Selection and Application of ssDNA Aptamers against Clenbuterol

Feb 6, 2017 - Clenbuterol hydrochloride (CLB) is often abused as additive feed for livestock to decrease adipose tissue deposition and to increase gro...
0 downloads 0 Views 2MB Size
Download PDF
Article pubs.acs.org/JAFC

Selection and Application of ssDNA Aptamers against Clenbuterol Hydrochloride Based on ssDNA Library Immobilized SELEX Nuo Duan,† Wenhui Gong,‡ Shijia Wu,†,§ and Zhouping Wang*,†,∥

Downloaded via KAOHSIUNG MEDICAL UNIV on November 6, 2018 at 11:32:25 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

†

State Key Laboratory of Food Science and Technology, School of Food Science and Technology, Synergetic Innovation Center of Food Safety and Nutrition, Jiangnan University, Wuxi 214122, China ‡ Market Supervision and Administration Bureau, Taicang 215400, China § School of Food and Biological Engineering, Jiangsu University, Zhenjiang 212013, China ∥ National Engineering Research Center of Seafood, School of Food Science and Technology, Dalian Polytechnic University, Dalian 116034, China S Supporting Information *

ABSTRACT: Clenbuterol hydrochloride (CLB) is often abused as additive feed for livestock to decrease adipose tissue deposition and to increase growth rate. It raises a potential risk to human health through the consumption of animal product. In this study, aptamers with higher affinity and specificity were screened through 16 selection rounds based on the ssDNA library immobilized systematic evolution of ligands by exponential enrichment (SELEX) technique. After cloning and sequencing, five aptamer candidates were picked out for affinity and specificity assays based on a graphene oxide (GO) adsorption method. The results showed that the aptamer CLB-2 binds specifically against CLB with a dissociation constant, Kd, value of 76.61 ± 12.70 nM. In addition, an aptamer-based fluorescence bioassay was established for CLB analysis. The correlation between the CLB concentration and fluorescent signal was found to be linear within the range of 0.10 to 50 ng/mL with a limit of detection of 0.07 ng/mL. It has been further applied for the determination of CLB in pork samples, showing its great potential for sensitive analysis in food safety control. KEYWORDS: aptamer, clenbuterol hydrochloride, library immobilization, SELEX

■

INTRODUCTION Clenbuterol hydrochloride (CLB), a kind of β-agonist, is widely used as a bronchodilator, tocolytic, and a heart tonic medication in clinics.1 Unfortunately, CLB has also been used illegally as a veterinary drug or additive for livestock to improve the conversion rate of lean meat and animal growth rate.2,3 Due to long half-life time and slow metabolism, excessive CLB accumulates in the animal and transfers into the human body via animal products.4,5 People who consume food containing CLB over a long period of time would probably experience headaches, palpitations, muscular tremors, and acute poisoning.6 CLB has been forbidden for use as a veterinary drug or additive for animals in many countries.7 Thus, it is urgent to develop a rapid, sensitive, and cost-effective analysis method for CLB detection in animal products for the assurance of consumer health. Currently, instrumental analysis and immunoassays are the main analytical methods available for CLB detection. The instrumental analyses, including high-performance liquid chromatography (HPLC),8 liquid chromatography mass spectrometry (LC-MS),9 and gas chromatography mass spectrometry (GC-MS),10 rely on expensive instruments, complicated sample treatment, and professional personnel operation. Immunoassays, such as enzyme-linked immunoassay (ELISA),11 electrochemical immunoassay,12 and fluorescence immunoassay,13 have advantages of specificity, accuracy, and sensitivity. However, preparation of a specific antibody is a tedious and time-consuming process and has animal ethics © 2017 American Chemical Society

