Article pubs.acs.org/est
Selection, Characterization, and Biosensing Application of High Affinity Congener-Specific Microcystin-Targeting Aptamers Andy Ng, Raja Chinnappan, Shimaa Eissa, Hechun Liu, Chaker Tlili, and Mohammed Zourob* Institut National de la Recherche Scientifique, Centre Énergie Matériaux Télécommunications, 1650 Boulevard Lionel-Boulet, Varennes (Québec) J3X 1S2 Canada S Supporting Information *
ABSTRACT: The efficiency of current microcystin detection methods has been hampered by the low detection limits required in drinking water and that routine detection is restricted to a few of the congeners with high degree of undesired cross-reactivity. Here, we report the development of novel microcystin-targeting molecules and their application in microcystin detection. We have selected DNA aptamers from a diverse random library that exhibit high affinity and specificity to microcystin-LR, -YR, and -LA. We obtained aptamers that bind to all chosen congeners with high affinity with KD ranging from 28 to 60 nM. More importantly, we also obtained aptamers that are selective among the different congeners, with selectivity from 3-folds difference in binding affinity to total discrimination (KD of 50 nM versus nonspecific binding). Electrochemical aptasensors constructed with the selected aptamers were able to achieve sensitive and congener-specific microcystin detection with detection limit as low as 10 pM.
■
INTRODUCTION Cyanobacteria proliferate in surface water such as ponds, lakes, reservoirs and slow-moving streams in the presence of excessive nutrients, intense sunlight and at high water temperature.1,2 They produce a group of toxins known as microcystins, most commonly associated with Microcystis aeruginosa.2 Microcysins are cyclic heptapeptides with a framework consisting of five constant amino acids and two variable positions. There are more than 80 known microcystin congeners which exhibit structure variations and difference in toxicity.2 Microcystin-LR (MC-LR) was the first microcystin chemically identified and is known to be the most abundant and potent hepatotoxin among other cyanobacterial toxins.3 The main routes to microcystin poisoning in human are consumption of poisoned drinking water and skin contact with contaminated water at recreational sites. Other accidental microcystin ingestions include consumption of agricultural products irrigated by contaminated water4 and poisoned animals.5 The health hazard of microcystin contamination prompted a WHO evaluation of the tolerable daily intake (TDI) level corresponding to 0.01 μg/kg/day and establishment of a drinking water concentration limit of 0.5 μg L−1 for MC-LR.6 These regulations call for rapid, sensitive and reliable microcystin detection methods, particularly those that are suitable for routine field use. Current detection methods for microcystins are based on analytical and biological/biochemical techniques. The most commonly used analytical methodology is chromatography, such as HPLC equipped with different detection methods including absorbance, UV and diode array detector.7 However, separation of different microcystin congeners is difficult because they are structurally very similar. Capillary electrophoresis has also been documented for the detection of microcystins but it suffers from the complexity of analysis and poor reproducibility.8 Coupling of HPLC to mass spectrometry resulted in an © 2012 American Chemical Society
improvement in the detection limit and specificity. HPLC-MS/ MS has been employed in the identification and quantification of microcystins.9,10 However, these machines are very expensive and are unsuitable for field application. They also cannot be used for routine screenings and require highly skilled personnel to operate. Bioassay with live animals provides information on the total toxicity of the sample, but suffers from low sensitivity and reliability.11,12 Experiments with animal also raise ethical concerns. Biochemical assay involving measurement of protein phosphatase inhibition also informs about the toxicity of the sample, but the inhibitory activities are not specific to microcystins, which lead to false positive results.13,14 In addition, due to the large number of microcystin congeners with varying phosphatase inhibitory effects, in vitro activities might not be directly correlated to the actual amount of microcystin in the sample and more significantly, in vivo toxicities. Antibody-based ELISA assays are highly specific but they are not selective and still have shortcomings such as crossreactivity among microcystin congeners.15,16 In fact, application of ELISA assays has been restricted by difficulties in developing reliable antibody for different microcystin congeners as most commercial offerings employ antibody developed only for MRLR.17 On the other hand, routine sensitive monitoring and quantification of individual microcystin congeners allow a more accurate assessment on the toxicity of the contamination. For this, there is a need to develop alternative approaches for specific recognition of individual microcystin congener. Aptamers are synthetic single-stranded DNA or RNA molecules with unique sequences that can bind to their targets with high affinity and specificity. The first aptamers have been Received: Revised: Accepted: Published: 10697
