Selection of DNA Aptamers That Recognize α-Synuclein Oligomers

May 30, 2012 - disease and dementia with Lewy bodies. α-Syn oligomers thus ... which are strongly associated with the development of Alzheimer's dise...
7 downloads 0 Views 2MB Size
Download PDF
Article pubs.acs.org/ac

Selection of DNA Aptamers That Recognize α-Synuclein Oligomers Using a Competitive Screening Method Kaori Tsukakoshi, Koichi Abe, Koji Sode, and Kazunori Ikebukuro* Department of Biotechnology and Life Science, Tokyo University of Agriculture and Technology, 2-24-16 Naka-cho, Koganei, Tokyo 184-8588, Japan S Supporting Information *

ABSTRACT: α-Synuclein (α-syn) oligomers are considered major molecules responsible for the onset of Parkinson’s disease and dementia with Lewy bodies. α-Syn oligomers thus serve as an important target for the development of drugs and diagnostic tests for neurodegenerative diseases. In this paper we report on the identification of DNA aptamers that bind to soluble α-syn oligomers. A competitive screening method based on aptamer blotting was used for the selection of α-syn oligomer-specific aptamers. This approach resulted in the identification of eight aptamers that specifically bind to α-syn oligomers among α-syn monomers, oligomers, and fibrils. Interestingly, the aptamers also bound to amyloid β oligomers, which are strongly associated with the development of Alzheimer’s disease. The results of this study support the hypothesis that amyloid oligomers share a common structure. Oligomer-binding aptamers may serve as powerful analytical tools for the design and development of drugs and diagnostic tests for neurodegenerative diseases. In this paper we provide the first report on the DNA aptamers that specifically bind to α-syn oligomers from α-syn monomers, oligomers, and fibrils, recognizing α-syn and Aβ oligomers. Aptamers are DNA or RNA molecules that specifically bind to a target protein, small molecule, or cell, with a dissociation constant in the nano- to picomolar range.16,17 They are selected through an in vitro screening process known as systematic evolution of ligands by exponential enrichment (SELEX). Aptamers are more efficient than antibodies, owing to the ease of modifying active groups, adding useful small compounds (e.g., fluorescent dyes, biotin), renaturing, and designing structural changes. The binding ability and specificity of aptamers are comparable to (or, in certain cases, superior to) those of antibodies. Thus, aptamers have the potential for application as molecular recognition elements in research and diagnostics. Some aptamers against amyloidogenic proteins have been reported previously,18−23 and we first reported the DNA aptamer against α-syn.24 We previously selected the α-synbinding aptamer using α-syn monomer as a target protein and selected the aptamer bound to α-syn monomer, oligomer, and fibril but not to Aβ and BSA (Bovine Serum Albumin) because the aptamer could recognize the amino acid sequence of α-syn. On the other hand, our new aptamers seems to be “confomation specific”; that is, they bind to α-syn oligomer

N

eurodegenerative diseases such as Alzheimer’s disease (AD) and Parkinson’s disease (PD) are generally caused by the overproduction and deposition of amyloidogenic proteins and their aggregates. Recent investigations have clearly demonstrated that soluble amyloid oligomers are the most cytotoxic aggregates, as compared with amyloid fibrils. In vitro and in vivo analyses have also revealed that soluble oligomers destroy synaptic functions1−4 and disrupt the ionic gradient in cells,5,6 possibly caused by oligomers that form channel-like structures and consequently bind to cell membranes.7−9 Additionally, treatment of AD mouse models with antibodies specific to AD-specific amyloid β (Aβ) oligomers resulted in the effective prevention of synaptic degeneration.10 Oligomeric amyloid proteins are considered not only as therapeutic targets but also as diagnostic markers. Aβ oligomers were shown at higher levels in the cerebrospinal fluid of AD patients,11 and α-synuclein (α-syn) oligomers, which are associated with PD and dementia with Lewy bodies, are commonly detected in the cerebrospinal fluid and plasma of PD patients.12,13 To detect amyloid oligomers such as α-syn oligomers and Aβ oligomers, oligomer-binding antibodies or single-chain antibody fragments (scFVs) have been developed.14,15 A11, an extensively studied antibody binding to several amyloid oligomers, and soluble amyloid oligomers share a common structure for molecular recognition, thus suggesting that their toxicity might also be generated via a common mechanism.14 Interestingly, the wide range of recognition of several amyloid oligomers by oligomer-specific scFVs has also been reported.15 © 2012 American Chemical Society