arguments. The stability of antibodies is also susceptible to temperature and other environmental factors.14 An aptamer is a short single-stranded DNA (ssDNA) or RNA sequence that forms a unique spatial conformation, which provides the basis for excellent affinity and specificity toward their targets. Additional advantages of aptamers include selection in vitro, economical and facile synthesis, easy modification, and stability during storage.15 Until now, various aptamers have been isolated by systematic evolution of ligands by exponential enrichment (SELEX) against numerous targets ranging from large cells to small ions.16−18 Whether the target is large cells or small molecules, the protocols for selection of aptamers are based on some type of affinity separation of binding and unbinding sequences. When the target is large bacteria or cells, the binding sequences could be separated from unbinding sequences by centrifugation, which is simple and effective.16 However, when it comes to small molecules, that often means chemically modifying them and then attaching them to the solid-state matrix like magnetic beads or sepharose. Gu et al. reported an aptamer targeted to diclofenac selected by Mag-SELEX.19 Diclofenac was covalently attached to magnetic beads by carboxyl and amine groups. Cruz-Aguado et al. immobilized ochratoxin A on an agarose-based resin to select Received: Revised: Accepted: Published: 1771

November 6, 2016 January 4, 2017 February 5, 2017 February 6, 2017 DOI: 10.1021/acs.jafc.6b04951 J. Agric. Food Chem. 2017, 65, 1771−1777

Article

Journal of Agricultural and Food Chemistry Table 1. Experimental Conditions in Aptamer Selection Against CLB selection round

ssDNA (pmol)

biotin-P1 (pmol)

magnetic beads (μg)

CLB (μM)

incubation time (min)

counter selection

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

1000 100 100 100 100 80 80 80 60 60 40 40 20 20 10 10

1500 150 150 150 150 120 120 120 90 90 60 60 30 30 15 15

2000 200 200 200 200 160 160 160 120 120 80 80 40 40 20 20

100 60 60 60 60 40 40 40 20 20 10 10 5 5 1 1

120 120 120 120 120 90 90 90 90 90 60 60 40 40 30 30

no no no no yes no yes no yes no yes no yes yes yes no

the aptamer to bind to the target.20 However, this chemical modification may change their original structure and make them lose some important sites for aptamer binding. To circumvent this limitation, some target immobilization-free SELEX protocols have emerged, such as GO-SELEX,21 multiGO-SELEX,22 capture-SELEX,23 and switching-SELEX.24,25 Due to the adsorption of GO and ssDNA via π−π stacking, the unbound sequences can be separated from target-bound sequences. Thus, a neither target nor a ssDNA library was needed for immobilization in GO-based SELEX. Both captureSELEX and switching-SELEX are based on a ssDNA library immobilized onto magnetic beads. The ssDNA library is designed to hybridize to a complementary 5-biotinylated DNA on the streptavidin-coated magnetic beads. The target-bound sequences released from the beads due to their structure switching and, therefore, separated from the unbound sequences that remained on the beads. CLB is the kind of small molecule with low molecular weight (313.7 g/mol) and fewer functional groups. Only target immobilization-free SELEX protocols is appropriate for aptamer selection. Therefore, in this work, the ssDNA library immobilized SELEX procedure was applied to screen aptamer binding to CLB specifically. A GO adsorption method was adopted for further research of binding affinity and applicability of aptamers for CLB. This ssDNA library immobilization SELEX protocol avoids the structure change of the target and is much more convenient and effective with the help of a magnetic field. To the best of our knowledge, this is the first public report of aptamer selection against CLB based on the ssDNA library immobilized SELEX. It will build a foundation for aptamer application in CLB detection and provide an alternative method for aptamer selection against small molecules.

■

counter targets (μM)

