Selection and Characterization of Aptamers ... - ACS Publications

Subscriber access provided by George Washington University Libraries

Article

Selection and characterization of aptamers using a modified Whole-Cell Bacterium SELEX for the detection of Salmonella enterica serovar Typhimurium Padma Sudha Rani Lavu, Bhairab Mondal, Shylaja Ramlal, Harishchandra Sreepathy Murali, and Harsh Vardhan Batra ACS Comb. Sci., Just Accepted Manuscript • DOI: 10.1021/acscombsci.5b00123 • Publication Date (Web): 12 Apr 2016 Downloaded from http://pubs.acs.org on April 16, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Combinatorial Science is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Combinatorial Science

Title: Selection and characterization of aptamers using a modified Whole-Cell Bacterium SELEX for the detection of Salmonella enterica serovar Typhimurium Author’s information: Padma Sudha Rani Lavu (First author) Principle Investigator (WOS-A) Defence Food Research Laboratory (DFRL), Mysore-570011 Email: [email protected] Bhairab Mondal Senior Research Fellow, (Inspire fellow, DST) Defence Food Research Laboratory (DFRL), Mysore-570011 Email: [email protected] Dr. Shylaja Ramlal (Corresponding author) Scientist ‘D’ Defence Food Research Laboratory (DFRL), Mysore-570011 Email: [email protected] Dr. Harishchandra Sreepathy Murali, Scientist ‘F’ Head, Microbiology division, Defence Food Research Laboratory (DFRL), Mysore-570011 Email: [email protected] Dr. Harsh Vardhan Batra, Outstanding Scientist, Director, Defence Food Research Laboratory (DFRL), Mysore-570011 Email: [email protected]

1 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 28

Abstract This study describes the selection of single-stranded DNA (ssDNA) aptamers against Salmonella enterica serovar Typhimurium using a modified whole cell systematic evolution of ligands by exponential enrichment (whole cell SELEX). To evolve specific aptamers, ten rounds of selection to live Salmonella cells, alternating with negative selection against a cocktail of related pathogens were performed. The resulting highly enriched oligonucleotide pools were sequenced and clustered into eight groups based on primary sequence homology and predicted secondary structure similarity. Fifteen sequences from different groups were selected for further characterization. The binding affinity and specificity of aptamers were determined by fluorescence binding assay. Aptamers (SAL 28, SAL 11, and SAL 26) with dissociation constants of 195±46 nM, 184±43 nM, and 123±23 nM were used to develop a nanogold-based colorimetric detection method and a sedimentation assay. The former showed the better sensitivity limit of 102 CFU/mL using aptamer SAL 26. This approach should enable further refinement of diagnostic methods for the detection of Salmonella enterica serovar Typhimurium and of other microbial pathogens.

Keywords: whole cell SELEX, DNA aptamer, Salmonella Typhimurium, fluorescence, gold nanoparticle Introduction Salmonella enterica serovar Typhimurium is one of the most harmful enteric pathogens, a leading cause of the food borne illness salmonellosis in infants, the elderly, and immunocompromised persons [1, 2]. The inspection of food for the presence of Salmonella has become routine all over the world [3, 4]. Human salmonellosis is usually associated with the consumption of Salmonella-contaminated foods mostly originating from animal sources such as poultry, eggs, milk and beef but also non-animal sources such as vegetables, fruits, and spices [5]. Various methods have been developed for the detection of Salmonella. Conventional culture methods can detect Salmonella through sequential steps of pre-enrichment, selective enrichment, and selective differential plating, but they are labour intensive and require a week to determine and corroborate contamination at quantitative and qualitative levels [6]. Molecular techniques such as PCR can minimize the time, but they are not highly sensitive or specific because residual matrix-associated inhibitors often compromise molecular detection [7, 8]. 2 ACS Paragon Plus Environment

Page 3 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Immunological assays show excellent detection limits [9-11], but suffer from different immunological responses in people exposed to the bacteria, and from lack of antibody stability in some environments [12, 13]. Aptamers are single stranded DNA or RNA molecules which form stable and specific complexes with target molecules with affinities and selectivities that can rival those of antibodies for applications in target capture and detection [14-16]. Several characteristics of aptamers make them attractive for pre-analytical sample processing and bio diagnostic assay development, including their small size, ease of synthesis and labeling, lack of immunogenicity, low cost of production and good target binding affinity and specificity [17]. Aptamers specific to a wide range of protein and non-protein targets have been identified using a method termed systematic evolution of ligands by exponential enrichment (SELEX) [18-21]. Live pathogen cells can be targeted in SELEX, in which case the entirety of the cell surface is presented as a target in native conformation [25, 27]. Although more complex, the target is therefore easier to produce than a purified cell-surface marker, and separation of unbound aptamers from bound aptamers is conveniently done by simple centrifugation [23-27]. In this study, we developed aptamers against live whole cells of Salmonella enterica serovar Typhimurium by utilizing a modified and rapid whole-cell SELEX method employing four other Salmonella serovars and other bacterial cells as targets for negative selection. This ensures the high specificity needed to meet the requirement of practical detection. Binding constants of individual aptamers were assessed by a fluorescence binding assay, and an aptamer-based sedimentation assay and a nanogold-predicated colorimetric assay were developed to demonstrate the potential use of the aptamers to bacterial capture for direct detection and confocal microscopy based imaging. The molecules bound by each aptamer were not identified, but are likely to be found among the lipopolysaccharide, outer membrane proteins, or surface-displayed lipoproteins. Results Asymmetric PCR In this study, asymmetric PCR was performed for the amplification of aptamer pools. The number of PCR cycles was also optimized to avoid over amplification, which is evidenced by misannealed products. Asymmetric PCR preferentially increased the target ssDNA and decreased the primer dimers as well as non-specific amplification. As shown in supporting Fig.S2, optimization



