibitor) or calphostin C-induced apoptosis.26−30 In this work, we focused upon the atypical PKCζ as this isoform is overexpressed in human squamous cervical cancers,31 C4-I cells (our pilot observations), and HeLa cells,16 and PKCζ ectopic overexpression counteracts apoptogenesis in various cell lines,32,33 whereas overexpression of a functionally defective PKCζ mutant enhances apoptosis in tumor cells treated with etoposide (VP-16).22 Also, antisense oligonucleotide-induced suppression of PKCζ causes apoptosis in HeLa cells.16 PKCζ also phosphorylates topoisomerase II thereby modulating its activity and increasing the resistance to VP-16-elicited cytotoxicity through a decreased formation of the cleavable complexes causing permanent DNA breaks.34,35 In addition, PKCζ increases the inclusion of exon 9 in caspase-2 mRNA thereby favoring the synthesis of the supposedly anti-apoptotic caspase-2 short (S) isoform while counteracting the expression of the proapoptotic caspase-2 long (L) isoform that is instead enhanced by topoisomerase inhibitors.36 Via the phosphorylation of IKKβ kinase or of nuclear factor-κB (NF-κB) RelA subunit, PKCζ kicks off the NF-κB pathway, which controls cell growth, anchorage-independent growth, and escape from apoptosis.16,31,37−40 On such premises, PKCζ’s reputation as a pro-survival/anti-apoptotic PKC isoform is generally deemed to rest on solid grounds.37,39,41−43 However, there are also indications that, in response to various stimuli, PKCζ promotes instead apoptosis.44−46 Thus, the actual role(s) of PKCζ might be determined by the specific context and model under consideration. As the particular function(s) of PKCζ signaling at the nuclear envelope of in vivo HCCs or in vitro C4-I or other HCC cell lines had not been defined, in this work we started addressing this topic. First, we identified the members of the subproteomes respectively interacting with PKCζ at the NMs of untreated or

VP-16-treated C4-I cells. Second, we clarified the dealings of PKCζ with one of its interactors, whose functional roles at the nuclear envelope were unknown, i.e., the Bcl10 protein, a presumptive apoptosis modulator and tumor suppressor gene involved in NF-κB regulation as part of a Carma1/3-Bcl10Malt1 complex, the CBM signalosome.47−53 The results herein reported reveal for the first time the highly dynamic complexity of the NM-linked interactors/substrates of PKCζ according to the current cellular context examined and indicate that by phosphorylating Bcl10 at NMs PKCζ favors its own proapoptotic inactivation and destruction in VP-16-treated C4-I cells.

■

EXPERIMENTAL SECTION

Cell Culture

HCC C4-I cells were a gift from Prof. Nelly Auersperg (University of British Columbia, Vancouver, BC, Canada). Cells were plated in 175-cm2 plastic flasks (Sarstedt S.r.l., Verona, Italy) and incubated at 37 °C in 95% air/5% CO2 in complete medium consisting of 95% (v/v) Dulbecco’s modified Eagle’s Minimum Essential Medium (MEM; Sigma-Aldrich, Milan, Italy), 5% (v/v) heat-inactivated (56 °C for 30 min) fetal bovine serum (Lonza AG, Basel, Switzerland), and gentamycin (0.1 mg mL−1; Lonza). Before reaching confluence, the cultures were split at a ratio of 1:6 by incubating them at 18 ± 2 °C with 0.025% (w/v) trypsin (Sigma-Aldrich). Cell Growth and Apoptosis

Experiments were started by seeding 0.8 × 106 cells in each of several 175-cm2 flasks, and 24 h later (the experimental 0 h), the cells in some flasks were sampled (untreated controls), while in half the remaining flasks the topoisomerase-II inhibitor VP-16 (etoposide or 4-demethyl-epipodophyllotoxin-9-[4,6-Oethylidene-β-D-glucopyranoside]; 2.0 μg mL−1; Sigma-Aldrich)54 was added, and the cultures incubated without medium change for another 48 or 72 h period. Cell damage was assessed via epifluorescence microscopy by staining cells with acridine orange and ethidium bromide, which simultaneously revealed viable, apoptosing, and necroptosing cells.55 Isolation of Nuclei and Nuclear Membranes (NMs)

Cells were harvested by scraping them into cold (4 °C) PBS and centrifuging the suspension at 200g for 10 min. The sedimented cells were carefully resuspended in an isotonic solution containing 50 mM Tris-HCl pH 7.4, 0.25 M sucrose, 0.025% Nonidet P-40 (NP-40), 5.0 mM MgSO4, 20 μM sodium orthovanadate, 5 mM sodium fluoride, and complete EDTA-free protease inhibitor mixture (Roche, Milan, Italy). After homogenization, nuclei and NMs were isolated according to Emig et al.56 The integrity of the nuclei was judged via phase contrast microscopy; the purity of the NMs was assessed by immunoblotting with an anti-lamin B1 (C-20) goat antibody (Santa Cruz Biotechnology, Inc., Heidelberg, Germany), and any contamination by the cytoplasmic and nucleoplasmic fractions was excluded through immunoblotting with antiGAPDH and anti-matrin-3 antibodies (Santa Cruz), respectively. Nuclei were suspended in an excess volume of hypotonic buffer [10 mM Tris pH 7.4, 10 mM Na2HPO4, 20 μM sodium orthovanadate, 5 mM sodium fluoride and complete EDTAfree protease inhibitor mixture (Roche)] containing DNase I and heparin (0.2 and 5.0 mg mg −1 nuclear protein, respectively). This suspension was incubated at 4 °C for 45 min and then centrifuged at 9500g for 15 min. The resulting B



Article

accumulating data from 200 consecutive laser shots. Masses from an exclusion list containing known background peaks and trypsin specific autoproteolytic peptide masses were automatically deleted from the generated mass lists. Data processing was accomplished using Data Explorer software (Version 4.0, Applied Biosystems): mass spectra were analyzed and baselines corrected, noise was filtered (correlation factor 0.7), and data lists containing m/z values were extracted from mass spectral data, including signals with relative intensities higher than 2%.Tryptic monoisotopic peptide masses were identified by PMF with the Protein Prospector’s MS-Fit program (Version 5.2.2, University of California) (http://prospector.uscf.edu) software against Swiss-Prot (SwissProt.2010.09.10) (519.348 entries) setting the following parameters: Homo sapiens species, one missed cleavage site, and a mass tolerance setting of 100 ppm. Carbamidomethylation of cysteine was set as fixed modification, and oxidation of methionine was chosen as variable modification. Restrictions were applied to protein mass and pI determined by means of Delta2D software (Decodon). The criteria used to accept identifications included the extent of sequence coverage (>10%), the number of peptides matched (a minimum of four), the Mowse score (minimum of 1000), and the mass accuracy.

pellet contained nuclear envelope-enriched NMs, while the supernatant held the nucleoplasmic fraction (NP). In this study, we focused on NM fractions, but we also analyzed whole cytoplasmic fractions (SN1s) and total cell lysates (TCLs) when appropriate. Immunoprecipitation (IP) of Proteins from NMs

Before IP, proteins were solubilized from NMs by adding Trisbuffered saline [20 mM Tris pH 7.4, 200 mM NaCl, 20 μM sodium orthovanadate, 5 mM sodium fluoride, and complete EDTA-free protease inhibitor mixture (Roche)] and NP-40 1.0%. IP of equal protein amounts (150 μg) were performed with Dynabeads Protein G (Invitrogen Ltd., Paisley, U.K.) and antibodies against PKCζ or Bcl10 (Santa Cruz) according to the manufacturer’s recommended protocol. The samples were mixed with Dynabeads coupled with the antibodies, incubated for 1 h at 4 °C, and washed three times with PBS. After the final wash, the samples were resuspended in either Tris-buffered saline to measure PKCζ native activity or in sample buffer for immunoblot analysis. Two Dimensional Gel Electrophoresis (2-DE)

Immunoprecipitates from NMs were resuspended in 2-DE lysis buffer/rehydration buffer [7.0 M urea, 2.0 M thiourea, 2% w/v CHAPS, 0.5% v/v ZOOM carrier ampholytes (Invitrogen), 20 mM DTT, and 0.002% bromophenol blue]. Proteins were first separated according to their isoelectric points (pIs) on 7 cm immobilized pH-gradient ZOOM strips (pI ranges 4−7 and 6− 10; Invitrogen) and then in the second dimension according to their molecular mass (Mr) in a NuPAGETM Novex 4−12% BisTris ZOOM gel (Invitrogen). The gels were stained using SilverQuest (Invitrogen), an MS-compatible silver staining kit, and scanned, and the protein spot patterns were analyzed with the Delta2D software (Decodon GmbH, Greifswald, Germany). Protein spots were detected automatically with the following software settings: sensitivity 25%, average spot size 8 (radius of an average spot in pixels). The intensity of each protein spot was quantified summing up the gray values of the pixels belonging to each spot. The amount of protein per spot was defined as the sum of the intensities of all of the pixels that made up the spot. After background subtraction the total spot volume was calculated for each gel image. Each spot was assigned a normalized spot volume as a proportion of the total spot volume. All of the spots that were reproducibly detectable in triplicate were considered in this study.

Western Immunoblotting

Equal amounts (10−20 μg) of protein, determined by means of Biorad Protein Assay (Biorad Laboratories, Milan, Italy), were analyzed by immunoblotting as previously described,26−30 using antibodies recognizing PKCζ (C-20), (p-Thr410)-PKCζ, PKCι (N-20), PKCθ (C-18), PKCα (C-20), Bcl10 (331.3 or H-197), and lamin B1 (C-20) (all from Santa Cruz) at a final 1.0 μg mL−1. The PKCζ (C-20) antibody also recognized PKCι, whereas the PKCι (N-20) antibody cross-reacted neither with PKCζ nor with any other PKC isoform. Antigen−antibody complexes were detected using the appropriate alkaline phosphatase-conjugated anti-mouse, anti-rabbit, or anti-goat IgGs (Santa Cruz) and either BCIP/NBT liquid substrate reagent or CDP-Star (Sigma-Aldrich). Developed blots were photographed with a digital camera, and the molecular mass and densitometry of each specific band were assessed using Sigmagel software (Jandel Corp., San Rafael, CA). Assay of Immunopurified Native PKCζ Specific Activity

A fluorometric PKC activity assay kit, the Omnia Ser/Thr Recombinant Kit 8 (Invitrogen), including the Omnia S/Tpeptide-8 as a PKCζ-specific substrate, was used. To measure the specific activity of PKCζ immunoprecipitated from NMs, the assay mixture was prepared as recommended by the supplier. No cofactor was added to the immunocomplexbearing beads. Each sample was incubated with or without a PKCζ-pseudosubstrate inhibitor (H2N-SIYRRGARRWRHLOH, 60 μM; Sigma-Aldrich) to confirm the specificity of PKCζ activity. The amounts of phosphorylated S/T-peptide-8 were determined by fluorescence measurements (λex 360 nm; λem 485 nm) as recommended by the supplier. The results were expressed in arbitrary units calculated for each sample as ΔF μg−1 of immunoprecipitated protein.