60 40 20 10 5 5 1

5′-AGCAGCACAGAGGTCAGATG-3′; phosphorylated reverse primer, 5′-(phosphate)-TTCACGGTAGCACGCATAGG-3′; biotin-P1, 5′-bio-AGCACGCATAGG-3′. All PCR reagents and other electrophoresis components were purchased from Sangon Biotechnology Co., Ltd. (Shanghai, China). Clenbuterol hydrochloride, ractopamine, and acrylamide/bisacrylamide 30% solution were purchased from Sigma-Aldrich Company (St. Louis, MO, USA). Salbutamol, epinephrine, and dopamine were purchased from Aladdin Co., Ltd. (Shanghai, China). Norepinephrine and isoprenaline were purchased from TCI Co., Ltd. (Shanghai, China). The lambda exonuclease and 1× lambda exonuclease reaction buffer were purchased from New England Biolabs (Hitchin, UK). Gelred stain solution was purchased from Botium Company (USA). Ultrapure water was from a MilliDirect-Q3 ultrapure water system (Millipore, Bedford, MA). PCR amplification was conducted in a BioRad C1000 thermal cycler (Bio-Rad Co., USA). Gel electrophoresis and imaging were performed in a PowerPac basic power supply and molecular imager gel doc XR + system with Image Lab software (BioRad Co., USA). The concentration of PCR product and the ssDNA pool was qualified by a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Co., USA). The fluorescence intensity of FAMlabeled ssDNA was measured on an F-7000 fluorescence spectrophotometer (Hitachi Co., Japan). Preparation of ssDNA Library Immobilized Magnetic Beads. Amine-functionalized Fe3O4 magnetic beads used for ssDNA library immobilization were prepared according to Wang and Li’s method26 (see Supporting Information). Then the magnetic beads were coated with the avidin based on a classical glutaraldehyde method27 (see Supporting Information). For the ssDNA library immobilization, the biotin-labeled complementary strand P1 (biotin-P1) was designed to pair with the fixed primer area of the ssDNA library. The ssDNA library was mixed with biotin-P1 in a molar ratio of 1:1.5 in binding buffer (50 mM Tris-HCl, 5 mM KCl, 100 mM NaCl, 1 mM MgCl2, pH 7.4). The amount of biotin-P1 in each selection round is shown in Table 1. The mixture was heated at 95 °C for 10 min and transferred promptly to 37 °C for 3 h to finish the complementary hybrid formation. Then, the duplex with a biotin label was immobilized on avidin-coated magnetic beads with a mass ratio of 1:80 at 37 °C for 6 h. The details are shown in Table 1. The library immobilized magnetic beads were washed with binding buffer six times to remove unfixed ssDNA. Aptamer Selection. The ssDNA library immobilized SELEX procedure applied in this study is illustrated in Scheme 1. In the initial selection round, 1 nmol of a random ssDNA library was immobilized on beads and incubated with CLB (100 μM) in binding buffer at 37 °C for 2 h with gentle shaking. An initial incubation volume of 1 mL was used for the first round, and this was decreased to 300 μL for subsequent rounds. During the incubation, the sequences which

MATERIALS AND METHODS

Materials and Instruments. The initial ssDNA random library with 80 nt was synthesized by Integrated DNA Technologies (IDT) (Coralville, IA, USA) with the following sequence: 5′-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3′. The ssDNA library consists of a central 40 nt randomized sequence and a 20 nt fixed primer sequence at two sides. The primers used for amplification and biotin-labeled strand P1 complemented with a ssDNA library were synthesized by Sangon Biotechnology Co., Ltd. (Shanghai, China). The following primers were used: forward primer, 1772