April 27, 2012 September 6, 2012 September 7, 2012 September 7, 2012 dx.doi.org/10.1021/es301686k | Environ. Sci. Technol. 2012, 46, 10697−10703
Environmental Science & Technology
Article
reported in 199018,19 and aptamers recognizing a wide variety of targets have been developed.20−27 Aptamers can exhibit extremely high affinities down to pM KD’s;28 extremely high specificity allowing over 10 000-fold discrimination between Land D-amino acid.29 Aptamers as recognition receptor has several advantages over existing technologies such as antibodies and enzymes. They can be selected from random libraries of synthetic DNA/RNA sequences in a selection procedure for binding to the target molecules.30 The selected “hits” are more easily identifiable, cheaper to produce using automated synthesis. They are stable under a variety of environments and can also be conjugated with nanomaterials and immobilized on transducing device widely used in biosensors, a new class of detection technology. In fact, biosensors using aptamers as novel capturing agents to replace antibodies recognition receptor for low-abundance analyte detection are emerging.31,32 Here, we report the selection of aptamers from a diverse library of 1014 random DNA oligonucleotides against MC-LR, -YR and -LA in a SELEX type screening approach.33 The binding properties of the selected aptamers toward the chosen microcystin congeners were characterized. We employed the selected aptamers as high affinity and specificity recognition receptors and demonstrated their application for congenerspecific microcystin detection on an electrochemical biosensing platform.
primer: 5′-fluorescein-ATACCAGCTTATTCAATT-3′; reverse primer: 5′-poly dA 20 -PEG 6 -AGATTGCACTTACTATCT-3′. Unmodified primer set was used for PCR amplification and cloning when SELEX rounds were completed. In Vitro Selection. Aliquots of MC-LR, -YR, and -LA beads with phosphatase inhibitory activity equivalent to 50nM free microcystin standards were washed 5 times with 500 μL binding buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 2 mM MgCl2). 160pmol (3 nmol at the first selection round) ssDNA pool was heated to 90 °C for 5 min, cooled at 4 °C for 10 min and then at 25 °C for 5 min before addition to the washed microcystin beads. The mixtures were incubated end-overend at 25 °C for 2 h, followed by washing with binding buffer until no DNA is detected in the washes by UV and/or fluorescence. DNA bound to microcystin beads was eluted with 300 μL aliquots of elution buffer (7 M urea in binding buffer) and heated at 90 °C for 10 min until no DNA is detected. Eluted DNA was desalted and concentrated by ultrafiltration device with a 3 kDa cutoff membrane (Amicon). In a counter selection round, the DNA pool was first incubated with blank sepharose beads (i.e., blocked sepharose beads without conjugated microcystin) prior to incubation with microcystin beads. Washed DNA were collected in this counter selection step, subjected to the same heating and cooling treatment as above and subsequently incubated with microcystin beads. The selected DNA pools were amplified by PCR in 15 parallel 75 μL reactions each containing 2 units of Taq Plus and polymerase buffer (Bioshop), 2 mM MgCl2, 200 μM dNTP, 0.2 μM of forward and reverse primer. PCR conditions: 94 °C for 10 min, followed by 25 cycles of 94 °C for 1 min, 47 °C for 1 min, 72 °C for 1 min, and a final extension step of 10 min at 72 °C. PCR products were dried by SpeedVac and resuspended in 50:50 water and formamide and heated to 55 °C for 5 min. The relevant DNA strand (labeled with fluorescein) was separated from the double stranded PCR product in 12% denaturing PAGE and eluted from the gel band by freeze−thaw cycle. Eluted ssDNA in TE (10 mM Tris, pH 7.4, 1 mM EDTA) was concentrated by ultrafiltration as described above and used for the next round of selection. Cloning and Sequencing of Selected DNA. After the final selection round, the selected ssDNA were amplified with nonmodified primer set and cloned into pCR2.1-TOPO vector using the TOPO TA Cloning Kit (Invitrogen). Positive colonies were picked and were grown in liquid media. ssDNA inserts were PCR amplified using the M13 forward and reverse primer sites within the vector and sequenced. Sequences of the selected ssDNAs were analyzed and aligned using DIALIGN.35 Dissociation Constant and Congener-Selectivity Determination. The selected ssDNA sequences were amplified by PCR with the fluorescein-labeled forward primer and the poly-A labeled reverse primer to allow easy quantification and separation of the antiparallel DNA strands. Each fluoresceinlabeled sequence were heated to 90 °C for 10 min, 4 °C for 10 min and then 25 °C for 5 min. Different amounts of each sequence (0−300nM final concentration) were incubated with MC-LR, -YR, and -LA beads (equivalent to 3 pmol free microcystin) and beads without conjugated microcystins. The mixtures were washed and DNA was eluted as described above. The amount of DNA eluted from each sample was determined by fluorescence measurement. A saturation curve was obtained for each sequence and the dissociation constant for each