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 28

reactions illustrated a sharp band of expected base size (agarose gel analysis) with a primer ratio at 1.6:0.4 (Forward: Reverse) after 30 cycles. Whole Cell-SELEX for Evolution of Salmonella enterica serovar Typhimurium-Specific Aptamers A standard DNA SELEX procedure of selection and amplification was performed to identify aptamers against Salmonella enterica serovar Typhimurium, as described in detail in (Supporting Information.5). Ten rounds of SELEX were performed, including three rounds of counterselection against a mixture of closely related organisms at rounds 2, 4, and 7, to isolate the aptamers that could favorably bind to target cells with high specificity. After each round of selection, observation of a target band on the gel after PCR amplification suggested that aptamer candidates could bind Salmonella enterica serovar Typhimurium and no amplified DNA was detected in the negative control, which consisted of cells that underwent incubation, washing and heat elution, but without addition of the ssDNA library. The enrichment of cell-bound aptamers was monitored during each round of selection by measuring eluent DNA concentration relative to a constant concentration of DNA used in each incubation (Supporting Fig.S3) and the fluorescence labeled DNA (Fig.1). These measurements showed an increase in the fraction of the aptamer pool able to bind to the target cells in each round. The stringency of the selection was controlled by adjusting the target cell concentrations, incubation times and washes. After the final round of selection, the purified PCR products of the last eluted ssDNA aptamers were cloned into E. coli TOP10 cells. Cloning, Sequencing and Structural Analysis of Aptamer Candidates A total of 32 sequences were obtained by random selection of E. coli cells transformed in the previous step. As shown in Fig. 2, alignment analysis performed with CLUSTALW revealed 6098 % sequence homology and some aptamers (such as SAL 10, 11, 25, 37, and 43) were 1-4 nucleotides shorter than the initial library. The secondary structures of these aptamers were predicted using the Mfold online server (Supporting Fig.S6). Based on the sequence homology and stable secondary structure analysis, the selected aptamers could be divided into eight phylogenetic groups (Supporting Fig.S4); Jalview analysis discovered the presence of few nucleotide conserved regions in each group that may play a role in target epitope binding (Supporting Fig.S5). Three aptamers with among the most stable predicted folded structures (lowest Gibbs free energy) are shown in Fig 3. Fifteen candidate aptamer sequences out of the 4 ACS Paragon Plus Environment

Page 5 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


eight groups were chosen for further characterization with one to three sequences from each group (Table 1). Relative Binding Affinity and Specificity In order to assess the relative binding affinities and selectivities of the above aptamers, each was made with a FITC labeled at the 5’end, and was incubated in large excess (250 nM) with a constant cell concentration (5 × 106 CFU/mL) of Salmonella enterica serovar Typhimurium. After washing away unbound aptamer, the fluorescence intensity of bound sequences eluted from the cells provided a rough estimation of the relative binding affinity of each. The same analysis was performed with each of the closely associated organisms used in the negative selections. The results shown in Fig. 4 show that each sequence bound significantly better to the target bacterium than to the control species. The random DNA sequence library pool showed no significant binding towards the target species, ruling out binding by non-specific polyanionic effects. Apparent dissociation constants determined by titration (Fig.5) showed similar affinities (Kd = 100-300 nM) for the seven aptamers tested (Table 2). The three highest-affinity binders (SAL 28, SAL 11, and SAL 26) were chosen for further characterization and development of aptamer based detection assays. Fluorescence Imaging and Enzyme Linked Aptamer Sedimentation Assay (ELASA) Excess (250 nM) FITC- and biotin-labeled aptamers (SAL 28, SAL 11, and SAL 26) were incubated separately with Salmonella enterica serovar Typhimurium cells (5 × 106 CFU/mL) and the related bacterial cells used for negative selections. As shown in Fig 6, the fluorescently labeled aptamers bound much better to the target Salmonella species. The same observation was made by incubating the biotinylated aptamer (after washing excess aptamer away) with streptavidin conjugated horseradish peroxidase (Supporting Fig.S7). Dilution of the Salmonella cells in the biotinylated aptamer assay established the detection limit of this assay as approximately 103 CFU/mL (Fig.7, supporting Fig.S8). Gold NanoParticle Based Colorimetric Detection of Salmonella enterica serovar Typhimurium To enhance detection sensitivity further, aptamer SAL 26 was used to test the applicability of this novel strategy. The red-colored AuNPs (20 nm in diameter) have an intense SPR absorption located at 520 nm. AuNPs were stabilized by the adsorbed citrate anion at the surface and are readily aggregated in the presence of 50 mM NaCl, which screens the electrostatic repulsion 5 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 28

between particles. Such aggregation shifts the SPR absorption to the longer wavelength, resulting in the characteristic red-blue color change. Interestingly, with the selected aptamer (SAL 26, 250 nM) alone, AuNPs retained the red color upon the addition of 50 mM NaCl (Fig. 8B) because of highly negatively charged ssDNA spontaneously binds to AuNPs through interactions between gold and nitrogen containing bases, and effectively stabilizes AuNPs against salt-induced aggregations. However, in the presence (5 × 106 CFU/mL) of Salmonella enterica serovar Typhimurium, the AuNPs solution readily turned blue (Fig. 8B). This color change suggests that selected aptamer (SAL 26) form a tertiary structure along with target cell which does not possess an affinity to AuNPs results in salt-induced aggregation. It is also important to note that the assay is fairly rapid and can be finished within 30 min. A series of control experiments were carried out to confirm that such a color change was only specific to the binding of Salmonella enterica serovar Typhimurium with its aptamers. Firstly, Salmonella enterica serovar Typhimurium itself did not show any visible effect on AuNPs, even high concentrations of Salmonella enterica serovar Typhimurium (5 × 108 CFU/mL), the color of AuNPs remains the same as prepared (supporting Fig.S9). Secondly, when selected aptamer (SAL 26) was replaced with only random sequence, no color change was observed over a wide range of concentrations Salmonella enterica serovar Typhimurium cells (supporting Fig.S10). Thirdly, related organisms when challenged with the same assay protocol could not induce the red-blue color change, which implied that the evolved aptamers retained its high selectivity towards Salmonella enterica serovar Typhimurium cells (Fig.8C, 8D). The sensitivity of selected aptamer was also analyzed using various concentrations of Salmonella enterica serovar Typhimurium cells and it shows the aptamer SAL 26 could be used to detect 102 CFU/mL (Fig.8E). Confirmation of aptamer SAL26 Selectivity to Salmonella enterica serovar Typhimurium in a mixed cell suspension The aptamer SAL26 (250 nM) was assessed for its selectivity against Salmonella enterica serovar Typhimurium in mixed cell population by Enzyme linked aptamer sedimentation assay and gold nano particle based colorimetric assay. A significant stronger signal in ELASA (Fig.9A) visual colour change and change of absorbance spectra (Fig.9B) in mixed cells indicated the selectivity of SAL 26 in both the assays respectively.