Received: February 2, 2012 Accepted: May 30, 2012 Published: May 30, 2012 5542

dx.doi.org/10.1021/ac300330g | Anal. Chem. 2012, 84, 5542−5547

Analytical Chemistry

Article

but not to α-syn monomer or fibril. In this study we describe αsyn oligomer-specific DNA aptamers isolated by the combination of a gel-shift assay and a previously developed competitive screening method.25 Additionally, in this study we demonstrate that selected DNA aptamers bind to Aβ oligomers.

■

EXPERIMENTAL SECTION Design of a DNA Library. A fluorescein isothiocyanate (FITC)-labeled DNA library consisting of a 24-mer randomized region, an 18-mer primer-binding region at both ends, and a 3-mer thymine linker between the randomized region and the primer-binding region (5′-FITC-ATACTGCCATTCATTTCA-ttt-N24-ttt-AGATATCAGCATGTGTCA-3′) was designed. To avoid loss of structural variety in the randomized regions that will be selected as aptamers, the cDNAs of both primerbinding regions were added to TBS buffer (10 mM Tris−HCl, 150 mM NaCl, 5 mM KCl, pH 7.4) during DNA library folding by heat treatment. Folding of the DNA library and hybridization of cDNAs were carried out at 95 °C for 10 min, and then the DNA library and cDNAs were gradually cooled to 25 °C at a rate of 2 °C/min. All libraries and aptamers were heat treated as described previously before use. All oligonucleotides employed in this study were synthesized elsewhere (Greiner Bio-One, Life Technologies). The DNA sequences are shown in the Supporting Information (Table S1). α-Synuclein Preparation. α-Syn was prepared through recombinant expression in Escherichia coli.24 An α-syn oligomer was generated through two cycles of freeze-drying as described previously24 and purified by size-exclusion chromatography. αSyn fibrils were generated through incubation for 120 h at 37 °C, and the products were confirmed through thioflavin T (TfT) fluorescence. To remove any α-syn monomers and oligomers, the α-syn solution was centrifuged (17400g, 4 °C, 15 min), and the pellet containing the α-syn fibrils was collected. The pellet was then resuspended in 500 μL of phosphatebuffered saline (PBS; 137 mM NaCl, 2.7 mM KCl, 8.1 mM Na2HPO4, 1.4 mM KH2PO4, pH 7.3) and collected again through centrifugation (17400g, 4 °C, 15 min). The PBS wash step was repeated four times. Finally, the α-syn fibrils were resuspended in PBS buffer. The concentration of α-syn fibrils in solution was estimated by measuring the concentration of the supernatant obtained at each wash. Selection of Aptamers. A 1 nmol sample of the DNA library (5 μM) and 20 μg of the α-syn oligomer (0.1 mg/mL) were mixed for 1 h at room temperature (rt). Agarose gel electrophoresis (3%, w/v) was then performed to separate the aptamers bound to the α-syn oligomers. α-Syn oligomers were visualized in the gel through Coomassie brilliant blue staining, and the target-bound DNA was extracted using a MERmaid kit (MP Biomedicals). The selected DNAs were PCR-amplified using FITC-labeled forward primer, biotin-labeled reverse primer, and AmpliTaq Gold DNA polymerase (Life Technologies) or a KAPA2G Fast PCR kit (Kapa Biosystems). Thermal cycles were typically performed as follows: 30 times at 95 °C for 15 s, 55 °C for 15 s, and 72 °C for 30 s, followed by a 7 min extension at 72 °C. For the second round, 19 pmol of the selected DNA library was incubated with 20 μg of α-syn oligomer, and α-syn oligomer-binding DNAs were selected as described in the preceding section. Competitive screening using α-syn monomers, oligomers, and fibrils was based on a previously reported aptamer blotting method (Figure 1). Purified α-syn monomers, oligomers, and fibrils were immobilized on a nitrocellulose membrane and