■
MATERIALS AND METHODS Preparation of Microcystin Sepharose Beads. MC-LR sepharose beads were purchased from Millipore. Microcystin sepharose beads were also prepared in-house as previously described.34 Microcystin congeners (MC-LR, -YR and -LA) (Enzo Life Sciences) were dissolved in 1.5 vol of water, 2 vol of DMSO, 0.7 vol of 5N NaOH and 1 vol of aminoethanethiol hydrochloride (1 g mL−1) (Sigma). The solution was incubated at 50 °C for 30 min under nitrogen gas, cooled and an equal volume of glacial acetic acid was added. The mixture was then diluted five times with 0.1% TFA and pH adjusted to 1.5 by addition of 100% TFA. The mixture was then passed through a C18 Sep-pak column equilibrated with 0.1% TFA, washed with 10% acetonitrile. Aminoethanethiol-microcystin was eluted in 100% acetonitrile, followed by drying in a SpeedVac machine. Aiminoethanethiol-microcystin was reacted with swollen NHSactivated sepahrose-4B (GE Healthcare) in 50 mM sodium bicarbonate, pH 9.2. The microcystin-conjugated sepharose was then washed five times alternately with 50 mM Tris, pH 8.0, 0.5 M NaCl and 50 mM sodium acetate pH 4.0, 0.5 M NaCl. The amount of active, conjugated microcystin was estimated by comparing the protein phosphatase 2A (Cayman) inhibitory activity of microcystin standards for each congener and the conjugated microcystin beads in a Ser-Thr phosphatase assay (Promega). Random DNA Library and Primer Set. A random ssDNA library of 1014 nucleotides was chemically synthesized and purified by PAGE (IDT). The ssDNA library consisted of a central random region of 60 nucleotides flanked by two 18 nucleotides-sequences at 3′ and 5′ end. These regions are primer binding sites for amplification of the library sequence. 5′-ATACCAGCTTATTCAATT - N60-AGATAGTAAGTGCAATCT-3′ (96mer). To facilitate the separation of single stranded DNA from amplified double stranded PCR products, the forward and reverse primers were designed and modified with fluorescein and a PEG linker (to block polymerase extension) followed by a poly-A tail as described.33 Forward 10698
dx.doi.org/10.1021/es301686k | Environ. Sci. Technol. 2012, 46, 10697−10703
Environmental Science & Technology
Article
microcystin congener was calculated by nonlinear regression analysis. Electrochemical Detection of Microcystins. Prior to modification, the gold electrodes (2 mm in diameter) were first polished with various particle sizes (1.0, 0.3, and 0.05 μm) alumina slurry (Al2O3), followed by washing with Milli-Q water, ultrasonication for 5 min and dried in a nitrogen stream. The electrodes were then cleaned in piranha solution (3:1 mixture of concentrated H2SO4 and 30% H2O2 for 10 min) and washed with ultrapure water. Next, the electrodes were electrochemically cleaned in 0.1 M H2SO4 by potential scanning between 0.0 and 1.6 V for 5 min, followed by washing with ultrapure water and drying under nitrogen. Finally, the 5′-disulfide terminated aptamers; 1 μM solution of each aptamer in binding buffer were immobilized on the clean gold electrodes by immersing the electrodes for 24 h. After modification, the electrodes were rinsed with binding buffer solution, followed by incubation in 1 mM 6-mercapto-1hexanol (MCH) in 10 mM phosphate buffer, pH 7.0 for 30 min. The modified electrodes were then washed thoroughly with binding buffer and immediately used in the electrochemical experiments, or kept in binding buffer solution at 4 °C until further use. For the cross reactivity experiments, a 5 μL droplet of 1 nM solution MC-LR, -LA, or -YR in binding buffer was added onto the DNA-modified gold electrodes surface and incubated for 30 min. The electrodes were then washed with binding buffer to remove the nonspecifically bound microcystins followed by rinsing with 10 mM Tris-HCl buffer, pH 7.4 before subjected to the electrochemical measurements. Square wave voltammetry (SWV) experiments were carried out using an Autolab PGSTAT302N (Eco Chemie, The Netherlands) potentiostat/galvanostat. A three-electrode system was used for all the electrochemical measurements, consisting of a gold working electrode (modified with DNA), an Ag/AgCl electrode as the reference and a Pt wire as the auxiliary electrode. The voltammetric measurements of DNAmodified gold electrodes were performed in 5 μM [Ru(NH3)6]Cl3 in 10 mM Tris- HCl buffer at pH 7.4 (after incubation in the same solution for 10 min). The parameters used for the SWV measurements: step potential −5 mV, frequency 25 Hz, amplitude 20 mV; interval time 0.04 s and scan rate 125 mV s−1.