DOI: 10.1021/acs.jafc.6b04951 J. Agric. Food Chem. 2017, 65, 1771−1777

Article

Journal of Agricultural and Food Chemistry

structures, sequences were divided into five families, and the aptamer candidates with highest enrichment and lower free energy of formation ΔG in each family were picked out for the binding assay. Then five sequences were synthesized with a carboxyfluorescein (FAM) fluorescence label at the 5′ end. Aptamer Binding Assay. The affinity and specificity of five sequences binding to CLB were assessed via the adsorption properties of GO. Fluorescence-labeled (5′-FAM) sequences from 10 to 200 nM were incubated with CLB (1 μM) at 37 °C for 2 h in 300 μL of binding buffer. Then, a certain amount of GO (1.5 mg/mL) (the mass ratio between GO and aptamers was 70:1) was added and incubated at 37 °C for 30 min. The complexes of CLB and sequences were collected by centrifugation and obtained for fluorescence analysis. Negative controls without CLB added were used to determine nonspecific binding. The relative fluorescence intensity at different concentrations of sequences was used for plotting the saturation curves and calculating the dissociation constant (Kd) values by GraphPad Prism 5.0 software. To assess the specificity, 200 nM of sequences was incubated with the avidin and structural analogues (salbutamol, ractopamine, epinephrine, dopamine, norepinephrine, and isoprenaline) in 300 μL of binding buffer at 37 °C for 2 h. The concentration of each counter target was fixed at 1 μM. Then, 70 μL of GO (1.5 mg/ mL) was added and incubated at 37 °C for 30 min to adsorb the unbound aptamers. The fluorescence intensity of the complexes of CLB and sequences was measured followed by centrifugation. Detection of CLB Using Aptamer-Based Fluorescence Analysis. An aptamer-based fluorescence assay was established for CLB detection to prove the potential application of aptamers in real samples. Thirty microliters of FAM-labeled aptamer CLB-2 (1 μM), 30 μL of CLB with different concentrations, and 240 μL of binding buffer were mixed and incubated at 37 °C for 2 h. The same sample without CLB was used as a blank control. Then, 35 μL of GO (1.5 mg/mL) was added and incubated 37 °C for 30 min. The mixture was centrifuged at 14 000 rpm for 15 min, and the supernatant was collected and measured on an F-7000 fluorescence spectrophotometer. The detection of CLB in real samples was also studied. Pork was purchased from the local market and pretreated according to the literature with appropriate modifications.28 Five hundred grams of pork was homogenized for 10 min into a smooth paste. Next, 1 mL of CLB standard solutions at different concentration (50 ng/mL, 100 ng/ mL, 500 ng/mL) were individually mixed with 100 g of pork paste and homogenized for 10 min. Then, 2 g of the above homogenized sample was mixed with 1 mL of 0.02 M HCl and centrifuged at 14 000 rpm for 10 min. The supernatant was adjusted to pH 7.4 with 2 M NaOH (5 μL) and centrifuged at 14 000 rpm for 10 min. The supernatant was further filtered with a 0.45 μm filtration membrane and collected for the next assay.

Scheme 1. Selection Procedure of the ssDNA Library Immobilized SELEX Technique

bound with CLB were broken away from the duplex and released from the beads. The ssDNA−CLB complexes were separated by using magnetic force and collected to serve as a template to be amplified by PCR. A 50 μL PCR mixture consisted of 5 μL of ssDNA template, 1 μL of forward primer (5 μM), 1 μL of reverse primer (5 μM), 1 μL of dNTP (5 mM), 0.5 μL of Taq DNA polymerase (5 U/μL), 5 μL of 1× PCR buffer, and 36.5 μL of ultrapure water. The thermal cycle parameter was denatured at 94 °C for 5 min, followed by 19 cycles of denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, and extension at 72 °C for 30 s, then extension at 72 °C for 2 min and cooled at 4 °C. Next, 8% polyacrylamide gel electrophoresis was used to separate PCR products. After being stained with Gel-red, the gel was photographed under UV light to confirm the 80 bp size of PCR products. The PCR products were purified with a phenol chloroform method. To obtain the ssDNA pool for the next selection round, a phosphorylated reverse strand of double-stranded DNA was digested by lambda exonuclease. The concentration of purified PCR product was quantified by a NanoDrop 2000 spectrophotometer to calculate the amount of lambda exonuclease and exonuclease reaction buffer. The digestion was conducted at 37 °C for 30 min, 75 °C for 10 min, and then identified by 8% denaturing polyacrylamide gel electrophoresis. The digestion products were purified by a phenol chloroform method and used for the sublibrary in the next selection rounds. To increase the selection pressure, experimental conditions were changed in each round. As shown in Table 1, the concentration of the ssDNA pool was reduced from 1000 to 10 pmol; CLB was reduced from 100 to 1 μM, and the incubation time was reduced from 120 to 30 min from the first to the 16th selection rounds. To eliminate nonspecific binding, the counter SELEX process was employed by using avidin and analogues including salbutamol, ractopamine, epinephrine, dopamine, norepinephrine, and isoprenaline in the fifth, seventh, ninth, 11th, 13th, 14th, and 15th selection rounds. These counter targets were first mixed with the ssDNA library immobilized beads at 37 °C for 2 h in 300 μL of binding buffer. The supernatant containing nonspecific ssDNAs bound to counter targets was removed by magnetic force. Then, the beads were collected and washed with binding buffer six times and incubated with CLB. The subsequent procedures were the same with the positive SELEX, and the experimental conditions are shown in Table 1. Cloning and Sequencing. The aptamers binding with CLB were enriched after 16 selection rounds, and the PCR products were cloned to obtain sequences by Sangon Biotechnology Co., Ltd. (Shanghai, China). The homology of sequences was analyzed with DNAMAN software, and their secondary structures were predicted by RNA structure software v4.60. Based on the homology and secondary