Page 7 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Discussion Single stranded nucleic acid aptamers represent a new generation of macromolecules that bind to their targets with low nano to micro molar dissociation constants which can be further labeled for visual detection or tethered to a solid support for target capture and concentration. Few reports are available till date on selection of aptamers targeting cells or purified cellular proteins of various Salmonella enterica serovars including RNA aptamers [21, 27-35]. Despite these previous reports, the presently described approach has a potential to overcome several limitations associated with conventionally used SELEX methods. It provides selection of high affinity ligands to the target in its native three-dimensional conformation and predominantly works onto target molecules present on cell surface and selected aptamers are not sensitive to structural perturbations that might occur during post-selection labeling. Overall, such improvements to the selection process increases the utility of final aptamer sequences in smart in-vitro assays for detection of any microbe by allowing the optimization of both binding affinity and sensitivity, a significant advantage over the traditional SELEX methods. Our modified strategy presents some inimitable aspects that are discussed below. Traditionally, reported aptamers with specificity to Salmonella Typhimurium have been selected to cell surface outer membrane proteins, trans membrane protein but their purification in native conformation is difficult and they tend to be rather unstable [27-31]. Other bacteria with this protein may be recognized by the aptamer and this may bring false-positive results. In the present whole-cell SELEX approach, that the aptamers selected are functional to the target molecule on live cells with a native conformation. In addition, cell-specific aptamers can be obtained without any prior knowledge about cell surface molecules on the target cells. We strictly maintained the bacterial incubation time in order to keep the cells in log phase and this inherently increases the likelihood and even, solves the problem of discrimination of viable and non-viable target cells. The conventional techniques require technical skilled personnel for analysis and operation of some expensive equipment and additional time for sample preparation which is taken care to a large extent in the described protocol. In previously reported whole-cell SELEX methods (23, 27-35), normally aptamer selection is done using PCR amplification followed by separation of single stranded DNA by streptavidin coated magnetic beads. During this process, there is a limitation in binding of aptamers to magnetic beads and there are chances 7 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 28

of missing some real good sequences with high specificity which is not the case in presently described method. Our modified strategy focused on ssDNA generation through asymmetric PCR after each round of selection there by directly proceeding to pick up specific sequences. Another value of current whole cell approach used in this study is the incorporation of counterSELEX by employing a wide range of Gram-negative and Gram-positive bacteria that can more effectively eliminate non-specific aptamers and to evolve highly selective aptamers to the target bacterial species. Moreover, for checking the binding affinity and determination of presence of specific aptamer for target after every round of SELEX, a defined proper method is also not available. In the presently described SELEX protocol, this aspect appears to get overruled by the fluorescence binding assay step that determines the affinity after every round of SELEX. Another advantage that could be observed in this study was; the obtained 32 sequenced transformants, which upon subjecting to multiple sequence alignment, Phylogenetic and Jalview analysis revealed eight groups of aptamers that shares 60-98% sequence similarities and with few nucleotide conserved regions. Furthermore, the secondary structure analysis of each group of aptamers revealed a typical stem-loop structure, and lower Gibbs free energy (dG). Moreover, the binding affinity individual selected aptamers were measured by the fluorescence binding to favour the selection of aptamer having high binding affinity. The binding affinity between an aptamer and its target is expressed by the equilibrium dissociation constant (Kd). In our study, Aptamers SAL 28, SAL 11, and SAL 26, demonstrated an apparent dissociation constants (195±46 nM, 184±43 nM, and 123±23 nM), and these binding affinities are consistent with those previously reported aptamers generated by whole-cell SELEX. To facilitate the use of aptamers as probes in in-vitro assays, the affinity and specificity of aptamer candidates were further evaluated by Fluorescence confocal microscopy imaging, where in all candidate aptamers had shown specificity to Salmonella enterica serovar Typhimurium. Further to demonstrate their application in screening, and sensitive detection of the pathogen, we adapted two additional detection platforms such as aptamer-linked sedimentation assay and gold nanoparticle based colorimetric assay. The sensitivity of the developed bioassays when investigated resulted in limit of detection (LOD) of 103 CFU/mL in aptamer sedimentation assay and 102 CFU/mL in gold nanoparticle based colorimetric assay. The results clearly demonstrated that the limit of detection for both of these assays in terms of rapidity, sensitivity and cost are 8 ACS Paragon Plus Environment

Page 9 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


comparable to available antibody based methods viz., immuno magnetic separation (IMS), liposome based immuno chromatographic method, IMS-PCR,,ELISA etc., where the sensitivity varies from 102 to 107 CFU/ml [4, 6-11]. The sensitivity of other available methods like PCR and Real time PCRs though is as low as 1 cell/25g; it requires pre-enrichment and DNA extraction steps and residual matrix-associated inhibitors often compromise detection [7, 41 43]. Aptamers thus obtained with the described strategy having their binding affinities to bacterial cell surface molecules can find utility in many analytical systems both in field and laboratory detection systems over a wide range of food, clinical and environmental samples.