Figure 1. Enrichment of microcystin-specific aptamers during the in vitro selection procedure. The bar graphs show the amounts of ssDNA eluted from (a) MC-LR, (b) MC-LA, and (c) MC-YR beads in each selection round with 160 pmol input ssDNA. CS denotes counterselection step for elimination of ssDNA bound to the sepharose beads.
■
RESULTS AND DISCUSSION We employed a DNA library consisting of 1014 random 60nucleotide sequences and screened independently against sepharose beads conjugated with three microcystin congeners (-LR, -YR, and -LA) in a SELEX procedure. With a constant amount of DNA as input in each round, a stepwise increase of DNA recovery was obtained in each of the selection procedures, indicating enrichment of microcystin-binding DNA (Figure 1). DNA recovery for the MC-LR aptamer selection was not significant until the eighth round; while for MC-YR and -LA, significant recoveries (up to 4 pmol DNA) were already obtained in the beginning rounds of selection. We attributed this difference to the properties of the sepharose beads used in the commercial MC-LR sepharose and our inhouse MC-YR and -LA sepharose beads. Our library might contain sequences that have a certain affinity to our in-house beads, which resulted in significant DNA binding in the early rounds. In fact, we have performed several rounds of selection with in-house MC-LR sepharose beads and observed DNA recovery similar to the in-house MC-YR and -LA beads (data
not shown). A counter-selection step could reduce these undesired binding sequences in the screenings against MC-LA and -YR. Instead of applying this harsh selection pressure at the beginning of SELEX, we opted to perform counter-selection when significant DNA enrichment was obtained in order to preserve the very few microcystin-binding sequences. Once the increase in DNA recovery became significantly higher than the previous round, we carried out two consecutive counterselections for MC-LA and -YR after the third and ninth round, respectively. Recovery of DNA significantly reduced in the first counter-selection, implying the elimination of sequences that bind to the sepharose bead and not to microcystins. However, no significant drop in DNA recovery was obtained after the second counter-selection round (Figure 1), suggesting the DNA population not specific to the conjugated microcystin congener was eliminated. For all screenings, recovery plateaued at 8−10 pmol, possibly because of the total occupation of 10699
dx.doi.org/10.1021/es301686k | Environ. Sci. Technol. 2012, 46, 10697−10703
Environmental Science & Technology
Article
Table 1. ssDNA Sequences Selected for Binding Characterization sequence name
sequence
selection target
AN1 AN6 RC4 RC6 RC12 RC22 RC25 HC1
GGGCGCGCTAAAAGTAGGGGGATTGATAAGGGTAAATCATGTATATCGGTGTACTCGCCG GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCTCCGC CACGCACAGAAGACACCTACAGGGCCAGATCACAATCGGTTAGTGAACTCGTACGGCGCG CACGCAACAACACAACATGCCCAGCGCCTGGAACATATCCTATGAGTTAGTCCGCCCACA GCGCGGCGGCAAACTAACTAACGCGAGTAACATACCGGCATCATCAGCCACCCCTGCCGT CGCCAATCTCAAAGCCCGCCACCTGCCCCTCACTGCCCACCTGTGGAATCCATGTCGCTC GACCGCGGCAACACGGACATCATTCTGAAATACGCCATAGTTCTTCAATAGGTTGGTGCC GGACAACATAGGAAAAAGGCTCTGCTACCGGATCCCTGTTGTATGGGCATATCTGTTGAT
MC-LR MC-LR MC-LA MC-LA MC-LA MC-LA MC-LA MC-YR
Figure 2. Affinity and selectivity of the microcystin-targeting aptamers.