■

RESULTS AND DISCUSSION ssDNA Library Immobilized SELEX for Evolution of CLB Aptamers. The amount of ssDNA immobilized on the beads has a great impact on the library variety, which is important for the selection. Therefore, the amount of beads used for immobilization was optimized by using UV−vis absorption spectroscopy. As shown in Figure 1, a strong absorbance of the aptamer can be seen at 260 nm before conjugation to beads (black curve). After the ssDNA library was immobilized on the beads, the supernatant was collected by magnetic separation. The absorbance of the supernatant liquor was weaker at 260 nm with the increase of beads. When the mass ratio between the beads and the library reached 80:1, the absorption of free ssDNA in the supernatant tended to zero, indicating that the complementary ssDNA library was completely immobilized on the beads. Therefore, the mass ratio of 80:1 between the beads and the library was used for ssDNA library immobilization. 1773

DOI: 10.1021/acs.jafc.6b04951 J. Agric. Food Chem. 2017, 65, 1771−1777

Article

Journal of Agricultural and Food Chemistry

Figure 3. Concentration ratio (PCR products concentration of bound ssDNA/blank control) measured by Image Lab software.

Figure 1. Optimization of the mass ratio between magnetic beads and the ssDNA library for immobilization.

concentration ratio increased, except for the fifth, seventh, ninth, 11th, and 13th rounds, which were count-SELEX rounds with decreased concentration ratios. The concentration ratio reached a maximum on the 16th round and started to saturate at the 17th. Besides, the PCR band of bound ssDNA was much brighter than that of the blank control in the 16th and 17th selection rounds (Figure S1). Therefore, the purified PCR products in the 16th round were cloned and sequenced. Determination of Binding Affinity and Specificity. Forty sequences were obtained by cloning and sequencing, and five families were grouped based on homology and secondary structures. One representative aptamer candidate with high enrichment and lower energy was synthesized with a FAM label for the binding assay from each family. The binding assay was carried out according to the adsorption of the aptamer on GO, which is induced by a π−π stacking interaction between the exposed nucleobases and GO. As shown in Figure S2, in the presence of the CLB, the conformation of aptamer candidates was changed and cannot be adsorbed by GO. However, the conformation of unbound sequences was not changed and adsorbed by GO. The higher the fluorescence intensity, the better the affinity of aptamer used. As shown in Table 2, the Kd value of aptamer CLB-2 (76.61 ± 12.70 nM) was lower than that of other aptamers, indicating the better affinity to CLB. The saturation curve and predicted secondary structure are

As the selection proceeded, the selection pressure was gradually increased, including the reduction of the ssDNA pool for immobilization, the decrease of the concentration of CLB, and the contraction of incubation time. During the incubation, the bound ssDNA folded into three-dimensional conformations, resulting in the breakage of hydrogen bonds between ssDNA and biotin-P1. The bound ssDNA released from the beads, and the unbound ssDNA was still immobilized on the beads via base pairing with biotin-P1. The ssDNA-CLB complexes were collected by magnetic separation and served as the template for PCR amplification. As shown in Figure 2, the PCR products of 16 selection rounds were pure bands, with the correct size in polyacrylamide gel electrophoresis (PAGE) indicating that the bound ssDNA was amplified successfully in each round. As the selection evolved, more ssDNA was released from the beads, and the CLB-bound ssDNA was enriched, leading to an increased concentration of the template for amplification. As a result, the concentration of PCR products is higher than that of the blank control under the same PCR conditions. Thus, the concentration ratio (PCR product concentration of bound ssDNA/blank control) measured by Image Lab software was used to investigate the efficiency of enrichment for each round. As shown in Figure 3, with increasing rounds of selection, the

Figure 2. Polyacrylamide gel electrophoresis of PCR products from the first round to 16th round. 1774