Key virtue of the proposed research is that whole-cell SELEX strategy combined with ELASA and gold nanoparticle based colorimetric assays simplifies and shortens the normally encountered complex and time consuming process required for development of in-vitro detection systems. Moreover, specificity, rapidity and cost effectiveness associated with the described process can find application for identification of any microbe beyond Salmonella enterica serovar Typhimurium. Conclusion We present a proof-of-concept that aptamers can be used as high affinity ligands for capture and subsequent detection of whole cells of bacteria. Using current approach, it requires less than two months in identifying suitable aptamers for the detection of Salmonella enterica serovar Typhimurium from ssDNA library. Thus, our whole cell- SELEX method shortened the complex process required for identifying Salmonella enterica serovar Typhimurium specifically, rapidly, easily, and cost effectively. On the basis of results in present study, we anticipate that the aptamers SAL 28, SAL 11, SAL 26 may be used to capture and detect Salmonella enterica serovar Typhimurium, even when applied to a complex sample matrix with mixed microbial population, such as food. We have adapted two detection platforms such as Enzyme-linked aptamer sedimentation assay and gold nanoparticle based calorimetric analysis which can be useful as a simple tool for detection of Salmonella enterica serovar Typhimurium that demonstrates the great potential in food-safety control Materials



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 28

The initial ssDNA library and the primers used for amplification were obtained from Xcelris Bioscience (Ahmadabad), except mentioned specifically. All the solutions were prepared with ultra-high purity water obtained from a Millipore water purification system. Experimental Procedure Bacterial Strains and Culture Bacterial strain used in this study is listed in (Supporting information1) and preparation of stock solution of each organism for the selection study was optimized and the best results were obtained by the following procedure (Supporting information 2). Design of aptamer library and primer: The ssDNA aptamer library used in the present study consists of a central region of 40 randomized nucleotides flanked 17 bases forward and 19 bases of reverse primer binding regions necessary for PCR amplification (Supporting information 3.) The nucleotide sequences of the library and the primers are listed in supporting table 1. Amplification of Single-Stranded DNA (ssDNA) Library: In order to generate the ssDNA template, asymmetric polymerase chain reaction (PCR) [36] was performed in a PCR reaction (40 µl) containing 4 µl of 10X PCR buffer, 3.2 µl of 1.6 mM MgCl2, 2 µl of 2.0 mM dNTPs, 2 U µL-1 of 0.4 µl Taq DNA polymerase, 1 µl of the template library, 27.4 µl of dH2Oand different ratios of forward to reverse primer (1.1:0.9,1.2:0.8, 1.3:0.7, 1.4:0.6, 1.5:0.5, 1.6:0.4, 1.7:0.3, 1.8:0.2, 1.9:0.1, 2.0:0) to obtain desired amplification. PCR was performed (Biorad, India) with following protocol: initial denaturation 94 °C for 5 min, followed by 30 cycles of denaturation at 94 °C for 45 s, annealing at 56 °C for 45 s extension at 72 °C for 30 s and a final extension at 72 °C for 5 min. Finally, PCR amplicons were separated by 2.5% agarose gel electrophoresis and PCR product of desired size (76 bp) was eluted from the gel using the Qiagen MiniElute gel extraction kit following manufacturer’s protocol. Modified whole cell SELEX The aptamer selection scheme for Salmonella enterica serovar Typhimurium was initiated with a randomized ssDNA library (2 nM initial rounds). In subsequent rounds, 100 pmol of aptamer pools were denatured by heating at 95 °C for 5 min in 400 µL of 1X BB and then snap-cooled on ice for 10 min to create folded ssDNA. For positive selection, thoroughly washed target Salmonella cells at 5 × 108 CFU/mL (first round) and 5 × 106 CFU/mL (subsequent rounds) concentration were suspended in 100 µL of binding buffer (BB) containing bovine serum 10 ACS Paragon Plus Environment

Page 11 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


albumin (BSA; Sigma, USA) and a fivefold molar excess of yeast tRNA (Invitrogen) and incubated with the former at room temperature for 45 min with moderate shaking (500 rpm). Following incubation, the cells were washed twice in 500 µL of 1X BB with 0.05 % BSA and the supernatants with unbound aptamers were removed by centrifugation at 4,500 rpm for 10 min at 4 °C. The bound ssDNAs were eluted by heating at 95 °C for 10 min in 100 µL of sterile ddH2O. This mixture was then centrifuged at 12,000 rpm for 10 min and the supernatant isolated was designated as cell-bound aptamer (CA) fraction. This was recovered using PCR purification kit followed by its elution in 30 µl distilled water, and the concentration was measured by Nanodrop-2000 (Thermo Scientific, India). Collected CA fraction was amplified by PCR for its use in the next round of selection. To ensure the high specificity and affinity of the aptamer candidates, counter-SELEX was performed after second, fourth and seventh round of SELEX. Counter SELEX was performed with bacterial cocktail (Supporting information.5). The unbound aptamer candidates were collected after centrifugation and were then amplified for the next round of SELEX. The PCR products were separated by 2.5 % agarose gel electrophoresis and then the target band (76 bp) was excised and purified. A total ten rounds of selection were performed using fresh aliquots of cells for each round. TOPO TA Cloning, Sequencing and Analyzing for Identification of Consensus Aptamer Sequences The selected aptamer pools from tenth round of SELEX were amplified and subsequently cloned into TA cloning vector (Invitrogen/Life Technologies, India) as per manufacturer’s protocol. Positive transformants were analyzed and sequenced (Xceleris, Bangalore) (Supporting information.6). The sequences were analyzed and aligned by using the web-based tool ClustalW (http://www.ebi.ac.uk/Tools/msa/clustalw2/) [37, 38]. Selected sequences were subjected to secondary

structure

prediction

using

the

Mfold

software

(http://mfold.

rna.albany.edu/?q=mfold/DNA-Folding-Form) at 26 °C in 150 mM (Na+) and 1 mM (Mg++) for determination of free energy [39, 40 ]. The most likely structure was chosen on the basis of the lowest predicted free energy of formation (∆G; kcal/mol). Aptamer Binding Assays and determination of apparent Equilibrium Dissociation Constants (Kd) Fluorescence labeled ssDNA binding assay was performed to monitor the enrichment of each SELEX round and to evaluate binding affinity of aptamers to target cells. In brief, 250 nM of 11 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 28