binding sites on the beads by the binding DNA. The amount of DNA recovered is consistent with the amount of active microcystin present in the beads (15 pmol). The limiting amount of microcystin represented a stringent selection pressure, which might promote the selection of high affinity binders. Selection cycles were stopped according to enrichment plateau (for MC-LR) and multiple occurrences of identical sequences obtained (for MC-LA and -YR) after the counterselection rounds. We have analyzed 25 clones for each screening by multiple sequence alignment. While we do not have strong consensus sequences, we were able to obtain sequences with multiple occurrences. In particular, we obtained only one sequence after 14 rounds of screening against MC-YR. Nevertheless, clones obtained from the screening against MCLR and -LA showed sequence families with sufficient
similarities, which allowed us to select sequences that have the highest occurrences in each family. All the selected sequences were first tested for binding to sepharose beads without microcystin (see the Supporting Information). Sequences that did not bind to blank sepharose beads were subsequently characterized with sepharose beads conjugated with each microcystin congener (Table 1). The KD’s of the chosen aptamers were in the low- to midnanomolar range, except for AN1, RC12, and RC25 which did not exhibit binding to both blank and microcystin-beads (Figure 2 and Supporting Information). The lowest KD (28 ± 8 nM) was obtained for RC6 against MC-YR, which is several orders of magnitude lower than a MC-LR-targeting aptamer reported previously.36 Interestingly, RC6 was originally selected against MC-LA, but binds to all three microcystin congeners. RC4 and RC22 bind to MC-LA and -LR with similar affinity 10700
dx.doi.org/10.1021/es301686k | Environ. Sci. Technol. 2012, 46, 10697−10703
Environmental Science & Technology
Article
Table 2. Detection Limit of the Microcystin Aptasensorsa
(Figure 2), but with two to 3-fold increase in KD toward MCYR. The MC-YR-targeting aptamer, HC1, showed a KD of 193 ± 28 nM. However, its affinity toward MC-LR and -LA is much weaker, with K D values approaching μM level. More significantly, an aptamer (AN6) selected from screening against MC-LR exhibits a very high degree of selectivity among the congeners, recognizing primarily MC-LR. AN6 binds to MCLR with high affinity (KD = 50 ± 12 nM), 3-fold weaker to MC-LA (KD = 158 ± 39 nM) and no binding to MC-YR. This selectivity implies that the selected aptamers are targeting the variable regions of microcystin, further strengthening our rationale for the chosen immobilization site for increased exposure of the variable regions on the microcystins. In particular, the interaction between AN6 and MC-LR requires a Leu and an Arg at position nos. 2 and 4, respectively. A single Leu to Tyr substitution in MC-YR at position no. 2 completely abolishes the interaction. On the other hand, position no. 4 might be a secondary recognition site since AN6 retained moderate binding to MC-LA, which has an Ala at position no. 4 (Figure 2). We have chosen three aptamers (AN6, RC4, and HC1) that exhibit congener selectivity in order to access the suitability of an electrochemical platform for congener-specific detection of microcystins. We applied an approach similar to the label-free voltammetric aptasensor for lysozyme reported by Yu et al.37 However, in this report the change in the voltammetric response upon binding was explained to be due to the positive nature of lysozyme.37 Here, the DNA aptamers are immobilized on the gold electrodes by self-assembly via thiol chemistry, and exposed to a solution containing the redox cations ([Ru(NH3)6]3+). The cations bind to the aptamer modified surface via electrostatic interaction with the negatively charged phosphate backbone of the DNA, giving a relatively high reduction peak current of [Ru(NH3)6]3+ cations in the SWV. After the specific binding of the microcystins to the corresponding aptamers, the reduction peak current was significantly decreased. This decrease in the voltammetric current is likely due to the folding of the aptamer into a different conformation, resulting in less [Ru(NH3)6]3+ electrostatically bound to the electrode surface. Indeed, the electrochemical sensing depending on the conformation change was mostly used for the detection of large analytes, However, electrochemical aptasensors depending on the conformation change for small molecules have been also reported for cocaine,38 adenosine,39 ATP,40 and theophylline.41 The electrochemical aptasensors constructed from the three chosen aptamers were capable of quantitative detection of their targeted microcystin congener, yielding linear responses from 10 pM to 10 nM microcystin (Figure 4). Since the typical environmental microcystin concentrations fall within this range, the aptasensors are suitable for water analysis. They are also highly sensitive with a detection limit of 7.5−12.8 pM (Table 2), significantly below the allowed concentration limit in water (0.5 μg L−1 or 0.5 nM). The aptasensors, each constructed with a different aptamer as the recognition receptor, showed differences in electrochemical response for different microcystin congeners. In addition, the differences in response were in good agreement with the binding experiments (Figure 3). In particular, with AN6, a MC-LR-specific aptamer, the aptasensor showed a significant peak current change (40%) in the presence of 1 nM MC-LR; while no change was observed in the presence of MC-LA and -YR (Figure 4d). Similarly, with RC4, an aptamer specific to both MC-LA and -LR, the aptasensor
detection limit (pM) aptasensor
MC-LR
MC-LA
MC-YR
AN6 RC4 HC1
11.8 7.5 7.7
10.6 12.8
8.9
a
The linear response of the aptasensors from 10pM to 10nM (Fig. 4) can be represented by the equation, io-i/io (%) = α − β × log[MC] (nM). The detection limit was calculated based on three times the standard deviation of the baseline signals.