Figure 1. Competitive screening using α-syn monomers and fibrils as competitors. The DNA library was present on nitrocellulose membrane immobilized α-syn oligomers and competitors. DNA selectively binding to α-syn oligomers, and not to α-syn monomers and fibrils, was extracted and PCR-amplified.

blocked with 4% (w/v) skim milk in TBS-T (Tris-buffered saline (TBS) with 0.05% Tween-20). The DNA library was incubated on a nitrocellulose membrane that spotted with the three α-syn species. DNA from the oligomer-immobilized spots was extracted and PCR-amplified. This screening was repeated three times, and the resulting DNA library was sequenced. Each α-syn oligomer DNA library was subjected to aptamer blotting to check for DNA enrichment and specific binding to α-syn oligomers. A 1 μg aliquot of the α-syn monomers, oligomers, and fibrils was spotted onto a nitrocellulose membrane and reacted with a 100 nM concentration of the DNA library. The membrane was washed with TBS-T, and detection was performed using an anti-FITC antibody conjugated to horeradish peroxidase (HRP; Takara Bio Inc.) at a 1000-fold dilution using TBS-T. The membrane was washed three times with TBS-T and developed using Immobilon Western chemiluminescent HRP substrate (Millipore). Details of the screening conditions are given in the Supporting Information (Table S2). Evaluation of Binding Properties of Clones Obtained from the Selected Library. Aptamer candidate DNA segments having both primer regions were labeled with FITC through hybridization of an FITC-modified cDNA to the 3′terminus of the primer-binding region. The other primerbinding region was masked using unlabeled cDNA. The aptamer candidates were heat-treated in TBS and diluted to 1 μM using TBS-T. An enzyme-linked oligonucleotide assay (ELONA) was used to evaluate the binding capacity to α-syn oligomers. A 1 μg sample of α-syn oligomer was immobilized in a 96-well microtiter plate and incubated at 37 °C for 90 min. The wells were blocked using 4% (w/v) skim milk in TBS-T. FITClabeled aptamer candidates were added to the wells and incubated for 1 h at rt. The wells were washed three times using 100 μL of TBS-T, and an anti-FITC antibody conjugated with HRP, diluted 1000-fold using TBS-T, was added to the wells and incubated under the same conditions. After the wells were washed five times, BM chemiluminescence enzyme-linked immunosorbent assay (ELISA) substrate (POD) (Roche) was added to each well. Chemiluminescence was measured using an Arvo MX 1420 multilabel counter (Perkin-Elmer). Clones that 5543