FITC-labeled aptamers were incubated with Salmonella enterica serovar Typhimurium (5 × 106 CFU/mL) in 500 µL of binding buffer for 45 min at room temperature with gentle agitation. After incubation, the samples were centrifuged at 4,500 rpm for 10 min and the unbound DNA was removed by thorough wash with 500 µL of 1X BB. Finally, FITC-bound aptamers were eluted by heating and transferred to 96-well microtitre plate (NUNC, India). The fluorescence intensity of unbound and eluted ssDNA was measured (excitation, 492 nm; emission, 532 nm) using Infinite M1000 spectrophotometer (TECAN, India) and all the binding assays were repeated thrice. For the evaluation of cross-reactivity, binding assays were repeated with closely related bacteria. To determine the apparent binding kinetics of selected aptamers, the binding assay was performed with increasing concentration of

FITC-labeled ssDNA aptamer (0 to 350 nM)

incubated with a constant cell concentration of Salmonella enterica serovar Typhimurium (5 × 106 CFU/mL). To calculate the Equilibrium dissociation constants (Kd) of the aptamers, the quantity of aptamer bound to targets apparent was plotted and data points were fitted to the equation y=Bmax×x/ (Kd+x) via non-linear regression analysis, using Graph Pad Prism6 software. Confocal imaging of cells stained with Aptamers The selected FITC-labeled aptamers with higher affinities (250 nM) were incubated with the bacteria (5 × 106 CFU/mL) individually at room temperature for 45 min with gentle rotation in 500 µL 1X BB. Finally the unbound aptamers were removed by washing thrice before imaging; the cells were immobilized on the glass slide by 3 % paraformaldehyde and then observed under the advanced spectral confocal scanning microscope (Zeiss, Germany). The FITC was excited by a 492 nm laser and the fluorescence signals were collected by a 40x objective. For evaluation of cross-reactivity, assays were repeated with different bacterial populations. Enzyme-Linked Aptamer Sedimentation Assay (ELASA) To demonstrate the affinity and specificity of aptamers to Salmonella enterica serovar Typhimurium, we have performed enzyme linked immunosorbent assay (Supporting fig.S7). Denatured Biotin-labeled aptamer candidates (250 nM) were incubated with 5 × 106 CFU/mL of Salmonella enterica serovar Typhimurium in 500 µL binding buffer for 45 min at room temperature. After incubation, the samples were centrifuged at 4,500 rpm for 10 min and unbound aptamers were removed by washing three times with 1.5 % Tween-20 in BB. Finally, 12 ACS Paragon Plus Environment

Page 13 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


100 µL of 1:2500 dilution of Streptavidin conjugated to HRP (horseradish peroxidase) was added and incubated at room temperature for 30 min on a shaking platform, later centrifuged at 4,500 rpm for 10 min, and finally tubes were washed for three times with 1.5 % Tween-20 in BB and colour was developed by using OPD (o-Phenylenediamine, Bangalore Genie) according to the Manufacturer’s instructions. The sorbent was centrifuged at 4,500 rpm for 10 min and the supernatant was transferred to 96-well microtitre plates. Absorbance was read at 492 nm using a standard ELISA reader instrument (TECAN, India). For evaluation of cross-reactivity and assays were repeated with different bacterial populations. Detection of Salmonella enterica serovar Typhimurium by aptamer-based colorimetric analysis Colorimetric detection method of Salmonella enterica serovar Typhimurium using unmodified AuNPs as an indicator and its aptamer as specific recognition element was developed (fig.8A). For this experiment 50 µL of 250 nM of ssDNA (SAL 26 aptamer or random DNA) solution was denatured by heat treatment, and mixed with different concentrations of cells (Salmonella enterica serovar Typhimurium) in 10 mM PBS buffer with 1 mM MgCl2, the mixtures were then incubated for 5 min at room temperature and were added into 96-well microtitre plate. Then, 50 µL of AuNPs solution was added and allowed to settle for 2 min. Finally, 50 µL of 50 mM NaCl was added to the prepared solutions to give a final volume of 150 µL. After the solution was equilibrated

for

3

min,

UV–Vis

absorbance

was

measured

via

Microtitre

plate

Spectrophotometer (TECAN, India) at a wavelength 630 nm. The UV–Vis absorption spectrum was monitored over the wavelength range from 400 nm to 800 nm. For evaluation of crossreactivity, colorimetric assays were repeated with different bacterial populations. Confirmation of aptamer SAL26 Selectivity to Salmonella enterica serovar Typhimurium in a mixed cell suspension The selective affinity of aptamer SAL26 for Salmonella enterica serovar Typhimurium both assays (ELASA and gold nano particle based colorimetric assay) were assessed in a mixed bacterial population (105–106 cells each) comprised of Salmonella enterica serovar Typhimurium,

Staphylococcus

aureus,

Klebsiella

spp,

Enterobacter

spp,

Listeria

monocytogenes, Shigella flexneri, E. Coli (method described previously). Statistical analysis