Figure 3. Determination of the dissociation constants (KD) for aptamers (a) RC22, (b) RC6, (c) AN6, (d) RC4, (e) HC1, and (f) scrambled negative control sequence. On the basis of the fluorescence recovered, saturation curves were obtained and the dissociation constants were calculated by nonlinear regression analysis.
displayed similar dose−response for MC-LA and -LR. In contrast, MC-YR did not trigger any response in this sensor at concentrations ranging from 10 pM to 10 nM (Figure 4b and d). Interestingly, when HC1 was used as the recognition receptor, the electrochemical response was markedly higher than the same sensor setup with higher-affinity aptamers (AN6 and RC4). In addition, the MC-YR-specific HC1 has very weak affinity to MC-LR and -LA with KD approaching μM level. Despite its low affinity, the HC1 aptasensor yields larger electrochemical response. In addition, it detects all three congeners with only slight difference in dose−response, showing little congener selectivity (Figure. 4c, inset). A large conformation change would cause a significant alteration of electrochemical properties of HC1, thereby yielding a higher electrochemical response, despite that fewer microcystin molecules was captured by HC1. This result implies that, a relatively weak aptamer can still be useful as recognition receptor in high-sensitivity application because electrochemical 10701
dx.doi.org/10.1021/es301686k | Environ. Sci. Technol. 2012, 46, 10697−10703
Environmental Science & Technology
Article
Figure 4. Electrochemical detection of microcystin. SWV of 5.0 μM [Ru(NH3)6]3+ on AN6 aptamer (a), RC4 aptamer (b), HC1 aptamer, (c) modified gold electrodes in 10 mM Tris buffer at pH 7.4 before (black line) and after (red line) incubation with 1 nM MC-LR, -LA, and -YR. (d) Percentage of electrochemical signal change showing congener selectivity of the aptasensor. The inset is the calibration curves based on the change of the % SWV peak current change versus the logarithm of the concentrations.
Notes
detection can significantly amplify the binding signal through factors such as change in molecule conformation. Therefore, optimization of the aptasensor based on these findings could greatly improve microcystin detection in terms of sensitivity and selectivity. Nevertheless, the achieved detection limits for the aptasensor are below the WHO drinking water concentration limit of 0.5 μg L−1 for MC-LR. These results indicate the potential application of the developed aptasensor for routine water analysis. Integrating the high-affinity microcystin binding and congener-selectivity, we expect a microcystin biosensor capable of combining efficient sample preconcentration and subsequent congener-specific quantification, facilitating routine microcystin monitoring with a more accurate measurement and estimate of toxicity. We envisage this highly sensitive and specific detection to be implemented within microfluidic systems for field applications.
■
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS We acknowledge the financial support for the project given by NSERC and NanoQuebec.
■
(1) Dittmann, E.; Wiegand, C. Cyanobacterial toxins–occurrence, biosynthesis and impact on human affairs. Mol. Nutr. Food Res. 2006, 50, 7−17. (2) Pearson, L.; Mihali, T.; Moffitt, M.; Kellmann, R.; Neilan, B. On the chemistry, toxicology and genetics of the cyanobacterial toxins, microcystin, nodularin, saxitoxin and cylindrospermopsin. Mar. Drugs 2010, 8, 1650−1680. (3) Krishnamurthy, T.; Carmichael, W. W.; Sarver, E. W. Toxic peptides from freshwater cyanobacteria (blue-green algae). I. Isolation, purification and characterization of peptides from Microcystis aeruginosa and Anabaena f los-aquae. Toxicon 1986, 24, 865−873. (4) Codd, G. A.; Metcalf, J. S.; Beattie, K. A. Retention of Microcystis aeruginosa and microcystin by salad lettuce (Lactuca sativa) after spray irrigation with water containing cyanobacteria. Toxicon 1999, 37, 1181−1185. (5) Falconer, I. R.; Dornbusch, M.; Moran, G.; Yeung, S. K. Effect of the cyanobacterial (blue-green algal) toxins from Microcystis aeruginosa on isolated enterocytes from the chicken small intestine. Toxicon 1992, 30, 790−793. (6) Guidelines for Drinking-Water Quality. Addendum to Vol. 2: Health Criteria and Other Supporting Information; World Health Organization: Geneva, Switzerland, 1998; www.who.int/water_ sanitation_health/dwq/2edaddvol2a.pdf. (7) Harada, K. I.; et al. Laboratory analysis of cyanotoxins. In Toxic Cyanobacteria in Water: A Guide to Their Public Health Consequences,
ASSOCIATED CONTENT
S Supporting Information *
Sequences of DNA obtained at the end of the selection cycles, additional binding data for blank sepharose beads and nonbinding sequences. This information is available free of charge via the Internet at http://pubs.acs.org/.