In-Gel Protein Digestion, MALDI-TOF/MS Analysis, PMF, and Bioinformatics

The tryptic in-gel digestion and desalting steps were performed using 96-well ZipPlate microSPE plates (Millipore) according to the manufacturer’s instructions. Briefly, protein spots were excised with a spot picker (OneTouch, The Gel Company, San Francisco, CA), transferred to 96-well ZipPlates, and digested overnight at 37 °C as previously detailed.57 Extracted peptides were directly applied onto a target that was loaded with a thin layer of CHCA (α-cyano-4 hydroxy-cinnamic acid; LaserBioLabs, Cedex, France) matrix. A Voyager De PRO MALDITOF/MS workstation (Applied Biosystems, Milan, Italy) operating in the reflector mode was used. An accelerating voltage of 25 kV was applied for PMF. Calibration of the instrument was performed externally with [M + H]+ ions of Des-Arg1-bradykinin, angiotensin-1, Glu1-fibrinopeptide B, and neurotensin. Signals corresponding to m/z values ranging from 500 to 5000 were monitored. Each spectrum was produced by

Isolation of Endogenous Phospho (p)-Bcl10

Phosphoproteins were isolated using a PhosphoCruz-Agarose (Santa Cruz) according to the manufacturer’s instructions. Briefly, 150 μg NM proteins were diluted up to 1.0 mL with 50 mM MES pH 6.6, 1.0 M NaCl, 0.25% CHAPS (binding/ washing buffer) and reacted with PhosphoCruz-Agarose for 90 C



Article

min at 4 °C under swelling. After three washes with binding/ washing buffer, the phosphoproteins were eluted from PhosphoCruz-Agarose in 100 mM ammonium bicarbonate pH 9.0, 0.25% CHAPS (elution buffer) and analyzed by immunoblotting using an anti-Bcl10 antibody (SantaCruz).

GTTGTTCCTGGTCATTGAGTA or CATGAAAGTGGTGAAGAAAGA for PKCζ. The respective recombinant lentiviruses were produced by HEK293FT cells transfected using the Vira Power Lentiviral Expression System (Invitrogen). Briefly, using Lipofectamine 2000, pLK0.1-puro/Bcl10 (3.0 μg) or pLK0.1-puro/PKCζ was co-transfected along with the ViraPower Packaging Mix in subconfluent HEK293FT cells. The respective recombinant lentiviruses were harvested 48 h later, filtered through a Millex-HV 0.45 μm, and stored at −80 °C according to the supplier’s protocol. For RNA interference experiments the viral stocks were added to C4-I cells (0.8 × 106) supplemented with 4.0 μg mL−1 Polybrene (Santa Cruz). Infected cells were selected by incubation with 5.0 μg mL−1 puromycin (Sigma) for 4 days. A lentiviral non-target (nt) vector containing a short hairpin that does not recognize any human or mouse gene (MISSION pLK0.1-puro, SigmaAldrich) was used in parallel as a negative control in all transduction experiments. The effectiveness of silencing Bcl10 or PKCζ expression was determined by immunoblotting TCLs and/or NMs with an anti-Bcl10 or anti-PKCζ antibody (Santa Cruz), respectively.

Phosphorylation of Recombinant r-Bcl10 by r-PKCζ in Vitro

Human full-length active r-PKCζ and human r-6*His-Bcl10 proteins were purchased from Promega Italia (Milan, Italy) and from ProteinTech Group, Inc. (Chicago, IL), respectively. rBcl10 was incubated in a final volume of 25 μL of kinase assay buffer (25 mM MOPS, pH 7.2, 12.5 mM β-glycerol-phosphate, 25 mM MgCl2, 5 mM EGTA, 2 mM EDTA, 0.25 mM DTT) containing 210 nM ATP and 1 μCi of [γ-33P]ATP in the presence of 40 ng of r-PKCζ for 30 min at 30 °C. Reactions were terminated by spotting 20 μL of the reaction mixture onto P81 phosphocellulose paper (Millipore), which was washed thrice in 1% H3PO4, and the incorporation of [33P]phosphate was determined by scintillation counting. Two different reaction controls were set up: the first blank consisted of exactly the same reaction mixture except that r-PKCζ was boiled for 10 min before its addition to it; the second control consisted of exactly the same reaction mixture except for rBcl10. The kinetics of r-Bcl10 phosphorylation by r-PKCζ were analyzed by increasing the concentration (from 76 to 610 nM) of r-Bcl10 in the presence of 40 ng of r-PKCζ for 30 min at 30 °C, and the Km and Vmax of the reaction were calculated from the phosphorylation curve. Parallel phosphorylation reactions of r-Bcl10 were terminated by adding SDS sample buffer and boiling prior to SDS-PAGE. Then, the phosphorylation degree of r-Bcl10 was determined via autoradiography.

Caspase-3 Activity and Inhibition

The specific activity of caspase-3 was measured in equal protein amounts (50 μg) of TCLs, SN1s, and NMs using a specific 7amido-4-methyl-coumarin (AMC)-conjugated fluorometric substrate, Ac-DMQD-AMC (50 μM; Bachem GmbH, Weil am Rhein, Germany).58 The results were expressed as specific activity or as arbitrary units when immunoprecipitates were analyzed (means ± SE of ΔF μg−1 protein of each experimental group). Conversely, to study caspase-3 inhibition, we started by seeding 0.8 × 106 C4-I cells in each of several 175-cm2 flasks. At the experimental 0 h (i.e., 24 h later), the cells in some flasks were sampled (controls), while VP-16 (2.0 μg mL−1) was added to the remaining flasks. At 30 h and again at 38 h, the cells were treated for 60 min with 35 μM and 80 μM, respectively, of the specific caspase-3 inhibitor z-Asp(OMe)Gln-Met-DL-Asp(OMe)-fluoro-methyl-ketone (z-DQMD-fmk; Bachem)59 or with vehicle alone (0.1% DMSO). At 48 h cells were harvested, NMs isolated, and NM protein samples immunoblotted with PKCζ (C-20) antibody (Santa Cruz).

Isolation of Cytoplasms and Nuclei for Cell-Free in Vitro Reconstituted Nuclei-Cytoplasms (N−Cs) Constructs Studies

We followed our previously described procedures.26,29 Briefly, untreated or 24 h VP-16-treated C4-I cells were harvested by scraping into cold (4 °C) PBS, washed twice in cold PBS, and next incubated on ice for 10 min at a density of 1 × 107 cells mL−1 in lysis buffer [150 mM NaCl, 1 mM KH2PO4, 5 mM MgCl2, 1 mM EGTA, 1 mM dithiothreitol, 20 μM sodium orthovanadate, 5 mM sodium fluoride, complete EDTA-free protease inhibitor mixture (Roche), 5 mM Hepes pH 7.4, 10% glycerol, and 0.3% Triton X-100]. Cell lysates were centrifuged (2000g for 10 min at 4 °C), and cytoplasmic supernatants (C) from untreated and VP-16 treated cells were stored for subsequent analysis. Intact nuclei (N) were isolated from untreated cells, washed twice with lysis buffer without Triton X100, and suspended at a final 1−2 × 107 nuclei mL−1. To generate two N−C constructs, N isolated from untreated cells (1 volume) were incubated with C from either untreated or VP-16-treated cells (4 volumes) at 30 °C for 30 min. Each N− C construct was split into two equal aliquots; one was added with a specific PKCζ inhibitor (60 μM) while the other was not. Figure 5 outlines the experimental design.

Statistical Analysis

One-way ANOVA with posthoc Holm-Sidak’s test (all pairwise multiple comparison procedures) was applied to the data and a P < 0.05 was considered as statistically significant. Statistical analyses were performed using the Sigmastat 3.5 software package (Systat, Software, Inc., Chicago, IL).

■

RESULTS

C4-I Cell Growth and VP-16-Induced Apoptosis

The substrate-adherent cell numbers in untreated cultures increased 3-fold between the experimental 0 h (i.e., 24 h after plating in 175-cm2 flasks and a fresh medium change at 24 h) and 72 h (Supporting Information Figure S1A), when more than 99.7% of such cells were viable excluding ethidium bromide and having a normally acridine orange-stained DNA (Supporting Information Figure S1B, panel I). Adding VP-16 (2.0 μg mL−1) immediately stopped C4-I cell proliferation; 24 h later the viable cell numbers began progressively dropping (by 72 h, −61% vs 0 h; P < 0.001) (Supporting Information Figure 1A), while apoptosis-related cytological changes, apoptotic bodies, and dead cells became detectable (Supporting

Generation of Lentiviral iRNA against Bcl10 or PKCζ, Infection, and Selection of C4-I Cells

The human immunodeficiency virus type 1-derived lentiviral vector was used to generate constitutively active pLK0.1-puro/ Bcl10 vector and pLK0.1-puro/PKCζ vector for the specific depletion of either protein. The most effective constructs had the following target sequences: GTTGAATCTATTCGGCGAGAA or GAAGTGAAGAAGGACGCCTTA for Bcl10, and D



Article

Figure 1. Proteins populating the PKCζ-interacting subproteomes at NMs of wt C4-I cells are substantially different under conditions of growth (0 h) or apoptosis (24 h). Representative SilverQuest 2-DE gels (n = 3) of proteins co-immunoprecipitated with PKCζ from NMs of untreated (0 h) and VP-16-treated (2.0 μg mL−1) (24 h) cells. Spot numbers correspond to equal protein numbers in Table 1. Among the 31 and 33 protein species respectively identified in either kind of specimens, PKCζ’s spot is labeled in letters, and spot 45 corresponds to Bcl10; both of these identifications were confirmed via immunoblotting (cf. Figures 3 and 4). Note the shift to the left of both PKCζ and Bcl10 spots in the 24 h VP-16-treated 2-DE pH 47 gel as compared with its 0 h (untreated) counterpart.

the subproteomes from untreated and 24 h VP-16-treated cells, respectively; only eight proteins were shared between both subproteomes, one of which was Bcl10 (Table 1). Thus, within each functional protein group of PKCζ-interacting proteins there were total or striking differences in “membership” between the untreated or apoptogen-treated NM subproteomes (Figure 2B). This quite remarkable shift in PKCζ interactors/ substrates suggests that the specific functions of PKCζ at NMs change remarkably according to ongoing circumstances. Notably, only a few of the two NM subproteomes’ proteins were already known to interact with PKCζ, such as PDK1,39 caspase-3,24,60−62 Bax,42 and FRMD6,63 the latter being a member of the FERM-domain protein family involved in recruiting atypical PKCs to apical junctional complexes.