DOI: 10.1021/acs.jafc.6b04951 J. Agric. Food Chem. 2017, 65, 1771−1777

Article

Journal of Agricultural and Food Chemistry Table 2. Sequence (5′−3′) and Dissociation Constant (Kd) Values of Aptamer Candidates

Kd (nM)

no.

sequences

CLB-1 CLB-2 CLB-3 CLB-4 CLB-5

AGCAGCACAGAGGTCAGATGATAATGTATTGTAATATTATATTATAGAATTAATCAATTTCCTATGCGTGCTACCGTGAA AGCAGCACAGAGGTCAGATGTCATCTGAAGTGAATGAAGGTAAACATTATTTCATTAACACCTATGCGTGCTACCGTGAA AGCAGCACAGAGGTCAGATGATCCAAGTAGGTGTCACCTTAACAACTCTTTGAATTTATCCCTATGCGTGCTACCGTGAA AGCAGCACAGAGGTCAGATGAATTTGCATAACAATATCAACTGAGGATTACCCTCAGCATCCTATGCGTGCTACCGTGAA AGCAGCACAGAGGTCAGATGTATGACAACATAGTCTTACATTCTATGACATTCGTGATGCCCTATGCGTGCTACCGTGAA

173.4 76.61 938.3 571.8 347.4

± ± ± ± ±

59.81 12.70 509.0 156.0 161.1

Figure 4. Secondary structure predicted by RNA structure software v4.60 and the corresponding saturation curve of aptamer CLB-2.

Aptamer-Based Fluorescent Bioassay for CLB Detection. To demonstrate the potential use of the aptamer CLB-2 in the quantitative determination of CLB, a fluorescent bioassay was established based on the GO adsorption method. The increased fluorescence intensity generated by the FAM-labeled aptamer was observed depending on the increased concentration of CLB. As shown in Figure 6, a strong linear correlation (y = 101.46x + 211.36, R2 = 0.9927) was obtained between the relative fluorescence intensity and the concentration of CLB ranging from 0.10 to 50 ng/mL. The limit of detection (LOD) was 0.07 ng/mL, as estimated by the equation LOD = 3SD/ slope, where SD represents the standard deviation of blank samples, and the slope was obtained from the calibration curve. The accuracy of the measurements was also evaluated by determining the recovery of CLB in the spiked pork samples. As shown in Table 3, the recovery rate was between 98.88 and 109.40%, demonstrating that the developed aptasensor can be applied to the quantitative determination of CLB in the real samples. In this work, we successfully developed a ssDNA library immobilized SELEX procedure by attaching the ssDNA library to magnetic beads via a complementary DNA to their constant region to screen the aptamer against CLB. This strategy is wellsuited for small molecule aptamer selection because it would not change the native structure of the target. Among the

shown in Figure 4. Then, aptamer CLB-2 was evaluated by the specificity assay. As shown in Figure 5, the relative fluorescence intensity of CLB is much higher than that of avidin and other analogues, indicating the high specificity of aptamer CLB-2.

Figure 5. Specificity evaluation of aptamer CLB-2 against CLB. 1775

DOI: 10.1021/acs.jafc.6b04951 J. Agric. Food Chem. 2017, 65, 1771−1777

Article

Journal of Agricultural and Food Chemistry

Foundation (2016T90430), and Collaborative innovation center of food safety and quality control in Jiangsu Province. Notes

The authors declare no competing financial interest.