■
REFERENCES
AUTHOR INFORMATION
Corresponding Author
*Phone: 514-228-6981; fax: 450-929-8102; e-mail: zourob@ emt.inrs.ca;
[email protected]. Author Contributions
A.N., R.C., and S.E. contributed equally to this work. 10702
dx.doi.org/10.1021/es301686k | Environ. Sci. Technol. 2012, 46, 10697−10703
Environmental Science & Technology
Article
Monitoring and Management; Chorus, I., Bartram, J., Eds.; Routledge: London and New York, 1999; pp 362. (8) Li, P. C. H.; Hu, S.; Lam, P. K. S. Development of a capillary zone electrophoretic method for the rapid separation and detection of hepatotoxic microcystins. Mar. Pollut. Bull. 1999, 39, 250−255. (9) Luukkainen, R.; Namikoshi, M.; Sivonen, K.; Rinehart, K. L.; Niemelä, S. I. Isolation and identification of 12 microcystins from four strains and two bloom samples of Microcystis spp.: Structure of a new hepatotoxin. Toxicon 1994, 32, 133−139. (10) Meriluotoavbt, J. Chromatography of microcystins MicrocystinLR. Anal. Chim. Acta 1997, 352, 277−298. (11) Campbell, D. L.; Lawton, L. A.; Beattie, K. A.; Codd, G. A. Comparative assessment of the specificity of the brine shrimp and microtox assays to hepatotoxic (microcystin-LR-containing) cyanobacteria. Environ. Toxicol. Water Qual. 1994, 9, 71−77. (12) Algal Toxins in Seafood and Drinking Water' Falconer, I. R., Ed.; Academic Press: London, 1993. (13) Protein Phosphorylation: A Practical Approach; Hardie, D. G., Ed.; Oxford University Press: Oxford, 1993. (14) Mountfort, D. O.; Kennedy, G.; Garthwaite, I.; Quilliam, M.; Truman, P.; Hannah, D. J. Evaluation of the fluorometric protein phosphatase inhibition assay in the determination of okadaic acid in mussels. Toxicon 1999, 37, 909−922. (15) Chu, F. S.; Huang, X.; Wei, R. D. Enzyme-linked immunosorbent assay for microcystins in blue-green algal blooms. J. - Assoc. Off. Anal. Chem. 1990, 73, 451−456. (16) Nagata, S.; Soutome, H.; Tsutsumi, T.; Hasegawa, A.; Sekijima, M.; Sugamata, M.; Harada, K.; Suganuma, M.; Ueno, Y. Novel monoclonal antibodies against microcystin and their protective activity for hepatotoxicity. Nat. Toxins 1995, 3, 78−86. (17) Metcalf, J. S.; Bell, S. G.; Codd, G. A. Production of novel polyclonal antibodies against the cyanobacterial toxin microcystin-LR and their application for the detection and quantification of microcystins and nodularin. Water Res. 2000, 34, 2761−2769. (18) Tuerk, C.; Gold, L. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 1990, 249, 505−510. (19) Ellington, A. D.; Szostak, J. W. In vitro selection of RNA molecules that bind specific ligands. Nature 1990, 346, 818−822. (20) Wilson, D. S.; Szostak, J. W. In vitro selection of functional nucleic acids. Annu. Rev. Biochem. 1999, 68, 611−647. (21) Famulok, M.; Mayer, G. Aptamers as tools in molecular biology and immunology. Curr. Top. Microbiol. Immunol. 1999, 243, 123−136. (22) Brody, E. N.; Gold, L. Aptamers as therapeutic and diagnostic agents. J. Biotechnol. 2000, 74, 5−13. (23) Bunka, D. H.; Stockley, P. G. Aptamers come of age - at last. Nat. Rev. Microbiol. 