Information Figure S1B, panels II−IV). Using a specific caspase-3 substrate, Ac-DMQD-AMC, we found that caspase3 activity levels were discrete but low and steady at both NMs and SN1s from untreated (0 to 72 h) wild-type (wt) C4-I cells (Supporting Information Figure S1C). In contrast, caspase-3 activity significantly increased at both NMs and SN1s after exposure to VP-16 (Supporting Information Figure S1C). Proteomic Analysis of PKCζ Protein Complexes at NMs

The purity of isolated NMs was assessed by immunoblot analysis for lamin B1, GAPDH, and matrin-3 (not shown). From the NMs of untreated (0 h) and of 24 h VP-16-treated cells 31 and 33, respectively, distinct spots of proteins that coimmunoprecipitated with PKCζ were resolved through 2-DE (Figure 1). We looked at proteins that were present either in untreated or VP16-treated samples and those differentially associated either in higher or lower amounts. All spots that were reproducibly detectable were analyzed in this study. After excision, these spots were proteolytically digested and identified by MALDI-TOF/MS, PMF, and bioinformatics (Table 1). The identified proteins could be clustered in eight main functional groups, the relative percent fractions of which differed remarkably under the two conditions (Figure 2). In the PKCζ-interacting NM subproteome from untreated cells, signal transduction- (35.5%), cell cycle regulation- (16.1%), and transcription control- (16.1%) related functional protein groups were the most representative ones. Conversely, the apoptosis(39.4%), transcription regulation- (21.2%), and signal transduction- (21.2%) related functional protein groups were the most prominent in NM subproteomes from VP-16-treated cells (Figure 2A). The actual compositions of the two subproteomes differed by 85.7%: 23 and 25 proteins were uniquely present in

PKCζ at NMs and TCLs of Wild Type (wt) C-4I Cells

At NMs from untreated cells, the PKCζ (66 kDa) holoproteins could be detected at steady, low levels between 0 h and 48 h, whereas PKCζ catalytic fragments (CFs; 44 kDa) were undetectable (Figure 3A). After VP-16 exposure, both intact PKCζ and PKCζ CFs levels significantly surged at NMs (Figure 3B, upper panel). In contrast, the amount of PKCζ holoprotein was unchanged (P > 0.05), while that of PKCζ CFs increased with time at TCLs (Figure 3B, lower panel). Immunoblot analysis with a specific phosphoantibody demonstrated that the amount of (p-Thr410)-PKCζ holoprotein also remarkably increased at NMs from VP-16-exposed cells, peaking at 48 h and then declining (Figure 3C, upper panel). Conversely, at TCLs (p-Thr410)-PKCζ holoprotein decreased linearly after VP-16 treatment (Figure 3C, lower panel). Regrettably, this phosphoantibody did not recognize (pThr410)-PKCζ CFs (not shown). In keeping with this finding, E


F

transcription regulation

cell cycle/growth regulation

signal transduction

category

32

30 31

28 29

25 26 27

23 24

19 20 21 22

12 13 14 15 16 17 18

11

10

9

8

7

1 2 3 4 5 6

spot no.

Serine/threonine-protein kinase D2 CaMK IV PP2A subunit A isoform PR65-alpha Serine/threonine-protein kinase 32A Tyrosine-protein kinase Fer 3-phosphoinositide-dependent protein kinase 1 Serine/threonine-protein kinase PCTAIRE-1 Protein kinase C-binding protein NELL1 Putative 3-phosphoinositidedependent protein kinase 2 Ras association domain-containing protein 2 Dual specificity protein phosphatase 18 PP2A subunit B isoform B55-alpha Diacylglycerol kinase theta Calpain small subunit 1 G1/S-specific cyclin-D1 Cyclin Y S-phase kinase-associated protein2 TFIIH basal transcription factor complex helicase XPD subunit Histone acetyltransferase KAT5 ZW10 interactor Serine/threonine-protein kinase Kist Zinc finger and BTB domaincontaining protein 26 Transcription factor SOX-6 Zinc finger protein with KRAB and SCAN domains 1 Zinc finger protein 167 Zinc finger protein 264 Pre-B-cell leukemia transcription factor-2 Metastasis-associated protein MTA3 Zinc finger and BTB domaincontaining protein 8B Zinc finger protein 426 Zinc finger and BTB domaincontaining protein 17 Histone H4 transcription factor

description

Q9BQA5

Q9BUY5 Q13105

Q9BTC8 Q8NAP8

Q9P0L1 O43296 P40425

P35712 P17029

Q92933 O95229 Q8TAS1 Q9HCK0

Q9Y2T4 P52824 P04632 P24385 Q8ND76 Q13309 P18074

Q8NEJ0

P50749

Q6A1A2

Q92832

Q00536

Q9BZL6 Q16566 P30153 Q8WU08 P165917 O15530

Swiss Prot

5.8

8.0 6.0

8.8 5.0

7.3 7.4 7.2

7.6 6.6

8.7 5.1 5.6 6.6

5.9 7.3 5.1 5.0 6.8 6.7 6.7

7.0

8.9

8.6

5.7

7.2

6.4 5.6 5.0 6.9 6.7 7.0

theor

pI

5.5

8.0 6.0

8.8 4.6

6.9 7.2 6.3

7.4 6.5

8.9 4.8 5.6 6.8

5.8 7.7 5.5 5.0 6.5 6.5 6.8

6.8

9.0

8.7

5.9

7.3

6.1 5.6 4.9 6.8 6.8 6.3

exp

59.7

63.1 87.9

67.5 54.2

85.0 70.6 45.9

91.9 63.6

58.6 31.3 46.5 49.4

51.5 101.2 28.3 33.7 39.3 47.8 86.9

21.1

37.8

44.8

89.6

55.7

96.8 51.9 65.3 46.4 94.6 63.2

theor

Table 1. Identified Proteins Associated with PKC-ζ at 0 and 24 h Following VP-16 Treatment

55.3

62.0 86.2

66.3 51.2

85.2 72.0 43.1

93.1 65.3

59.0 29.4 48.0 48.9

52.1 99.3 27.2 32.2 37.1 47.2 87.3

22.0

38.1

44.0

89.0

55.0

100.0 53.8 64.7 44.2 94.5 62.8

exp

MW (KDa)

6434

12/105

12/100 16/83

29/99 26/81 14/120

1.07 × 1010 1.09 × 109 11773

4.52 × 106 88430

45/105 17/120

7.63 × 109 560853

22/85 15/68

17/110 7/104 10/113 26/193

3.66 × 106 7040 36185 433543

908134 21624

13/102 14/104 14/115 10/76 12/79 11/90 18/75

4/55

56751 1.16 × 106 330583 9251 9.31 × 106 33542 1.17 × 106

3034

12/64

29/115

2.05 × 1012

8.51 × 106

27/71

1.53 × 107

10/47

14/103 21/114 31/97 11/116 57/179 28/88

1.1 × 108 16000 2.09 × 109 3.74 × 106 8,4 × 1011 2.28 × 108

10268

matched peptides/ total peptides

MOWSE score

26.3

33 38.7

46.5 39.6

45.4 38.4 56

32 32.2

39.8 30.7 36.8 42

40.7 19.6 59.3 38.3 46.9 26.4 37.1

29.8

39.9

43.4

37.7

44

29.7 65.5 46.4 46.5 44 45.7

sequence coverage (%)

-

-

-

5.40 7.77 -

15.74 10.94

1.52 0.83

17.65 2.03 13.30 5.09

2.30

2.78

2.34

5.04

2.08

2.46 12.96 8.91 3.92 3.15 7.73

0h

10.85

4.77 1.40

7.86 6.24

5.76

-

1.21 2.68 -

2.01 3.36 2.61 -

-

-

3.35

19.02

-

2.16 -b 10.09

24 h VP-16

% spot volumea

Journal of Proteome Research Article


G

a

54 55 56

44 45 46 47 48 49 50 51 52 53

43

42

40 41

Nuclear LIM interactor-interacting factor 3 Zinc finger RAD18 domaincontaining protein C1orf124 CASP8 and FADD-like apoptosis regulator Tripartite motif-containing protein 39 TNF receptor-associated factor 5 Caspase-3 Tumor necrosis factor alpha-induced protein 8 Programmed cell death protein 4 Bcl-2/adenovirus E1B 19 kDainteracting protein 2-like protein Baculoviral IAP repeat-containing protein 3 Caspase recruitment domaincontaining protein 16 Apoptosis-related protein 3 Bcl10 Caspase-14 BH3-interacting domain death agonist Apoptosis regulator BAX Heat shock 70 kDa protein 1A/1B Heat shock protein HSP 90-beta FRMD6 Nurim Nuclear pore complex protein Nup107 Lamin B1 Protein FAM122C Putative ATP-binding cassette subfamily A 11

description

P20700 Q6P4D5 Q4W5N1

Q6UW56 O95999 P31944 P55957 Q07812 P08107 P08238 Q96NE9 Q8IXM6 P57740

Q5EG05

Q13489

Q53EL6 Q7Z465

Q9HCM9 O00463 P42574 O95379

O15519

Q9H040

Q9GZU7

Swiss Prot

5.1 9.9 9.4

6.9 5.6 5.4 5.3 5.1 5.5 4.9 7.1 8.8 5.3

8.7

5.7

5.1 5.3

7.8 7.3 6.1 7.7

8.2

8.4

5.6

theor

8.5

5.6

4.9 5.6

7.7 7.1 6.5 8.0

8.0

8.4

5.7

exp

4.9 9.2 9.5

6.7 5.9 (0 h) 5.6 (24 h) 5.4 5.4 4.7 5.5 5.2 7.0 8.1 5.3

pI

66.4 22.5 17.5

24.7 26.3 27.7 22.0 21.2 70.1 83.3 72.0 29.4 106.4

22.6

68.4

51.7 39.7

59.7 64.4 31.6 23.0

55.3

55.1

29.2

theor

68.5 20.5 20.5

27.2 26.5 (0 h) 26.8 (24 h) 26.9 22.2 21.9 73.8 86.5 70.5 27.0 107.0

21.2

68.1

53.1 36.5

61.2 63.7 34.8 26.2

55.9

56.0

28.5

exp

MW (KDa)

14/73

1.94 × 107

1200 8.82 × 107 2.99 × 106

11/67 10/102 13/89

7/85 10/84 7/64 8/68 6/77 14/79 11/67 22/108 4/76 23/101

17/92

9,37 × 106

15301 5907 15326 7050 1367 23068 10315 2.41 × 106 40552 365442

12/119 19/90

34/98 21/101 13/82 9/106

1.58 × 109 1.13 × 106 3362 14724 8279 2.34 × 106

19/102

16/74

1.05 × 106 13651

16/93

matched peptides/ total peptides

2288

MOWSE score

41 68.7 67.9

36.6 37.2 36 42.6 59.4 24.8 19.2 29.9 35.9 10.9

46.7

52.8

38.4 52.9

40 46.3 34.7 67

58.3

42.5

59

sequence coverage (%)

8.38 3.09 2.58

6.24 6.03 14.55 3.41 10.03

4

7.76

-

-

-

-

-

0h

6.92 -

1.17 6.95 1.01 2.85 15.39 6.46 6.30 -

-

7.47

2.63 5.85

18 1.89 5.85 20.02

4.78

1.52

0.58

24 h VP-16

% spot volumea

Relative quantity (% volume) of the spot after excluding the background as the mean value of three experimental replicates. (The total quantity of all spots on the single gel is 100%). bNot detected.

unknown function

nuclear envelope structure

chaperone/ adapter

35

apoptosis regulation

36 37 38 39

34

33

spot no.

DNA repair

category

Table 1. continued

Journal of Proteome Research Article



Article

Figure 2. Functional groups of proteins co-immunoprecipitated with PKCζ from NMs and their relative percent fractions and dissimilar compositions under proliferative (0 h) and apoptotic (24 h) conditions. (A) The relative percent sizes of the fractions of the several main functional protein groups change significantly from the untreated (0 h) to the VP-16-exposed (24 h) wt C4-I cells. The group of proteins of unknown function occurs only at 0 h, whereas the DNA damage/repair group is present only at 24 h. Protein groups were identified via proteomics/bioinformatics (see Table 1 and the text for details). (B) The compositions of the various functional groups of PKCζ-interacting proteins at NMs have a high degree of dissimilarity in untreated vs VP-16-treated cells. The data shown here derive from a further analysis of the contents of Table 1.

exposed cells (Figure 3D), we focused our further studies on NMs.