■

(1) Zhang, Z. H.; Duan, F. H.; He, L. H.; Peng, D. L.; Yan, F. F.; Wang, M. H.; Zong, W.; Jia, C. X. Electrochemical clenbuterol immunosensor based on a gold electrode modified with zinc sulfide quantum dots and polyaniline. Microchim. Acta 2016, 183, 1089−1097. (2) Meyer, H. H.; Rinke, L. M. The pharmacokinetics and residues of clenbuterol inveal calves. J. Anim. Sci. 1991, 69, 4538−4544. (3) Xiao, R. J.; Xu, Z. R.; Chen, H. L. Effects of ractopamine at different dietary protein levels on growth performance and carcass characteristics in finishing pigs. Anim. Feed Sci. Technol. 1999, 79, 119− 127. (4) Degand, G.; Bernes-Duyckaerts, A.; Maghuin-Rogister, G. Determination of clenbuterol in bovine tissues and urine by enzyme immunoassay. J. Agric. Food Chem. 1992, 40, 70−75. (5) Li, F.; Feng, Y.; Zhao, C.; Li, P.; Tang, B. A sensitive graphene oxide−DNA based sensing platform for fluorescence turn-on detection of bleomycin. Chem. Commun. 2012, 48, 127−129. (6) Tang, Y. W.; Gao, Z. Y.; Wang, S.; Gao, X.; Gao, J. W.; Ma, Y.; Liu, X. Y.; Li, J. R. Upconversion particles coated with molecularly imprinted polymers as fluorescence probe for detection of clenbuterol. Biosens. Bioelectron. 2015, 71, 44−50. (7) Bo, B.; Zhu, X. J.; Miao, P.; Pei, D.; Jiang, B.; Lou, Y.; Shu, Y. Q.; Li, G. X. An electrochemical biosensor for clenbuterol detection and pharmacokinetics investigation. Talanta 2013, 113, 36−40. (8) Eddins, C.; Hamann, J.; Johnson, K. HPLC analysis of clenbuterol, a beta-adrenergic drug, in equine urine. J. Chromatogr. Sci. 1985, 23, 308−312. (9) Wasch, K. D.; Brabander, H. D.; Courtheyn, D. LC-MS-MS to detect and identify four beta-agonists and quantify clenbuterol in liver. Analyst 1998, 123, 2701−2705. (10) Ramos, F.; Matos, A.; Oliveira, A.; da Silveira, M. I. N. Diphasic dialysis extraction technique for clenbuterol determination in bovine retina by gas chromatography-Mass spectrometry. Chromatographia 1999, 50, 118−120. (11) Ren, X. F.; Zhang, F. M.; Chen, F. J.; Yang, T. B. Development of a sensitive monoclonal antibody-based ELISA for the detection of clenbuterol in animal tissues. Food Agric. Immunol. 2009, 20, 333−344. (12) Lai, Y. J.; Bai, J.; Shi, X. H.; Zeng, Y. B.; Xian, Y. Z.; Hou, J.; Jin, L. T. Graphene oxide as nanocarrier for sensitive electrochemical immunoassay of clenbuterol based on labeling amplification strategy. Talanta 2013, 107, 176−182. (13) Bacigalupo, M. A.; Meroni, G.; Secundo, F.; Scalera, C.; Quici, S. Antibodies conjugated with new highly luminescent Eu3+ and Tb3+ chelates as markers for time resolved immunoassays application to simultaneous determination of clenbuterol and free cortisol in horse urine. Talanta 2009, 80, 954−958. (14) Kaminski, R. W.; Clarkson, K.; Kordis, A. A.; Oaks, E. V. Multiplexed immunoassay to assess Shigella-specific antibody responses. J. Immunol. Methods 2013, 393, 18−29. (15) Duan, N.; Wu, S. J.; Chen, X. J.; Huang, Y. K.; Xia, Y.; Ma, X. Y.; Wang, Z. P. Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium systemic evolution of ligands by exponential enrichment (SELEX). J. Agric. Food Chem. 2013, 61, 3229−3234. (16) Duan, N.; Ding, X. Y.; He, L. X.; Wu, S. J.; Wei, Y. X.; Wang, Z. P. Selection, identification and application of a DNA aptamer against Listeria monocytogenes. Food Control 2013, 33, 239−243. (17) Tang, Z. W.; Shangguan, D. H.; Wang, K. H.; Shi, H.; Sefah, K.; Mallikratchy, P.; Chen, H. W.; Li, Y.; Tan, W. H. Selection of aptamers for molecular recognition and characterization of cancer cells. Anal. Chem. 2007, 79, 4900−4907.

Figure 6. Standard curve between the relative fluorescence intensity and the concentrations of CLB.