2006, 4, 588−596. (24) Hermann, T.; Patel, D. J. Adaptive recognition by nucleic acid aptamers. Science 2000, 287, 820−825. (25) Lee, J. F.; Hesselberth, J. R.; Meyers, L. A.; Ellington., A. D. Aptamer database. Nucleic Acids Res. 2004, 32, D95−100. (26) Lee, J. F.; Stovall, G. M.; Ellington, A. D. Aptamer therapeutics advance. Curr. Opin. Chem. Biol. 2006, 10, 282−9. (27) Nimjee, S. M.; Rusconi, C. P.; Sullenger, B. A. Aptamers: An emerging class of therapeutics. Annu. Rev. Med. 2005, 56, 555−583. (28) Pagratis, N. C.; Bell, C.; Chang, Y. F.; Jennings, S.; Fitzwater, T.; Jellinek, D.; Dang, C. Potent 2′-amino-, and 2′-fluoro-2′-deoxyribonucleotide RNA inhibitors of keratinocyte growth factor. Nat. Biotechnol. 1997, 15, 68−73. (29) Geiger, A.; Burgstaller, P.; von der Eltz, H.; Roeder, A.; Famulok, M. RNA aptamers that bind L-arginine with sub-micromolar dissociation constants and high enantioselectivity. Nucleic Acids Res. 1996, 24, 1029−36. (30) Joyce, G. F. In vitro evolution of nucleic acids. Curr. Opin. Struct. Biol. 1994, 4, 331−336. (31) Mir, M.; Katakis, I.; Vreeke, M. Aptamer biosensors: An alternative to immunosensors. IVDT. 2007, May issue; www. ivdtechnology.com/article/aptamer-biosensors-alternativeimmunosensors (accessed April 6, 2012).
(32) Torres-Chavolla, E.; Alocilja, E. C. Aptasensors for detection of microbial and viral pathogens. Biosens. Bioelectron. 2009, 24, 175−182. (33) Stoltenburg, R.; Reinemann, C.; Strehlitz, B. FluMag-SELEX as an advantageous method for DNA aptamer selection. Anal. Bioanal. Chem. 2005, 383, 83−91. (34) Moorhead, G.; MacKintosh, R. W.; Morrice, N.; Gallagher, T.; MacKintosh, C. Purification of type 1 protein (serine/threonine) phosphatases by microcystin-Sepharose affinity chromatography. FEBS Lett. 1994, 356, 46−50. (35) Morgenstern, B. DIALIGN: Multiple DNA and Protein Sequence Alignment at BiBiServ. Nucleic Acids Res. 2004, 32, 33−36. (36) Nakamura, C.; Kobayashi, T.; Miyake, M.; Shirai, M.; Miyakea, J. Usage of a DNA Aptamer as a Ligand Targeting Microcystin. Mol. Cryst. Liq. Cryst. 2001, 371, 369−374. (37) Cheng, A.; Ge, B.; Yu, H. Aptamer-Based biosensors for labelfree voltammetric detection of lysozyme. Anal. Chem. 2007, 79, 5158− 5164. (38) Baker, B. R.; Lai, R. Y.; Wood, M. S.; Doctor, E. H.; Heeger, A. J.; Plaxco, K. W. An electronic, aptamer-based small-molecule sensor for the rapid, label-free detection of cocaine in adulterated samples and biological fluids. J. Am. Chem. Soc. 2006, 128, 3138−3139. (39) Zayats, M.; Huang, Y.; Gill, R.; Ma, C.; Willner, I. Label-free and reagentless aptamer-based sensors for small molecules. J. Am. Chem. Soc. 2006, 128, 13666−13667. (40) Zuo, X.; Song, S.; Zhang, J.; Pan, D.; Wang, L.; Fan, C. A targetresponsive electrochemical aptamer switch (TREAS) for reagentless detection of nanomolar ATP. J. Am. Chem. Soc. 2007, 129, 1042− 1043. (41) Ferapontova, E.; Olsen, E. M.; Gothelf, K. V.; An, R. N. A. Aptamer-based electrochemical biosensor for detection of theophylline in serum. J. Am. Chem. Soc. 2008, 130, 4256−4258.
10703
dx.doi.org/10.1021/es301686k | Environ. Sci. Technol. 2012, 46, 10697−10703