PKCζ native specific activity immunoprecipitated from NMs increased in VP-16-treated cells during the first 48 h but subsequently fell (Figure 3D). Conversely, no change in PKCζ activity occurred at SN1s (cytoplasms), and a transient increase (at 24 h) followed by a fall was observed at TCLs from VP-16exposed cells (Figure 3D). As PKCι closely resembles PKCζ and is recognized by the PKCζ (C-20) polyclonal antibody used in these studies, we utilized the (N-20) anti-PKCι antibody, which does not crossreact with any other PKC isoform, to assess the contribution, if any, of PKCι to the PKCζ immunoreactivity detected at NMs. PKCι protein levels were very low and did not change at NMs from untreated or VP-16-treated cells (not shown), indicating that PKCι played no major role in the response to VP-16. Similarly, even PKCθ and PKCα protein levels underwent no change at NMs after VP-16 administration with respect to controls and, hence, were not considered further (not shown). Thus, our results established that during the first 48 h after VP-16 exposure, active (p-Thr410)-PKCζ holoprotein increasingly associates with NMs, where it subsequently undergoes progressive proteolysis and inactivation. Notably, as the most significant changes in PKCζ activity occurred at NMs of VP-16-

During VP-16-Induced Apoptosis PKCζ Increasingly Associates with Bcl10 at NMs

Our proteomic analysis had shown that Bcl10 is one of the eight proteins co-immunoprecipitating with PKCζ from NMs of both untreated and VP-16-treated cells (Table 1). Hence, we undertook to confirm via immunoblotting the association of Bcl10 with NMs. In untreated growing cells only a trifling, steady amount of Bcl10 was found connected with NMs (Figure 4A, upper panel). However, after VP-16 treatment, Bcl10 levels remarkably increased at NMs (Figure 4A, middle panel), while decreasing at TCLs (Figure 4A, lower panel).To validate the interaction between PKCζ and Bcl10 at NMs, we performed co-immunoprecipitations using antibodies reacting with PKCζ or Bcl10. As expected, the Bcl10 amount coimmunoprecipitating with PKCζ from 0 h NMs was trivial but rose hugely after VP-16 treatment (Figure 4B). Of note, Bcl10 co-immunoprecipitated with both PKCζ holoproteins and PKCζ CFs from NMs (Figure 4C), suggesting that the PKCζ•Bcl10 interaction implicates regions within the CF of PKCζ. Unexpectedly and notably, Carma1/Carma3 and Malt1 H



Article

Figure 3. PKCζ holoproteins (66 kDa) and catalytic fragments (CFs; 44 kDa), PKCζ holoprotein phosphorylation at Thr410, and PKCζ native activity particularly increase at NMs during the first 48 h following VP-16 (2.0 μg mL−1) administration to wt C4-I cells, while the changes are much less pronounced or opposite in other subcellular fractions (TCLs and SN1s). In (A−C) cells were cultured, harvested, and subfractionated, and equal protein amounts (10 μg) from NMs were immunoblotted as detailed in Experimental Section. Blots in (A-C) are representative of 10 experiments. LC, loading control (i.e., lamin B1). Densitometry data (means ± SE; n = 10) from whole experimental groups, normalized taking as 1.0 the PKCζ holoprotein band value at 0 h and expressed in arbitrary units, are shown on the right of corresponding immunoblots. In detail: (A) PKCζ holoprotein levels do not change, while PKCζ CFs are undetectable at NMs of proliferating C4-I cells. (B) PKCζ translocation and proteolysis increase at NMs of VP-16-treated vs untreated (0 h) C4-I cells. Conversely, the levels of PKCζ holoprotein do not change at TCLs, whereas PKCζ CFs are increased by 48 h and 72 h of VP-16 treatment. Samples were prepared as in (A). (C) (p-Thr410)-PKCζ levels surge at NMs between 0 and 48 h of VP-16 exposure, while slowly decreasing at TCLs. The phospho-specific antibody used recognizes (p-Thr410)-PKCζ holoprotein, but not (pThr410)-PKCζ CFs. (D) Time-related changes in PKCζ specific native activity immunoprecipitated from NM, SN1, and TCL fractions of VP-16treated cells vs 0 h controls. A fluorometric assay kit served to assess PKCζ activity as described in the Experimental Section. Data (means ± SE; n = 4) are expressed in arbitrary units of ΔF μg−1 of immunoprecipitated PKCζ protein taking 0 h values as 1.0. Statistical analysis in (A−D): *, P < 0.05 (at least) vs 0 h; **, P < 0.05 (at least) vs 24 h; ***, P < 0.001 vs 48 h.

threshold of 0.500. Thus, the NetPhos 2.0 Server analysis pointed to a greater number (i.e., 16) of potential (p)-Ser residues while predicting comparable numbers of (p)-Thr (i.e., six) and (p)-Tyr (i.e., four) residues. A further analysis carried out using the “NetPhosK 1.0 Server” software predicted eight potentially PKC-mediated Ser/Thr phosphorylation sites on the Bcl10 molecule, namely, Thr62, Thr77, Ser109, Ser112, Ser113, Thr152, Ser205, and Thr255, the last one having the highest score, i.e., 0.900. Next, supported by the results of these virtual simulations, we set up an r-PKCζ kinase in vitro assay with rBcl10 and [γ-33P]ATP. Our results showed that active r-PKCζ can directly phosphorylate r-Bcl10 (Figure 5B). Incubating increasing amounts of purified r-Bcl10 (from 76 to 610 nM) with r-PKCζ (40 ng) at 30 °C for 30 min resulted in (p)-Bcl10 levels mounting in a concentration-dependent fashion (Figure

were not among the proteins that co-immunoprecipitated with PKCζ•Bcl10 complexes from NMs (Table 1), and hence there were no CBM signalosomes.52,64 Bcl10 Is a PKCζ Substrate

In addition to detecting enhanced interactions between PKCζ and BCL10 at NMs after VP-16 treatment, we also observed a shift of PKCζ and Bcl10 to more acidic pIs in 2-DEs (Figure 1 and Table 1), matched by increases in (p-Thr410)-PKCζ (Figure 3C) and in (p)-Bcl10 (Figure 5A) levels at NMs from VP-16-treated vs control cells. Consequently, we tested the hypothesis that PKCζ phosphorylates Bcl10. As a first step, we used the “NetPhos 2.0 Server” software to assess the predicted phosphorylation sites at Ser, Thr, and Tyr residues in the Bcl10 molecule taking as positive predictions the scores above a I



Article

phosphorylate r-Bcl10 in vitro; our next step was to confirm that Bcl10 could also be phosphorylated by PKCζ at NMs of C4-I cells. We addressed this issue by treating C4-I cells with a specific PKCζ pseudosubstrate inhibitor (60 μM). This agent curtailed 90% of PKCζ activity immunoprecipitated from the NMs of VP-16-treated cells but was concurrently highly cytotoxic causing within 4 h a massive cell death, an upshot confounding the results (not shown). To overcome this problem, we generated four types of cell-free nuclearcytoplasmic constructs (N−Cs), to which the PKCζ pseudosubstrate inhibitor (60 μM) was or was not added (for experimental details see Figure 5C). All N−C types were incubated at 37 °C for 30 min before isolating the NMs, whose phosphoproteins were next immunoprecipitated using PhosphoCruz-Agarose. The various phosphoimmunoprecipitates and the corresponding total NM proteins were immunoblotted and probed with an anti-Bcl10 antibody (Figure 5D). Type (i) N−Cs had very little NM-linked total Bcl10; however, in type (iii) N−Cs NM-bound total Bcl10 was 2.9-fold higher compared with type (i) N−Cs (Figure 5D). Although (p)Bcl10 was negligible in NMs from type (i) N−Cs, it could be immunoprecipitated in 17.0-fold greater amounts from NMs of type (iii) N−Cs (Figure 5D). Thus, cytoplasms pretreated with VP-16 for 24 h could load nuclear envelopes from untreated nuclei with much larger amounts of total and (p)-Bcl10 than untreated cytoplasms did. Next, we assessed the degrees of Bcl10 loading and phosphorylation in immunoprecipitates from NMs of type (ii) and (iv) N−Cs. Unexpectedly, in both of these N−C types the inhibition of PKCζ activity was associated with an increased NM loading of total Bcl10 and of (p)-Bcl10 (Figure 5D). Therefore, to clarify the picture, we analyzed the changes in (p)-Bcl10/total Bcl10% ratio values in the four kinds of N−Cs; the lowest value belonged to NMs of type (i) and the highest to NMs of type (iii) N−Cs, the two differing from each other by 6-fold (P < 0.001). Conversely, intermediate percent ratio values pertained to NMs of type (ii) and (iv) N−Cs, which were similar (P > 0.05) to each other yet significantly (P < 0.02) different from type (i) and (iii) N−Cs values (Figure 5D). The results of this analysis suggested that (1) the heightened phosphorylation of Bcl10 by an active PKCζ at NMs of type (iii) N−Cs was effectively suppressed by the PKCζ-pseudosubstrate inhibitor at NMs of type (iv) N−Cs; and (2) as a consequence of PKCζ inhibition, some other protein kinase(s) could bind and phosphorylate discrete amounts of Bcl10 at NMs of type (ii) and (iv) N−Cs, i.e., independently of VP-16 treatment (Figure 5D). Notably, as Bcl10 can be phosphorylated at multiple sites, PKCζ cannot be its exclusively targeting kinase. Similar evidence were reported by Yeh et al.,66 who studied the phosphorylation of Bcl10 by Akt1. Therefore, PKCζ can directly phosphorylate Bcl10 in vitro and at NMs of both N−Cs and, hence, whole C4-I cells. Further studies are going on in our laboratory to identify the PKCζ phosphorylation site(s) in the Bcl10 molecule.

Figure 4. Bcl10 accumulates and interacts with PKCζ at NMs of VP16-exposed (2.0 μg mL−1) wt C4-I cells. After cell culture, harvesting, and subfractionation, equal amounts (10 μg) of proteins from NMs or TCLs were immunoblotted with a Bcl10 antibody. Crossed immunoprecipitations were performed as detailed in the Experimental Section. Representative blots from 10 experiments are shown in (A− C). Densitometric data (means ± SE) from each whole group of experiments were normalized by taking as 1.0 the corresponding 0 h values of specific protein bands (Bcl10 in A,B; PKCζ holoprotein in C) and expressed in arbitrary units. In detail: (A) Bcl10 loads at NMs while slowly falling (by 72 h) at TCLs of VP-16-treated cells. nd, not determined. (B) Bcl10 increasingly co-immunoprecipitates with PKCζ from NMs of VP-16-treated cells. (C) Both PKCζ holoprotein and PKCζ CFs co-immunoprecipitate with Bcl10 from NMs of untreated (0 h) and VP-16-treated C4-I cells. Statistical analysis in (A−C): *, P < 0.01 (at least) vs 0 h;**, P < 0.03 (at least) vs 24 h: ***, P < 0.02 vs 48 h. LC, loading control (lamin B1). ab, antibody.