Table 3. Recovery of CLB in Pork Samples by AptamerBased Fluorescent Bioassay spiked concentration (μg/kg)

detected concentration mean ± SD (μg/kg)

recovery rates (%)

0.50 1.00 5.00

0.504 ± 0.023 1.094 ± 0.098 4.944 ± 0.178

100.80 109.40 98.88

aptamer candidates, CLB-2 was identified as the optimal aptamer probe with the dissociation constant (Kd) of 76.61 ± 12.70 nM by GO adsorption assessment. An aptamer-based fluorescent method was established to confirm the potential application of the CLB-2 as high affinity and specificity recognition receptors for CLB detection in pork samples. This work demonstrated the feasibility of the aptamer of CLB for food safety control and provided an alternative select strategy for aptamer selection against small molecules, especially those that lack enough sites for immobilization.

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.jafc.6b04951. Synthesis and modification of amine-functionalized Fe3O4 magnetic beads, the PCR band of 16th and 17th selection round, binding assay procedure, and the optimization of GO concentration (PDF)

■

REFERENCES

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected] or [email protected]. ORCID

Zhouping Wang: 0000-0002-3868-8125 Funding

This work was partially supported by Key Research and Development Program of Jiangsu Province BE2016306, the National Science and Technology Support Program of China (2015BAD17B02), the Natural Science Foundation of Jiangsu Province BK20140155, National Natural Science Foundation of China (NSFC) 31401575, China Postdoctoral Science 1776

DOI: 10.1021/acs.jafc.6b04951 J. Agric. Food Chem. 2017, 65, 1771−1777

Article

Journal of Agricultural and Food Chemistry (18) Eissa, S.; Ng, A.; Siaj, M.; Tavares, A. C.; Zourob, M. Selection and Identification of DNA Aptamers against Okadaic Acid for Biosensing Application. Anal. Chem. 2013, 85, 11794−11801. (19) Joeng, C. B.; Niazi, J. H.; Lee, S. J.; Gu, M. B. ssDNA aptamers that recognize diclofenac and 2-anilinophenylacetic acid. Bioorg. Med. Chem. 2009, 17, 5380−5387. (20) Cruz-Aguado, J. A.; Penner, G. Determination of ochratoxin A with a DNA aptamer. J. Agric. Food Chem. 2008, 56, 10456−10461. (21) Park, J. W.; Tatavarty, R.; Kim, D. W.; Jung, H. T.; Gu, M. B. Immobilization-free screening of aptamers assisted by graphene oxide. Chem. Commun. 2012, 48, 2071−2073. (22) Nguyen, V. T.; Kwon, Y. S.; Kim, J. H.; Gu, M. B. Multiple GOSELEX for efficient screening of flexible aptamers. Chem. Commun. 2014, 50, 10513−10516. (23) Spiga, F. M.; Maietta, P.; Guiducci, C. More DNA−Aptamers for Small Drugs: A Capture−SELEX Coupled with Surface Plasmon Resonance and High-Throughput Sequencing. ACS Comb. Sci. 2015, 17, 326−333. (24) Oh, S. S.; Plakos, K.; Lou, X. H.; Xiao, Y.; Soh, H. T. In vitro selection of structure-switching self-reporting aptamers. Proc. Natl. Acad. Sci. U. S. A. 2010, 107, 14053−14058. (25) Nutiu, R.; Li, Y. F. In vitro selection of structure-switching signaling aptamers. Angew. Chem., Int. Ed. 2005, 44, 1061−1065. (26) Wang, L. Y.; Bao, J.; Wang, L.; Zhang, F.; Li, Y. D. One-pot synthesis and bioapplication of amine-functionalized magnetite nanoparticles and hollow nanospheres. Chem. - Eur. J. 2006, 12, 6341−6347. (27) Hun, X.; Zhang, Z. J. Functionalized fluorescent core-shell nanoparticles used as a fluorescent labels in fluoroimmunoassay for IL6. Biosens. Bioelectron. 2007, 22, 2743−2748. (28) Anhui Provincial Standard: Detection of residues of clenbuterol hydrochloride in animal tissues using ELISA (DB34/T 823-2008).

1777

DOI: 10.1021/acs.jafc.6b04951 J. Agric. Food Chem. 2017, 65, 1771−1777