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 28

All experiments were repeated three times with similar conditions. Results were presented as the mean value ± standard deviation (SD). Statistical differences between treatments were analyzed by uni-variate (ANOVA) and Tukey’s test assuming p value (P < 0.05), (P < 0.01) and (P < 0.001) followed by Dunnett’s test using Graph Pad Prism6. Acknowledgements: The first author is indebted to Department of Science and Technology (DST, New Delhi, India), for financial assistance through Women Scientist-A (WOS-A).The second author is indebted to Department of Science and Technology (DST, New Delhi, India), for financial assistance through INSPIRE program. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Conflict of interest: The authors declare no financial or commercial conflict of interest. REFERENCES 1. Crum-Cianflone, N. F. Salmonellosis and the gastrointestinal tract: more than just peanut butter. Current gastroenterology reports. 2008, 10, 424–431. 2. Moon, J. H., Shin, H. A., Rha, Y. A., Om, A. S. The intrinsic antimicrobial activity of bamboo salt against Salmonella enteritidis. Mol. Cell. Toxicol. 2009, 5, 323–327. 3. Velge, P., Cloeckaert, A., Barrow, P. Emergence of Salmonella epidemics: The problems related to Salmonella enterica serotype Enteritidis and multiple antibiotic resistance in other major serotypes. Veterinary research. 2005, 36, 267–288. 4. Favrin, S. J., Jassim, S. A., Griffiths, M. W. Development and Optimization of a Novel Immunomagnetic Separation-Bacteriophage Assay for Detection of Salmonella enterica Serovar Enteritidis in Broth. Applied and environmental microbiology.2001, 67,217–224. 5. Beuchat, L. Surface decontamination of fruits and vegetables eaten raw: a review. In Surface decontamination of fruits and vegetables eaten raw: a review. 1998, OMS 42. 6. Dziadkowiec, D., Mansfield, L. P., & Forsythe, S. J. The detection of Salmonella in skimmed milk powder enrichments using conventional methods and immunomagnetic separation. Letters in applied microbiology. 1995, 20, 361–364. 7. Jeníková, G., Pazlarová, J., Demnerová, K. Detection of Salmonella in food samples by the combination of immunomagnetic separation and PCR assay. International Microbiology. 2010, 3, 225–229. 14 ACS Paragon Plus Environment

Page 15 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


8. Barnett, C., Bell, C., Vig, K., Akpovo, A. C., Johnson, L., Pillai, S., & Singh, S. Development of a LIBS assay for the detection of Salmonella enterica serovar Typhimurium from food. Analytical and bioanalytical chemistry. 2011, 400, 3323–3330. 9. Shin, J., Kim, M. Development of liposome immunoassay for salmonella spp. using immunomagnetic separation and immunoliposome. Journal of microbiology and biotechnology. 2008, 18, 1689–1694. 10. Shukla, S., Leem, H., Kim, M. Development of a liposome-based immunochromatographic strip assay for the detection of Salmonella. Analytical and bioanalytical chemistry. 2011, 401, 2581– 2590. 11. Lee, H. A., Wyatt, G. M., Bramham, S. A. R. A., Morgan, M. R. Enzyme-linked immunosorbent assay for Salmonella typhimurium in food: feasibility of 1-day Salmonella detection. Applied and environmental microbiology. 1990, 56, 1541–1546. 12. Hamula, Camille LA, Hongquan Zhang, Feng Li, Zhixin Wang, X. Chris Le, and Xing-Fang Li. Selection and analytical applications of aptamers binding microbial pathogens. TrAC Trends in Analytical Chemistry.2011, 30, 1587-1597. 13. Cibiel, A., Dupont, D. M., Ducongé, F. Methods to identify aptamers against cell surface biomarkers. Pharmaceuticals. 2011, 4, 1216–1235. 14. Pestourie, C., Tavitian, B., Duconge, F. Aptamers against extracellular targets for in vivo applications. Biochimie. 2005, 87, 921–930. 15. Savran, C. A., Knudsen, S. M., Ellington, A. D., Manalis, S. R. Micromechanical detection of proteins using aptamer-based receptor molecules. Analytical chemistry. 2004, 76, 3194–3198. 16. Takemura, K., Wang, P., Vorberg, I., Surewicz, W., Priola, S. A., Kanthasamy, A., Sreevatsan, S. DNA aptamers that bind to PrPC and not PrPSc show sequence and structure specificity. Experimental Biology and Medicine.2006, 231, 204–214. 17. Tombelli, S., Minunni, M., Mascini, M. Analytical applications of aptamers. Biosensors and Bioelectronics. 2005, 20, 2424–2434. 18. Mondal, Bhairab, Shylaja Ramlal, Padma Sudha Rani Lavu, Harishchandra Sreepathy Murali, and Harsh Vardhan Batra. A combinatorial systematic evolution of ligands by exponential enrichment method for selection of aptamer against protein targets. Applied microbiology and biotechnology. 2015, 99, 9791-9803.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 28

19. Zhijiang Xi, Rongrong Huang, Zhiyang Li, Nongyue He, Ting Wang, Enben Su, and Yan Deng, Selection of HBsAg-specific DNA Aptamers Based on Carboxylated Magnetic Nanoparticles and Their Application in the Rapid and Simple Detection of Hepatitis B Virus Infection. ACS Applied Materials & Interfaces. 2015, 7, 11215−11223. 20. Yang, Jing, and Michael T. Bowser.Capillary electrophoresis–SELEX selection of catalytic DNA aptamers for a small-molecule porphyrin target. Analytical chemistry.2013, 85, 1525-1530. 21. Liu, Guoqing, Xiaofeng Yu, Feng Xue, Wei Chen, Yongkan Ye, Xiaojiao Yang, Yingqi Lian, Yi Yan, and Kai Zong. Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8. Microchimica Acta. 2012, 178, 237-244. 22. Pestourie, Carine, Laura Cerchia, Karine Gombert, Youssef Aissouni, Jocelyne Boulay, Vittorio De Franciscis, Domenico Libri, Bertrand Tavitian, and Frédéric Ducongé. Comparison of different

strategies

to

select

aptamers

against

a

transmembrane

protein

target.