Effects of iRNA Knock-Down of PKCζ or of Bcl10 During VP-16-Induced Apoptosis

To assess the role(s) played by PKCζ•Bcl10 complexes at NMs, we generated C4-I cells in which PKCζ expression was knocked down by iRNA lentiviral constructs (iPKCζ). As controls we used in parallel C4-I cells transduced with a nontarget (nt) iRNA. Immunoblot analysis of TCLs from iPKCζtransduced cells revealed a 70% reduction (P < 0.001) in PKCζ holoprotein and CF levels vs nt-transduced TCLs (Supporting

5B). The Bcl10 phosphorylation curve was linear between 76 and 304 nM and reached its plateau at 609 nM Bcl10. The kinetics of Bcl10 phosphorylation by PKCζ were determined via a double-reciprocal plot, and the calculated Km and Vmax values were 0.657 μM and 8.33 pmol/μg/min, respectively. Bcl10 had been indicated as a possible substrate for PKC,65 and we had shown that r-PKCζ could indeed directly J



Article

Figure 5. (p)-Bcl10 accumulates at NMs isolated from VP-16 (2.0 μg mL−1)-treated whole cells, and PKCζ can directly phosphorylate Bcl10 in a cell-free in vitro system and in nuclei-cytoplasms reconstituted constructs (N−Cs). (A) Endogenous (p)-Bcl10 is loaded at NMs of VP-16-exposed wt C4-I cells. Right panel: A typical immunoblot is shown. Densitometric data of specific protein bands are means ± SE (n = 4) expressed as arbitrary units once normalized taking as 1.0 the values at 0 h. LC, loading control. (B) Left panel: Kinetics of the in vitro phosphorylation of r-Bcl10 effected by r-PKCζ. Increasing amounts of r-Bcl10 were incubated with a fixed amount (40 ng) of active r-PKCζ. The 33P attached to r-Bcl10 was determined as detailed in the Experimental Section. Points are means ± SE (n = 4). Right panel: Kinase reaction products of the in vitro phosphorylation of r-Bcl10 effected by r-PKCζ were resolved by SDS-PAGE, and (p)-Bcl10 was visualized via autoradiography. Thin bands of autophosphorylated r-PKCζ are also visible at the top. (C) Schematic diagram of the four types of N−Cs employed; their setting up is detailed in the Experimental Section. Inh., PKCζ pseudosubstrate inhibitor. (D) Left panel: Both total and (p)-Bcl10 increased at NMs from type (ii), (iii), and (iv) N−Cs as compared with type (i) N−Cs. Center panel: Densitometric data corresponding to Bcl10 and (p)-Bcl10 specific bands from whole N−C experimental sets (n = 4) are shown as means ± SE expressed as arbitrary units once normalized taking as 1.0 the values at 0 h. Right panel: (p)Bcl10/total Bcl10 % ratio values show that the highest rise in (p)-Bcl10 was elicited by active PKCζ at NMs from type (iii) N−Cs; however, the suppression of PKCζ activity by a specific inhibitor revealed an increased Bcl10 translocation onto NMs and heightened Bcl10 phosphorylation there of a similar (P > 0.05) but more modest degree effected by some other kinase(s) in type (ii) and (iv) N−Cs, i.e., independently from VP-16 treatment. Statistical analysis in (A) and (D): *, P < 0.02 (at least) vs 0 h (A) or type (i) N−Cs (D) values. **, P < 0.02 (at least) vs 24 h (A) or type (ii) N−Cs (D) values; ***, P < 0.01 (at least) vs type (iii) N−Cs (D) values. ns, P > 0.05. LC, loading control (lamin B1) in (A) and (D).

and even less with PKCζ CFs (−94%, P < 0.001) (Figure 6A). Notably, we observed that, after a 48 h treatment of iPKCζtransduced cells with VP-16, even the accumulation of Bcl10 at NMs was mostly thwarted (−86%, P < 0.001) with respect to NMs from similarly treated wt cells (Figure 6B, bar 48wt). Thus, besides hindering PKCζ translocation, iPKCζ knock-down prevented the accumulation and phosphorylation (data not shown) of Bcl10 at the NMs, both likely consequences of the suppression of the PKCζ protein expression and activity, whereas the PKCζ-pseudosubstrate inhibitor only blocked PKCζ activity (cf. Figure 5D).

Information Figure S2A). Immunoblot analysis also showed that iPKCζ 0 h NM samples had significantly less (−63%, P < 0.01) intact PKCζ than nt 0 h NM samples, whereas a somewhat higher amount of PKCζ CFs was detected in the former than in the latter samples, a likely consequence of PKCζ knockdown-induced death in some cells16 (Figure 6A). Notably, after 48 h of VP-16 exposure, the amounts of both PKCζ holoprotein and PKCζ CFs increased linearly at NMs from nt-transduced cells just as they did at NMs from similarly treated wt cells (Figure 6A; cf. Figure 3B). As expected, NM samples from iPKCζ-transduced, 48 h VP-16-treated cells were much less loaded with PKCζ holoproteins (−84%, P < 0.001) K



Article

Figure 6. Lentiviral iRNA-mediated knock-down of PKCζ (iPKCζ) curtails the translocation of both PKCζ and Bcl10 and the proteolysis of PKCζ at NMs from VP-16-treated C4-I cells (A, B). Effective lentiviral knock-down of Bcl10 (iBcl10) reduces the translocation of Bcl10 but not of PKCζ while totally preventing any surge of the proteolysis of PKCζ from occurring at NMs from VP-16-treated C4-I cells (C,D). Cells were plated, infected with either lentivirus, selected with puromycin (5.0 μg mL−1), and then VP-16 treated for the time indicated, harvested, and their NMs isolated. Equal amounts (10 μg) of NMs proteins were immunoblotted and challenged with a PKCζ or Bcl10 polyclonal antibody as detailed in the Experimental Section. Representative blots are shown in (A−D). Densitometric data (means ± SE; n = 5) in (A−D) were normalized by taking as 1.0 the value of the corresponding protein at 0 h and expressed in arbitrary units. LC, loading control (lamin B1) in (A−D). In detail: (A) Lentiviral PKCζ suppression strongly curtails the accumulation of both PKCζ holoprotein and CFs at NMs after 24−48 h VP-16 treatment (corresponding to 72−96 h of puromycin selection) vs NMs from nt-transduced cells or wt cells (cf. Figure 3B). #, P < 0.01 (at least) vs nt-transduced cells NMs samples.(B) Lentiviral PKCζ suppression minimizes the accumulation of Bcl10 at NMs from VP-16-treated cells with respect to the huge increase observed at NMs from wt cells after 48 h of VP-16 treatment (bar 48wt, from Figure 4A). #, P < 0.001 vs 48 h wt cells. (C) Between 24 h and 48 h of VP-16 treatment (i.e., between 72 h and 96 h of puromycin selection), lentiviral Bcl10 suppression strongly reduces Bcl10 relocation at NMs vs nttransduced cells or wt cells (cf. Figure 4A). #, P < 0.003 (at least) vs nt-transduced cells. (D) Lentiviral suppression of Bcl10 still allows an increased loading of 66 kDa PKCζ holoprotein but wholly prevents the increased proteolysis of PKCζ from occurring at NMs from VP-16-exposed cells. LC, loading control (lamin B1).

To further clarify the role(s) played by Bcl10 in the PKCζ•Bcl10 complexes at NMs, we generated cells in which Bcl10 expression was knocked down by iRNA lentiviral constructs (iBcl10). As controls we used in parallel nttransduced cells. Immunoblot analysis of TCLs from iBcl10transduced cells revealed an 82% reduction (P < 0.001) in Bcl10 levels vs nt-transduced TCLs (Supporting Information Figure S2B). Likewise, at 0 h (experimental time) NMs from iBcl10-transduced cells contained only ∼12% of the already scanty Bcl10 amount found at NMs from parallel nt-transduced cells (Figure 6C). After treating iBcl10-transduced cells with

VP-16 for 48 h, we observed only a modest increase in Bcl10 associated with NMs, 6-fold lower than that detected at NMs from VP-16-treated nt-transduced cells (Figure 6C; cf. Figure 4A). Most interesting, PKCζ holoproteins accumulated at NMs from iBcl10-transduced VP-16-treated cells just as they did at NMs from VP-16-treated wt cells. Yet, in sharp contrast with the latter, PKCζ CFs levels never surged but steadily remained at their low starting levels at NMs from iBcl10-transduced VP16-treated cells (Figure 6D). L



Article

During VP-16-Induced Apoptosis PKCζ Is Cleaved by Caspase-3 at NMs from wt but Not from iBcl10 Cells

significantly increased (2.0-fold vs 0 h; P < 0.0003) the amount of NM-bound PKCζ holoprotein, while keeping PKCζ CFs at starting levels (P > 0.05 vs 0 h). Conversely, NM-bound PKCζ CFs levels remarkably surged (3.9-fold vs 0 h; P < 0.001) in cells treated with VP-16 in the absence of Z-DQMD-fmk. Thus, PKCζ is a caspase-3 substrate at NMs from VP-16-treated C4-I cells. Moreover, using the specific caspase-3 substrate, Ac-DMQDAMC,58 we noted that similarly increasing levels of caspase-3 activity co-immunoprecipitated with PKCζ from NMs of VP16-treated wt or nt-transduced cells (Figure 7B). Conversely, the caspase-3 activity co-immunoprecipitated with PKCζ from NMs of iBcl10-transduced cells was much lower already at 0 h and increased only marginally (P > 0.05) by 48 h after VP-16 administration, being 13.3-fold lower (P > 0.001) than the corresponding values from wt or nt NM samples (Figure 7B). These results demonstrated that Bcl10/(p)-Bcl10 must associate with PKCζ to make PKCζ proteolysis by caspase-3 possible.

As under VP-16 treatment PKCζ CFs progressively increased at NMs (Figure 3B), and our PMF analysis identified caspase-3 as a protease co-immunoprecipitating with PKCζ from NMs of 24 h VP-16-exposed cells (Figure 1; Table 1), we investigated the interactions between PKCζ and caspase-3 to assess their significance. Previous studies had demonstrated that active caspase-3 cleaves PKCζ in various cell systems.60−62 Therefore, as a first step, we determined whether intact PKCζ was a substrate for active caspase-3 even at NMs from wt C4-I cells. To this aim, cells were treated for 48 h with VP-16 in the presence or absence of a specific caspase-3 inhibitor, Z-DQMDfmk59 and next harvested, and their NMs were isolated. As shown in Figure 7A, combining Z-DQMD-fmk with VP-16

■

DISCUSSION In several recent studies, proteomic approaches have been applied (i) to analyze the effects of anticancer drugs, such as paclitaxel, and cisplatin, on different types of cervical carcinoma cells;67,68 (ii) to establish the proteomic profiles of cervical cancer tissue samples to identify genes/proteins that might play a role in the pathogenesis and development of cervical neoplasia;69,70 and (iii) in cervical cancer treatment to investigate the protein biomarkers associated with sensitivity to concurrent chemoradiotherapy (CCRT) in order to clarify the mechanisms governing CCRT resistance.71 These proteomic approaches to cervical cancer represent extremely valuable efforts aimed at defining the expression of all of the proteins present in cells or tissues samples in the specific disease conditions or reacting upon pharmacological treatments. Our present approach follows a different strategy, being based upon the principles of “functional proteomics”, that is, on the assumption that studying the associations among proteins would indicate their common involvement in a biological function and/or a signaling pathway: in the case in point, the role(s) played by PKCζ at the nuclear envelope of HCC C4-I cells, as this kinase isoform is overexpressed in human squamous cervical cancers,31 C4-I cells (our pilot observations), and HeLa cells.16 In fact, the first aim of the present study was to identify via proteomic analysis the several proteins that at the NMs of C4-I cells interact with PKCζ under proliferative or apoptotic conditions. Thus, we identified 31 PKC-ζ-associated proteins in untreated cells and 33 in VP-16-treated cells, of which only eight, including Bcl10, were present in both kinds of samples. Next, we could assign the PKC-ζ-interacting proteins to eight main functional categories, whose relative percent fractions differed in NM samples from untreated vs VP-16treated cells. In the untreated samples the signal transduction-, mitotic cell cycle regulation-, and transcription control-related protein groups predominated, whereas in the VP-16-treated samples the programmed cell death-regulating protein group had a much larger share, although signaling and transcriptionregulating proteins were still well represented. However, 71.4% of the signaling proteins, 85.7% of the apoptosis-regulating proteins, and 100% of the cell cycle-, transcription regulationrelated and chaperone/adapter proteins were utterly dissimilar in the two cellular conditions (cf. Figure 2A,B and Table 1). According to several reports, PKCζ is considered to act as an

Figure 7. PKCζ is a substrate of caspase-3 at NMs of VP-16-exposed cells, where caspase-3 associates with PKCζ•Bcl10 complexes. However, this association and, hence, PKCζ proteolysis are totally prevented from occurring at NMs by the lentiviral suppression of Bcl10. (A) Caspase-3 inhibitor hinders PKCζ proteolysis at NMs of VP-16-treated cells. A double 60 min exposure (at 30 h [35 μM] and 38 h [80 μM]) to z-DQMD-fmk increased the amount of PKCζ holoenzymes while decreasing that of PKCζ CFs vs VP-16-exposed but inhibitor-untreated cells. After culturing, harvesting, and subfractionation, equal NM protein amounts (10 μg) were immunoblotted with a PKCζ antibody. Representative blots are shown. Densitometric data (means ± SE; n = 10) pertaining to specific protein bands were normalized by taking as 1.0 the 0 h value of the PKCζ holoprotein band and expressed in arbitrary units. LC, loading control (lamin B1). Statistical analysis: *, P < 0.02 (at least) vs 0 h; **, P < 0.001 vs VP-16 alone 48 h. (B) The coincident surges of caspase-3 activity co-immunoprecipitated with PKCζ from NMs of VP-16treated nt-transduced or wt cells, and its reduction to minimal values from NMs of iBcl10 cells. Cells were cultured, infected, selected, and harvested, and their subcellular fractions were isolated; IPs were carried out using equal NM protein amounts (150 μg) and assayed for caspase-3 activity. Statistical analysis: #, P < 0.001 vs wt or nttransduced cells. M



Article

anti-apoptotic protein kinase,37,39,41−43 but others have implicated PKCζ in pro-apoptotic responses.44−46 Our proteomic results may help explain these diverging conclusions, as they show that on the whole PKCζ changes 85.7% of its interacting proteins at NMs of C4-I cells according to the current context. In fact, although single proteins may elicit important signaling responses, the interactions taking place within a signaling complex and the integrated behaviors of multiple complexes are the factors determining the progression of a cellular process such as cell survival or death. It has been proposed that PKC isoforms are able to form different complexes at diverse subcellular locations and their kinase activities induce dynamic changes in the expression profile of these complexes.72 Therefore, our results indicate that PKCζ operates as a role-shifting kinase that interacts with/ phosphorylates the NM proteins/substrates available under untreated or apoptogen-treated conditions. If so, the proteolysis by caspase-3 and consequent inactivation of PKCζ we observed may be one of the final events necessary for the full enactment of apoptosis. In fact, while still active PKCζ may be essential for the sustenance of cell survival in both untreated and VP-16exposed cells, as indicated by the rapid cellular death induced by the addition of a specific PKCζ-pseudosubstrate inhibitor or by PKCζ proteolysis and inactivation or total depletion. Moreover, PKCζ modulates topoisomerase II activity through phosphorylation, thus reducing the synthesis of the cleavable complexes causing persistent DNA breaks and stiffening the cellular resistance to VP-16 toxicity.34,35 In addition, the synthesis of the presumptively anti-apoptotic caspase-2 short (S) isoform is enhanced by PKCζ activity via the inclusion of exon 9 in caspase-2 mRNA, which curtails the topoisomerase inhibitors-stimulated expression of proapoptotic caspase-2 long (L) isoform.36 Finally, PKCζ triggers the NF-κB pathway favoring escape from apoptosis.16,31,37−40 What would Bcl10s role be in this picture? While studying the PKCζ-interacting proteins at NMs our attention was drawn to Bcl10 because (i) it co-immunoprecipitated with PKCζ from NM samples of both untreated and apoptosing cells; (ii) in 2DEs we observed between 0 h and 24 h a shift of both PKCζ and Bcl10 pIs toward more acidic values suggesting posttranslational modifications, e.g., phosphorylations;73 and (iii) Bcl10 is known as a presumptive apoptosis regulatory protein and tumor suppressor gene involved in NF-κB-mediated functions.47−53 So far, Bcl10 has been mainly studied in various types of lymphomas,74 in which it acts as the substrate of several kinases, such as Ca2+·calmodulin-dependent protein kinase II, p38-MAPK, AKT1, PKC, IkB kinase.65,66,75−79 Bcl10 also associates with a number of proteins, e.g., Carma1/ Carma3, MALT1, Bcl3, and TRAF2.52,53,65,66 In particular, in lymphomas Bcl10 partakes with Carma1/Carma3 and Malt1 to the assembly of CBM signalosomes, multiprotein complexes involved in various functions, including the activation of antiapoptotic NF-κB pathway.52,53,64,80 Moreover, it has been shown that Bcl10, once phosphorylated, significantly changes its interactions with various proteins and its subcellular distribution.65,66,75,79,80 On the other hand, using a proteomic approach, we could identify a previously unreported PKCζ•Bcl10 complex, whose amount increased with time at the NMs of apoptosing C4-I cells. Yet, among the PKCζ•Bcl10-interacting proteins at NMs of C4-I cells we found none of those previously known to associate with Bcl10 or to partake with it to the CBM signalosome. Thus, the role(s) played by Bcl10 at NMs of C4-I cells belong(s) to an entirely

new chapter, whose script we have just started deciphering. In brief, our present results are the first evidence that PKCζ increasingly interacts with Bcl10 at NMs of apoptosing C4-I cells and that PKCζ can be added to the group of Bcl10phosphorylating kinases.65,66,75−79 Our findings agree with those of Yui et al.,65 who showed that in 293T cells and in thymocytes the regulators of PKC activity also control the phosphorylation of an overexpressed Bcl10, a covalent modification that changed the Bcl10-binding partners and promoted apoptosis. Additionally, we report here that the specific depletion of PKCζ expression through lentiviral iRNA transactivation prevents most of Bcl10 accumulation at NMs of apoptosing cells, indicating that PKCζ recruits and phosphorylates Bcl10 at NMs. Furthermore, we show that the progressive proteolytic cleavage of PKCζ by caspase-3 otherwise occurring after VP-16 treatment at NMs from wt or nt-transduced cells is suppressed by the specific depletion of Bcl10 expression via iRNA transactivation. Reportedly, in 293T and MCF7 cells, Bcl10 interacts with initiator pro-caspase-9 mediating its autoproteolytic activation through oligomerization, another proapoptotic activity of Bcl10.48 In the same cell types, the downstream effector caspase-3 failed to coimmunoprecipitate with Bcl10.48 The authors noted that this evidence had intrinsic drawbacks because their study was based upon ectopically overexpressed proteins, and the operative mechanism(s) through which Bcl10 induced apoptosis remained unclear.48 In our C4-I cellular model, we neither overexpressed any protein nor detected caspase-9 but found in its place caspase-3 as a member of PKCζ•Bcl10 complexes at NMs of VP-16-treated cells. As for now, we cannot exclude that Bcl10·caspase-9 complexes (and/or CBM signalosomes) might form at subcellular sites other than the NMs and play a role in caspase-3-activation and, indirectly, in PKCζ proteolysis at NMs of apoptosing C4-I cells. Interestingly, when Bcl10 expression was suppressed via iRNA transactivation, we found that PKCζ did not associate with any mounting caspase-3 activity at NMs. This indicates that PKCζ-associated/ phosphorylated Bcl10 is necessary for PKCζ proteolysis by caspase-3 and, hence, for PKCζ inactivation, which would then favor the enactment of cell death. Thus, by interacting with and phosphorylating Bcl10, PKCζ unexpectedly promotes its own destruction; hence, the PKCζ•Bcl10 complexes play a clearly proapoptotic role at NMs of VP-16-treated C4-I cells. We are exploring the further role(s) PKCζ•Bcl10 complexes may play at other subcellular compartments, and even at NMs in proliferating C4-I cells. Therefore, we hope that an increased understanding of PKCζ•Bcl10 functions in C4-I cells will open novel therapeutic avenues to more effectively treat HCCs and hold the view that both PKCζ and Bcl10 constitute molecular targets that may prove useful for novel therapeutic approaches to HCCs.

■

ASSOCIATED CONTENT

S Supporting Information *

Figures S1 and S2 showing some of the features of C4-I cell growth and VP-16-induced apoptosis and the lentiviral iRNAmediated knock-down of PKCζ (iPKCζ) and Bcl10 (iBcl10), respectively, in total cell lysates. This material is available free of charge via the Internet at http://pubs.acs.org. N