Oligonucleotides. 2006, 16, 323-335. 23. Hamula, C. L., Le, X. C., Li, X. F. DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes. Analytical chemistry. 2011, 83, 3640–3647. 24. Cao, X., Li, S., Chen, L., Ding, H., Xu, H., Huang, Y., Shao, N. Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus. Nucleic acids research. 2009, 37, 4621–4628. 25. Dwivedi, H. P., Smiley, R. D., Jaykus, L. A. Selection and characterization of DNA aptamers with binding selectivity to Campylobacter jejuni using whole-cell SELEX. Applied microbiology and biotechnology. 2010, 87, 2323–2334. 26. Shamah, Steven M., Judith M. Healy, and Sharon T. Cload. Complex target SELEX. Accounts of chemical research. 2008, 41, 130-138. 27. Hyeon, Ji-Yeon, Jung-Whan Chon, In-Soo Choi, Chankyu Park, Dong-Eun Kim, and Kun-Ho Seo. Development of RNA aptamers for detection of Salmonella Enteritidis. Journal of microbiological methods.2012, 89, 179-82. 28. Labib, Mahmoud, Anna S. Zamay, Olga S. Kolovskaya, Irina T. Reshetneva, Galina S. Zamay, Richard J. Kibbee, Syed A. Sattar, Tatiana N. Zamay, and Maxim V. Berezovski.Aptamer-based viability impedimetric sensor for bacteria. Analytical chemistry.2012, 84, 8966-8969. 29. Pan, Qin, Xiao-Lian Zhang, Hong-Yan Wu, Pan-Wen He, Fubin Wang, Ming-Sheng Zhang, Jian-Ming Hu, Bing Xia, and Jianguo Wu. Aptamers that preferentially bind type IVB pili and 16 ACS Paragon Plus Environment

Page 17 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi. Antimicrobial agents and chemotherapy.2005, 49, 4052-4060. 30. Maeng, Jin-Soo, Namsoo Kim, Chong-Tai Kim, Seung Ryul Han, Young Ju Lee, Seong-Wook Lee, Myung-Hyun Lee, and Yong-Jin Cho. Rapid detection of food pathogens using RNA aptamers-immobilized slide. Journal of nanoscience and nanotechnology.2012, 12, 5138-5142. 31. Joshi, Raghavendra, Harish Janagama, Hari P. Dwivedi, TMA Senthil Kumar, Lee-Ann Jaykus, Jeremy Schefers, and Srinand Sreevatsan. Selection, characterization, and application of DNA aptamers for the capture and detection of Salmonella enterica serovars. Molecular and cellular probes. 2009, 23, 20-28. 32. Yang, M., Peng, Z., Ning, Y., Chen, Y., Zhou, Q., Deng, L. Highly specific and cost-efficient detection of Salmonella Paratyphi A combining aptamers with single-walled carbon nanotubes. Sensors. 2013, 13, 6865–6881. 33. Duan, N., Wu, S., Chen, X., Huang, Y., Xia, Y., Ma, X., Wang, Z. Selection and characterization of aptamers against Salmonella Typhimurium using whole-bacterium systemic evolution of ligands by exponential enrichment (SELEX). Journal of agricultural and food chemistry. 2013, 61, 3229–3234. 34. Moon, J., Kim, G., Lee, S., Park, S. Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis. Journal of microbiological methods. 2013, 95, 162–166. 35. Park, H. C., Baig, I. A., Lee, S. C., Moon, J. Y., Yoon, M. Y. Development of ssDNA Aptamers for the Sensitive Detection of Salmonella Typhimurium and Salmonella enteritidis. Applied biochemistry and biotechnology. 2014, 174, 793–802. 36. Berezovski, Maxim V., Michael U. Musheev, Andrei P. Drabovich, Julia V. Jitkova, and Sergey N. Krylov. Non-SELEX: selection of aptamers without intermediate amplification of candidate oligonucleotides. Nature protocols.2006, 1, 1359-1369. 37. Larkin, M. A., Blackshields, G., Brown, N. P., Chenna, R., McGettigan, P. A., McWilliam, H., Higgins, D. G. Clustal W and Clustal X version 2.0. Bioinformatics. 2007, 23, 2947–2948. 38. Thompson, J. D., Higgins, D. G., Gibson, T. J. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic acids research. 1994, 22, 4673–4680. 39. Zuker, M. On finding all suboptimal foldings of an RNA molecule. Science. 1989, 244, 48–52. 17 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 28

40. Zuker, M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic acids research. 2003, 31, 3406–3415. 41. Techathuvanan, Chayapa, Frances Ann Draughon, and Doris Helen D'Souza. Real-time reverse transcriptase PCR for the rapid and sensitive detection of Salmonella typhimurium from pork. Journal of Food Protection. 2010, 73, 507-514. 42. Malorny, Burkhard, Elisa Paccassoni, Patrick Fach, Cornelia Bunge, Annett Martin, and Reiner Helmuth. Diagnostic real-time PCR for detection of Salmonella in food. Applied and Environmental Microbiology. 2004, 70, 7046-7052. 43. Cohen, Huguette J., Subbaiah M. Mechanda, and Wei Lin. PCR amplification of the fimA gene sequence of Salmonella typhimurium, a specific method for detection of Salmonella spp. Applied and environmental microbiology.1996, 62, 4303-4308. Table 1 Aptamer sequences chosen for binding characterization, and their predicted Gibbs free energy (∆G) of folding. The constant primer sequences are marked in red. APTAMER

GROUP

SEQUENCE (5' to 3' )