■

Article

(10) Zhu, X.; Lv, J.; Yu, L.; Zhu, X.; Wu, J.; Zou, S.; Jiang, S. Proteomic identification of differentially-expressed proteins in squamous cervical cancer. Gynecol. Oncol. 2009, 112, 248−256. (11) Higareda-Almaraz, J. C.; Enríquez-Gasca Mdel, R.; HernándezOrtiz, M.; Resendis-Antonio, O.; Encarnación-Guevara, S. Proteomic patterns of cervical cancer cell lines, a network perspective. BMC Syst. Biol. 2011, 5, 96. (12) Carlson, M. W.; Iyer, V. R.; Marcotte, E. M. Quantitative gene expression identifies appropriate cell line models for individual cervical cancer pathways. BMC Genomics 2007, 8, 117−129. (13) Dempsey, E. C.; Newton, A. C.; Mochly-Rosen, D.; Fields, A. P.; Reyland, M. E.; Insel, P. A.; Messing, R. O. Protein kinase C isozymes and the regulation of diverse cell responses. Am. J. Physiol. Lung Cell. Mol. Physiol. 2000, 279, L429−438. (14) Reyland, M. E. Protein kinase C isoforms: Multi-functional regulators of cell life and death. Front. Biosci. 2009, 14, 2386−2399. (15) Breitkreutz, D.; Braiman-Wiksman, L.; Daum, N.; Denning, M. F.; Tennenbaum, T. Protein kinase C family: on the crossroads of cell signaling in skin and tumor epithelium. J. Cancer Res. Clin. Oncol. 2007, 133, 793−808. (16) Spitaler, M.; Wiesenhofer, B.; Biedermann, V.; Seppi, T.; Zimmermann, J.; Grunicke, H.; Hofmann, J. The involvement of protein kinase C isoenzymes alpha, epsilon and zeta in the in the sensitivity to antitumor treatment and apoptosis induction. Anticancer Res. 1999, 19, 3969−3976. (17) Huang, L.; Muthuswamy, S. K. Polarity protein alterations in carcinoma: a focus on emerging roles for polarity regulators. Curr. Opin. Genet. Dev. 2010, 20, 41−50. (18) Diaz-Meco, M. T.; Dominguez, I.; Sanz, L.; Dent, P.; Lozano, J.; Municio, M. M.; Berra, E.; Hay, R. T.; Sturgill, T. W.; Moscat, J. zeta PKC induces phosphorylation and inactivation of I kappa B-alpha in vitro. EMBO J. 1994, 13, 2842−2848. (19) Mancini, A.; Koch, A.; Whetton, A. D.; Tamura, T. The M-CSF receptor substrate and interacting protein FMIP is governed in its subcellular localization by protein kinase C-mediated phosphorylation, and thereby potentiates M-CSF-mediated differentiation. Oncogene 2004, 23, 6581−6589. (20) Barboule, N.; Lafon, C.; Chadebech, P.; Vidal, S.; Valette, A. Involvement of p21 in the PKC-induced regulation of the G2/M cell cycle transition. FEBS Lett. 1999, 444, 32−37. (21) McCracken, M. A.; Miraglia, L. J.; McKay, R. A.; Strobl, J. S. Protein kinase C delta is a prosurvival factor in human breast tumor cell lines. Mol. Cancer Ther. 2003, 2, 273−281. (22) Filomenko, R.; Poirson-Bichat, F.; Billerey, C.; Belon, J. P.; Garrido, C.; Solary, E.; Bettaieb, A. Atypical protein kinase C zeta as a target for chemosensitization of tumor cells. Cancer Res. 2002, 62, 1815−1821. (23) Way, K. J.; Chou, E.; King, G. L. Identification of PKC-isoformspecific biological actions using pharmacological approaches. Trends Pharmacol. Sci. 2000, 21, 181−187. (24) Nicholson, D. W. Caspase structure, proteolytic substrates, and function during apoptotic cell death. Cell Death Differ. 1999, 6, 1028− 1042. (25) Malhas, A. N.; Vaux, D. J. The nuclear envelope and its involvement in cellular stress responses. Biochem. Soc. Trans. 2011, 39, 1795−1798. (26) Chiarini, A.; Whitfield, J. F.; Pacchiana, R.; Armato, U.; Dal Prà, I. Photoexcited Calphostin C selectively destroys nuclear lamin B1 in neoplastic human and rat cells − A novel mechanism of action of a photodynamic tumor therapy agent. Biochim. Biophys. Acta 2008, 1783, 1642−1653. (27) Dal Prà, I.; Whitfield, J. F.; Chiarini, A.; Armato, U. Changes in nuclear protein kinase C-delta holoenzyme, its catalytic fragments, and activity in polyomavirus transformed pyF111 rat fibroblasts while proliferating and following exposure to apoptogenic topoisomerase-II inhibitors. Exp. Cell Res. 1999, 249, 147−160. (28) Dal Prà, I.; Whitfield, J. F.; Chiarini, A.; Armato, U. Increased activity of the protein kinase C-delta holoenzyme in the cytoplasmic particulate fraction precedes the activation of caspases in poly-

AUTHOR INFORMATION

Corresponding Author

*Tel/Fax: 0039 045 8027159. E-mail: [email protected]. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was funded in part by the Italian Ministry for University and Research (MiUR; FUR 2009/10). We are deeply grateful to Professors Nicole Murray and Alan Fields (Mayo Clinic, Jacksonville, Florida, USA) for useful discussions on lentiviral transduction.

■

ABBREVIATIONS Ac-DMQD-AMC, acetyl-Asp-Met-Gln-Asp-AMC; AMC, 7amido-4-methyl-coumarin; CF, catalytic fragment; 2-DE, twodimensional electrophoresis; HCC, human cervical carcinoma; iBcl10, Bcl10-suppressing lentivirus-transduced; iPKCζ, PKCζsuppressing lentivirus-transduced; IP, immunoprecipitation; LC, loading control; N−Cs, in vitro reconstituted nucleicytoplasms constructs; NM, nuclear membrane fraction; nt, non-target vector-transduced; PMF, peptide mass fingerprinting; (p)-, phospho-; r-, recombinant; SN1, whole cytoplasmic fraction; TCL, total cell lysate; VP-16, etoposide; z-DQMDfmk, z-Asp(OMe)-Gln-Met-DL-Asp(OMe)-fluoromethylketone; wt, wild type

■

REFERENCES

(1) Mukherjee, S.; Dey, S.; Bhattacharya, R. K.; Roy, M. Isothiocyanates sensitize the effect of chemotherapeutic drugs via modulation of protein kinase C and telomerase in cervical cancer cells. Mol. Cell. Biochem. 2009, 330, 9−22. (2) Scarinci, I. C.; Garcia, F. A.; Kobetz, E.; Partridge, E. E.; Brandt, H. M.; Bell, M. C.; Dignan, M.; Ma, G. X.; Daye, J. L.; Castle, P. E. Cervical cancer prevention: new tools and old barriers. Cancer 2010, 116, 2531−2542. (3) Scheffner, M.; Werness, B. A.; Huibregtse, J. M.; Levine, A. J.; Howley, P. M. The E6 oncoprotein encoded by human papillomavirus types 16 and 18 promotes the degradation of p53. Cell 1990, 63, 1129−1136. (4) Boyer, S. N.; Wazer, D. E.; Band, V. E7 protein of human papilloma virus-16 induces degradation of retinoblastoma protein through the ubiquitin-proteasome pathway. Cancer Res. 1996, 56, 4620−4624. (5) von Knebel Doeberitz, M.; Rittmüller, C.; zur Hausen, H.; Dürst, M. Inhibition of tumorigenicity of cervical cancer cells in nude mice by HPV E6-E7 anti-sense RNA. Int. J. Cancer 1992, 51, 831−834. (6) Keating, J. T.; Cviko, A.; Riethdorf, S.; Riethdorf, L.; Quade, B. J.; Sun, D.; Duensing, S.; Sheets, E. E.; Munger, K.; Crum, C. P. Ki-67, cyclin E, and p16INK4 are complimentary surrogate biomarkers for human papilloma virus-related cervical neoplasia. Am. J. Surg. Pathol. 2001, 25, 884−891. (7) Molano, M.; Van den Brule, A.; Plummer, M.; Weiderpass, E.; Posso, H.; Arslan, A.; Meijer, C. J.; Muñoz, N.; Franceschi, S. HPV Study Group. Determinants of clearance of human papillomavirus infections in Colombian women with normal cytology: a populationbased, 5-year follow-up study. Am. J. Epidemiol. 2003, 158, 486−494. (8) Perez-Plasencia, C.; Duenas-Gonzalez, A.; Alatorre-Tavera, B. Second hit in cervical carcinogenesis process: involvement of wnt/beta catenin pathway. Int. Arch. Med. 2008, 1, 10. (9) Kwasniewska, A.; Postawski, K.; Gozdzicka-Jozefiak, A.; Kwasniewski, W.; Grywalska, E.; Zdunek, M.; Korobowicz, E. Estrogen and progesterone receptor expression in HPV-positive and HPVnegative cervical carcinomas. Oncol. Rep. 2011, 26, 153−160. O



Article

omavirus-transformed pyF111 rat fibroblasts exposed to calphostin C or topoisomerase-II inhibitors. Exp. Cell Res. 2000, 255, 171−183. (29) Chiarini, A.; Whitfield, J. F.; Armato, U.; Dal Prà, I. Protein kinase C-βII is an apoptotic lamin kinase in polyomavirus-transformed, etoposide-treated pyF111 rat fibroblasts. J. Biol. Chem. 2002, 277, 18827−18839. (30) Chiarini, A.; Whitfield, J. F.; Armato, U.; Dal Prà, I. VP-16 (etoposide) and calphostin C trigger different nuclear but akin cytoplasmic patterns of changes in the distribution and activity of protein kinase C-beta I in polyomavirus-transformed pyF111 rat fibroblasts. Int. J. Mol. Med. 2006, 17, 111−120. (31) Yu, L. R.; Lv, J. Q.; Jin, L. Y.; Ding, S. D.; Ma, X. Y.; Wang, J. J.; Zhu, X. Q. Over-expression of protein kinase C isoforms (α, δ, θ and ζ) in squamous cervical cancer. Neoplasma 2011, 58, 491−498. (32) Leroy, I.; de Thonel, A.; Laurent, G.; Quillet-Mary, A. Protein kinase C zeta associates with death inducing signaling complex and regulates Fas ligand-induced apoptosis. Cell. Signalling 2005, 17, 1149−1157. (33) Perfetti, A.; Oriente, F.; Iovino, S.; Alberobello, A. T.; Barbagallo, A. P.; Esposito, I.; Fiory, F.; Teperino, R.; Ungaro, P.; Miele, C.; Formisano, P.; Beguinot, F. Phorbol esters induce intracellular accumulation of the anti-apoptotic protein PED/PEA-15 by preventing ubiquitinylation and proteasomal degradation. J. Biol. Chem. 2007, 282, 8648−8657. (34) Reis, C.; Giocanti, N.; Hennequin, C.; Mégnin-Chanet, F.; Fernet, M.; Filomenko, R.; Bettaieb, A.; Solary, E.; Favaudon, V. A role for PKCzeta in potentiation of the topoisomerase II activity and etoposide cytotoxicity by wortmannin. Mol. Cancer Ther. 2005, 4, 1457−1464. (35) Plo, I.; Hernandez, H.; Kohlhagen, G.; Lautier, D.; Pommier, Y.; Laurent, G. Overexpression of the atypical protein kinase C zeta reduces topoisomerase II catalytic activity, cleavable complexes formation, and drug-induced cytotoxicity in monocytic U937 leukemia cells. J. Biol. Chem. 2002, 277, 31407−31415. (36) Solier, S.; De Cian, M. C.; Bettaieb, A.; Desoche, L.; Solary, E.; Corcos, L. PKC zeta controls DNA topoisomerase-dependent human caspase-2 pre-mRNA splicing. FEBS Lett. 2008, 582, 372−378; Erratum. FEBS Lett. 2008, 582, 536. (37) Berra, E.; Diaz-Meco, M. T.; Dominguez, I.; Municio, M. M.; Sanz, L.; Lozano, J.; Chapkin, R. S.; Moscat, J. Protein kinase C zeta isoform is critical for mitogenic signal transduction. Cell 1993, 74, 555−563. (38) Moscat, J.; Rennert, P.; Diaz-Meco, M. T. PKCζ at the crossroad of NF-κB and Jak1/Stat6 signaling pathways. Cell Death Differ. 2006, 13, 702−711. (39) Hirai, T.; Chida, K. Protein kinase Cζ (PKCζ): activation mechanisms and cellular functions. J. Biochem. 2003, 133, 1−7. (40) Lallena, M. J.; Diaz-Meco, M. T.; Bren, G.; Payá, C. V.; Moscat, J. Activation of IkappaB kinase beta by protein kinase C isoforms. Mol. Cell. Biol. 1999, 19, 2180−2188. (41) Brady, S. C.; Allan, L. A.; Clarke, P. R. Regulation of caspase 9 through phosphorylation by protein kinase C zeta in response to hyperosmotic stress. Mol. Cell. Biol. 2005, 25, 10543−10555. (42) Xin, M.; Gao, F.; May, W. S.; Flagg, T.; Deng, X. Protein kinase Cζ abrogates the proapoptotic function of Bax through phosphorylation. J. Biol. Chem. 2007, 282, 21268−21277. (43) Wang, G.; Silva, J.; Krishnamurthy, K.; Tran, E.; Condie, B. G.; Bieberich, E. Direct binding to ceramide activates protein kinase Cζ before the formation of a proapoptotic complex with PAR-4 in differentiating stem cells. J. Biol. Chem. 2005, 280, 26415−26424. (44) Garin, G.; Abe, J.; Mohan, A.; Lu, W.; Yan, C.; Newby, A. C.; Rhaman, A.; Berk, B. C. Flow antagonizes TNF-α signaling in endothelial cells by inhibiting caspase-dependent PKCζ processing. Circ. Res. 2007, 101, 97−105. (45) Nazarenko, I.; Jenny, M.; Keil, J.; Gieseler, C.; Weisshaupt, K.; Sehouli, J.; Legewie, S.; Herbst, L.; Weichert, W.; Darb-Esfahani, S.; Dietel, M.; Schaefer, R.; Ueberall, F.; Sers, C. Atypical protein kinase C ζ exhibits a proapoptotic function in ovarian cancer. Mol. Cancer Res. 2010, 8, 919−934.

(46) Peng, Y.; Sigua, C. A.; Murr, M. M. Protein kinase C-zeta mediates apoptosis of mouse Kupffer cells via ERK-1/2: a novel mechanism. Surgery 2011, 149, 135−142. (47) Willis, T. G.; Jadayel, D. M.; Du, M.-Q.; Peng, H.; Perry, A. R.; Abdul-Rauf, M.; Price, H.; Karran, L.; Majekodunmi, O.; Wlodarska, I.; Pan, L.; Crook, T.; Hamoudi, R.; Isaacson, P. G.; Dyer, M. J. S. Bcl10 is involved in t(1;14)(p22;q32) of MALT B cell lymphoma and mutated in multiple tumor types. Cell 1999, 96, 35−45. (48) Yan, M.; Lee, J.; Schilbach, S.; Goddard, A.; Dixit, V. mE10, a novel caspase recruitment domain-containing proapoptotic molecule. J. Biol. Chem. 1999, 274, 10287−10292. (49) Zhang, Q.; Siebert, R.; Yan, M.; Hinzmann, B.; Cui, X.; Xue, L.; Rakestraw, K. M.; Naeve, C. W.; Beckmann, G.; Weisenburger, D. D.; Sanger, W. G.; Nowotny, H.; Vesely, M.; Callet-Bauchu, E.; Salles, G.; Dixit, V. M.; Rosenthal, A.; Sclegeberer, B.; Morris, S. W. Inactivating mutations and overexpression of BCL10, a caspase recruitment domain-containing gene, in MALT lymphoma with t(1;14) (p22;q32). Nat. Genet. 1999, 22, 63−68. (50) Koseki, T.; Inohara., N.; Chen, S.; Carrio, R.; Merino, J.; Hottiger, M. O.; Nabel, G. J.; Nunez, G. CIPER, a novel NFκBactivating protein containing a caspase recruitment domain with homology to Herpesvirus-2 protein E10. J. Biol. Chem. 1999, 274, 9955−9961. (51) Yoneda, T.; Imaizumi, K.; Maeda, M.; Yui, D.; Manabe, T.; Katayama, T.; Sato, N.; Gomi, F.; Morihara, T.; Mori, Y.; Miyoshi, K.; Hitomi, J.; Ugawa, S.; Yamada, S.; Okabe, M.; Tohyama, M. Regulatory mechanisms of TRAF2-mediated signal transduction by Bcl10, a MALT lymphoma-associated protein. J. Biol. Chem. 2000, 275, 11114−11120. (52) Rosebeck, S.; Rehman, A. O.; Lucas, P. C.; McAllister-Lucas, L. M. From MALT lymphoma to the CBM signalosome. Three decades of discovery. Cell Cycle 2011, 10, 2485−2496. (53) Thome, M. CARMA1, BCL-10 and MALT1 in lymphocyte development and activation. Nat. Rev. Immunol. 2004, 4, 348−359. (54) Kaufmann, S. H. Induction of endonucleolytic DNA cleavage in human acute myelogenous leukemia cells by etoposide, camptothecin, and other cytotoxic anticancer drugs: a cautionary note. Cancer Res. 1989, 49, 5870−5878. (55) Perini, G.; Della Bianca, V.; Politi, V.; Della Valle, G.; Dal Prà, I.; Rossi, F.; Armato, U. Role of p75 neurotrophin receptor in the neurotoxicity by beta-amyloid peptides and synergistic effect of inflammatory cytokines. J. Exp. Med. 2002, 195, 907−918. (56) Emig, S.; Schmalz, D.; Shakibaei, M.; Buchner, K. The nuclear pore complex protein p62 is one of several sialic acid-containing proteins of the nuclear envelope. J. Biol. Chem. 1995, 270, 13787− 13793. (57) Chiarini, A.; Armato, U.; Pacchiana, R.; Dal Prà, I. Proteomic analysis of GTP cyclohydrolase 1 multi-protein complexes in cultured normal adult human astrocytes under both basal and cytokineactivated conditions. Proteomics 2009, 9, 1850−1860. (58) Maianski, N. A.; Roos, D.; Kuijpers, T. W. Bid truncation, bid/ bax targeting to the mitochondria, and caspase activation associated with neutrophil apoptosis are inhibited by granulocyte colonystimulating factor. J. Immunol. 2004, 172, 7024−7030. (59) Bruckheimer, E. M.; Kyprianou, N. Dihydrotestosterone enhances transforming growth factor-β-induced apoptosis in hormone-sensitive prostate cancer cells. Endocrinology 2001, 142, 2419− 2426. (60) Frutos, S.; Moscat, J.; Diaz-Meco, M. T. Cleavage of ζPKC but not λ/ιPKC by caspase-3 during UV-induced apoptosis. J. Biol. Chem. 1999, 274, 10765−10770. (61) Smith, L.; Chen, L.; Reyland, M. E.; Tracie, A.; DeVries, T. A.; Talanian, R. V.; Omura, S.; Smith, J. B. Activation of atypical protein kinase C ζ by caspase processing and degradation by the ubiquitinproteasome system. J. Biol. Chem. 2000, 275, 40620−40627. (62) Smith, L.; Wang, Z.; Smith, J. B. Caspase processing activates atypical protein kinase C ζ by relieving autoinhibition and destabilizes the protein. Biochem. J. 2003, 375, 663−671. P



Article

(63) Ishiuchi, T.; Takeichi, M. Willin and Par3 cooperatively regulate epithelial apical constriction through aPKC-mediated ROCK phosphorylation. Nat. Cell Biol. 2011, 13, 860−866. (64) Bertin, J.; Wang, L.; Guo, Y.; Jacobson, M. D.; Poyet, J.; Srinivasula, S. M.; Merriam, S.; Di Stefano, P.; Alnemri, E. S. CARD11 and CARD14 are novel caspase recruitment domain (CARD)/ membrane-associated guanylate kinase (MAGUK) family members that interact with BCL10 and activate NF-κB. J. Biol. Chem. 2001, 276, 11877−11882. (65) Yui, D.; Yoneda, T.; Oono, K.; Katayama, T.; Imaizumi, K.; Tohyama, M. interchangeable binding of Bcl10 to TRAF2 and cIAPs regulates apoptosis signaling. Oncogene 2001, 20, 4317−4323. (66) Yeh, P. Y.; Kuo, S.-H.; Yeh, K.-H.; Chuang, S.-H.; Hsu, C.-H.; Chang, W. C.; Lin, H.-I.; Gao, M.; Cheng, A.-L. A pathway for tumor necrosis factor-α-induced Bcl10 nuclear translocation. J. Biol. Chem. 2006, 281, 167−175. (67) Lee, K.-H.; Yim, E.-K.; Kim, C.-J.; Namkoong, S.-E.; Um, S.-J.; Park, J.-S. Proteomic analysis of anti-cancer effects by paclitaxel treatment in cervical cancer cells. Gynecol. Oncol. 2005, 98, 45−53. (68) Yim, E.-K.; Lee, K.-H.; Kim, C.-J.; Park, J.-S. Analysis of differential protein expression by cisplatin treatment in cervical carcinoma cells. Int. J. Gynecol. Cancer 2006, 16, 690−697. (69) Bae, S.-M.; Min, H.-J.; Ding, G. H.; Kwak, S.-Y.; Cho, Y.-L.; Nam, K.-H.; Park, C. H.; Kim, Y.-W.; Kim, C.-K.; Han, B.-D.; Lee, Y.J.; Kim, D. K.; Ahn, W.-S. Protein expression profile using twodimensional gel analysis in squamous cervical cancer patients. Cancer Res. Treat. 2006, 38, 99−107. (70) Choi, Y. P.; Kang, S.; Hong, S.; Xie, X.; Cho, N. H. Proteomic analysis of progressive factors in uterine cervical cancer. Proteomics 2005, 5, 1481−1493. (71) Zhu, H.; Pei, H.-P.; Zeng, S.; Chen, J.; Shen, L.-F.; Zhong, M.Z.; Yao, R.-J.; Shen, H. Profiling protein markers associated with the sensitivity to concurrent chemoradiotherapy in human cervical carcinoma. J. Prot. Res. 2009, 8, 3969−3976. (72) Pass, J. M.; Zhang, J.; Vondriska, T. M.; Ping, P. Functional proteomic analysis of the protein kinase C signaling system. In Methods in Molecular Biology; Newton, A. C., Ed.; Humana Press Inc.: Totowa, NJ, 2003; Vol. 233: Protein Kinase C Protocols, pp 369−385. (73) Zhu, K.; Zhao, J.; Lubman, D. M. Protein pI shifts due to posttranslational modifications in the separation and characterization of proteins. Anal. Chem. 2005, 77, 2745−2755. (74) Ye, H.; Dogan, A.; Karran, L.; Willis, T. G.; Chen, L.; Wlodarska, I.; Dyer, M. J.; Isaacson, P. G.; Du, M. Q. BCL10 expression in normal and neoplastic lymphoid tissue. Nuclear localization in MALT lymphoma. Am. J. Pathol. 2000, 157, 1147− 1154. (75) Ishiguro, K.; Ando, T; Goto, H.; Xavier, R. Bcl10 is phosphorylated on Ser138 by Ca2+/calmodulin-dependent protein kinase II. Mol Immunol. 2007, 44, 2095−2100. (76) Bodero, A. J.; Ye, R.; Lees-Miller, S. P. UV-light induces p38 MAPK-dependent phosphorylation of Bcl10. Biochem. Biophys. Res. Commun. 2003, 301, 923−926. (77) Zeng, H.; Di, L.; Fu, G.; Chen, Y.; Gao, X.; Xu, L.; Lin, X.; Wen, R. Phosphorylation of Bcl10 negatively regulates T-cell receptormediated NF-κB activation. Mol. Cell. Biol. 2007, 27, 5235−5245. (78) Thome, M.; Weil, R. Post-translational modifications regulate distinct functions of CARMA1 and BCL10. Trends Immunol. 2007, 28, 281−288. (79) Wegener, E.; Oeckinghaus, A.; Papadopoulou, N.; Lavitas, L.; Schmidt-Supprian, M.; Ferch, U.; Mak, T. W.; Ruland, J.; Heissmeyer, V.; Krappmann, D. Essential role for IkappaB kinase beta in remodeling Carma1-Bcl10-Malt1 complexes upon T cell activation. Mol. Cell 2006, 23, 13−23. (80) Nakamura, K.; Senda, T.; Sato, K.; Mori, S.; Moriyama, M. Accumulation of BCL10 at the perinuclear region is required for the BCL10-mediated Nuclear Factor-kappa B activation. Pathobiology 2005, 72, 191−202.

Q


Role-Shifting PKCÎ¶ Fosters Its Own Proapoptotic ... - ACS Publications

Recommend Documents