∆G

ID

VALUE kcal/mol

SAL33

I

TAGCTCACTCATTAGGCACTCGTATTGAGGAGCTCGTATTATTTAATT ∆G = -8.30 CACACTGTGCTGCATAGTTAAGCCAGCC

SAL28

I

TAGCTCACTCATTAGGCACTCTGTCGTCAACAGTCTAACTTGTAGAAT ∆G = -9.44 TGATGTTACTGGCATAGTTAAGCCAGCC

SAL43

II

TAGCTCACTCATTAGGCACGAGACCACCGGCAACCTTTCACAAAGGG ∆G = -8.69 GAGGCTAAGCATAGTTAAGCCAGCC

SAL21

II

TAGCTCACTCATTAGGCACAGCAACTCGCTTTGATACCGGTAGAGTTT ∆G = -4.79 GTATTGCTCAAGCATAGT TAAGCCAGCC

SAL37

III

TAGCTCACTCATTAGGCACTTAGTTCAGACGCGAGTATTATCGGCGTC ∆G = -8.78 CAAGCAAGGGGCATAGTTAAGCCAGCC

SAL20

III

TAGCTCACTCATTAGGCACATATTCAGCAGTTGTATGATAGCGGGTCG ∆G = -4.50 CGAGTGTGTATGCATAGTTAAGCCAGCC 18 ACS Paragon Plus Environment

Page 19 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

SAL40


IV

TAGCTCACTCATTAGGCACTGCATTACATATATGGCAGTGGGTTAACC ∆G = -9.01 TGGATTGAGGAGCATAGTTAAGCCAGCC

SAL16

IV

TAGCTCACTCATTAGGCACCCGATTGTACTAATGAAGATGGACACTGA ∆G = -6.71 GAGGGGGATGGGCATAGTTAAGCCAGCC

SAL11

V

TAGCTCACTCATTAGGCACTCGAGAGGGATCTCGGGGCGTGCGATGA ∆G = -9.36 TTTTGCCTTCATGCATAGTTAAGCCAGCC

SAL45

V

TAGCTCACTCATTAGGCACCGTGCCAACTGAGGGATACAGGGGGAGT ∆G = -8.09 GTCGGTCTACCTGCATAGTTAAGCCAGCC

SAL23

VI

TAGCTCACTCATTAGGCACCTCACAGCCCTTCTTCCCGTATTTGTAGA ∆G = -2.65 CTAGTTACATTGCATAGTTAAGCCAGCC

SAL48

VII

TAGCTCACTCATTAGGCACCACACTGTCTTGATTTTGGATTTGTCGGT ∆G = -7.43 GCTGACCTGTGGCATAGTTAAGCCAGCC

SAL9

VII

TAGCTCACTCATTAGGCACTGCGAGTGAACTCCTCCTTTTGTATTTAG ∆G = -6.83 TGTGCGGATCTGCATAGTTAAGCCAGCC

SAL29

VII

TAGCTCACTCATTAGGCACATGTGGAGTGCGAACTGTCTGGTCTTATC ∆G = -7.74 GGGCTCGCTGTGCATAGTTAAGCCAGCC

SAL26

VIII

TAGCTCACTCATTAGGCACATTTGTGGCACCAAATTTGAATTAATCAA ∆G = -8.00 GACAGTGTGGTGCATAGTTAAGCCAGCC



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 28

Table 2 Binding dissociation constants (Kd) of aptamer sequences that have high affinity and selectivity for Salmonella enterica serovar Typhimurium cells used in whole cell-SELEX APTAMER ID

Kd VALUES (nM)

SAL 33

221±72

SAL 28

195±46

SAL 43

294±112

SAL 40

204±73

SAL 45

294±133

SAL 11

184±43

SAL 26

123±23

Fig. 1

Fluorescence intensity of bound and unbound aptamers during selection process The round zero represents naive library 20 ACS Paragon Plus Environment

Page 21 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig 2.

Multiple sequence alignment of the selected aptamers Sequences identified from 32 clones, aligned by ClustalW. Constant primer regions are indicated by asterisks at the bottom.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 28

Fig 3.

SAL 11

SAL 26

SAL 28

Predicted possible secondary structures of the aptamer sequences showing the lowest free energy using Mfold software.


Page 23 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig 4.

Determination of relative binding affinity and specificity of selected aptamers for Salmonella enterica serovar Typhimurium. 250 nM of FITC-labeled aptamers were incubated with 5 × 106 CFU/mL bacteria at RT for 45 min. After washing the eluted bound aptamers were quantified. A FITC-labeled version of the original ssDNA library was used as the negative control (BLANK). Error bars are standard error from triplicate analysis.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 28

Fig 5.

Binding titrations of selected FITC-labeled aptamers to Salmonella enterica serovar Typhimurium (5 ×106 CFU/mL).


Page 25 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig 6.

Confocal microscopy of selected aptamers binding to different bacteria Left side: Fluorescence; Right side: Bright field Fig.6A, 6B, 6C represents binding affinity of aptamers SAL 28, SAL 11, and SAL 26 to various cells respectively. A1, B1, C1: Salmonella enterica serovar Typhimurium cells; A2, B2, C2: Salmonella enterica serovar Typhimurium cells with naïve library; A3, B3, C3: S.aureus cells; A4, B4, C4: Shigella flexneri cells



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 28

Fig 7.

7A

7B

Specificity (7A) and Sensitivity (7B) determination of aptamers SAL 28, SAL 11, and SAL26 by ELASA Fig 8.


Page 27 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig 8A. Illustration of the colorimetric method using AuNPs for Salmonella enterica serovar Typhimurium detection Fig 8B. Visible colour changes of AuNPs in presence of Salmonella enterica serovar Typhimurium cells and SAL 26 aptamer.T1: AuNPs retained the red color in presence of 50 mM NaCl and selected aptamer. T2: AuNPs solution readily turned blue in presence of Salmonella enterica serovar Typhimurium. Fig 8C.Visible effect on AuNPs, in presence of various organisms. W1: Salmonella enterica serovar Typhimurium, W2: S.Paratyphi A, W3: S. Brunei, W4: S. aureus, W5: E.coli, W6: S. flexneri. Fig 8D. Absorbance spectra of AuNPs in presence of various microbes and aptamer (SAL 26, 250 nM) in presence of salt. Fig 8E.Sensitivity of Gold nanoparticle based colorimetric detection assay.W1: Control AuNPs, W2:106 CFU/mL, W3:105 CFU/mL, W4:104 CFU/mL, W5:103 CFU/mL, W6:102 CFU/mL, W7:101 CFU/mL Fig 9.

9A

9B

Confirmation and Selectivity of SAL 26 by ELASA (9A) and AuNP colorimetric assay (9B). 9A. significant stronger signal in ELASA indicate selectivity of SAL26. 9B. visual colour change and change of absorbance spectra in mixed cells indicate selectivity of SAL26



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 28

For Table of Contents Use Only Title: Selection and characterization of aptamers using a modified Whole-Cell Bacterium SELEX for the detection of Salmonella enterica serovar Typhimurium Author’s information: Padma Sudha Rani Lavu (First author), Bhairab Mondal, Dr. Shylaja Ramlal (Corresponding author), Dr. Harishchandra Sreepathy Murali, Dr. Harsh Vardhan Batra


Selection and Characterization of Aptamers ... - ACS Publications

Recommend Documents