dx.doi.org/10.1021/ac300330g | Anal. Chem. 2012, 84, 5542−5547

Analytical Chemistry

Article

specifically bound to α-syn oligomers were selected following the aptamer blotting method previously described. These aptamers were resynthesized without the primer-binding regions, and an FITC label and thymine 5-mer linker were added to the 5′-terminus. Analysis of α-Syn Oligomers Generated during the Amyloid Fibrillization Process. Purified α-syn monomers were filtered (Microcon YM-100, Millipore) to remove aggregates and adjusted to a concentration of 1.0 mg/mL using PBS. In a 2.0 mL tube, the α-syn solution was mixed with 0.02% NaN3 and incubated at 37 °C with constant shaking. Aliquots (30 μL) were removed from the incubated sample every 12 h, flash frozen in liquid nitrogen, and stored at −80 °C. Aliquots (1 μL) were spotted onto a nitrocellulose membrane and detected using the aptamers and the anti-αsyn antibody LB509 (Santa Cruz Biotechnology) as previously described. Fibrillization of α-syn was monitored by TfT fluorescence analysis. Binding Analysis for Amyloid β Oligomer. Aβ oligomers were prepared using a method established by Kayed et al.14 Aβ1−40 peptide (Peptide Institute, Inc.) was dissolved in hexafluoro-2-propanol (HFIP) at a concentration of 2.5 mg/ mL and incubated in ice for 20 min. A 100 μL sample of the Aβ1−40 monomer solution was then added to 900 μL of Milli-Q water. After incubation for 20 min at rt, the sample was centrifuged at 14000g for 15 min. The supernatant was collected and subjected to Ar gas bubbling for 30 min to remove HFIP from the supernatant. Aβ1−40 oligomers were obtained by incubating the solution with constant stirring at 800 rpm for 24 h at rt. The solution was then centrifuged at 14000g for 20 min to remove insoluble aggregates, and the supernatant was concentrated by using a 10 kDa MWCO (molecular weight cutoff) filter (Millipore). The concentration of Aβ1−40 oligomers was determined by their absorbance at 280 nm and the molar extinction coefficient of Aβ1−40 at 280 nm.26 ELONA was used to evaluate the binding capacity to Aβ1−40 oligomers and the Kd value of T-SO508 for Aβ1−40 oligomers. Aliquots (0.43 μg) of Aβ1−40 oligomers were added in a 96-well microtiter plate and subjected to 500 nM FITC-labeled aptamers as previously described. A detail of the Kd value analysis is given in the Supporting Information. Comparison with Commercial Antioligomer Antibody. Pyrroloquinoline quinine glucose dehydrogenase (PQQGDH) (Sysmex International Reagents Co. Ltd.), Creactive protein (CRP; Polyscience, Inc.), firefly luciferase from Luciora lateralis expressed in Escherichia coli, and immunoglobulin G (IgG) from mouse serum (Sigma) were comparatively tested in terms of binding specificity. Aliquots (5 pmol) of PQQGDH, CRP, luciferase, and IgG and 0.5 μg of the α-syn oligomers were immobilized onto a nitrocellulose membrane and detected by aptamers and the A11 antibody (Life Technologies), as previously described.

study we carried out a screening protocol based on the gel-shift assay as an initial method for aptamer selection because this can be carried out under near-physiological conditions. The results of this protocol confirmed the enrichment of DNA binding to α-syn oligomers using aptamer blotting analysis (data not shown). To isolate DNA aptamers binding to α-syn oligomers but not to α-syn monomers and fibrils, a competitive screening protocol based on an aptamer blotting method was designed. Because α-syn oligomers exist and accumulate with α-syn monomers and/or fibrils in the brain or cerebrospinal fluid of patients, the aptamers should discriminate α-syn oligomers from α-syn monomers and fibrils. As described in our earlier report,25 the competitive screening method has the advantage of being able to select aptamers on the basis of their binding affinity and specificity compared with the conventional SELEX, which is based on the affinity for a target molecule. We thus selected α-syn monomers and fibrils as competitors to remove the DNA that binds to monomeric and fibrillar forms of α-syn in this experiment. The progress of the entire selection was confirmed by aptamer blotting against α-syn monomers, oligomers, and fibrils (Figure S1, Supporting Information). The fifth DNA library showed specific binding to α-syn oligomers. As a result of sequence analysis of the fifth and sixth libraries, 67 sequences were identified in this study and then their binding capacities to α-syn oligomers were investigated. Finally, as a result of aptamer blotting analysis, eight clones that specifically bound to α-syn oligomers from α-syn monomers, oligomers, and fibrils were identified in this study (Table 1). To Table 1. Aptamer Sequences without Primer and Thymine Linker aptamer name

selected sequence (5′ → 3′)

T-SO517 T-SO606 T-SO554 T-SO530 T-SO552 T-SO504 T-SO508 T-SO602

GGTGGCTGGAGGGGGCGCGAACG GGGTCGGCTGTCCGTGGGTGGGGA CGAGGGGCGTCTGGGAGTGGTCGG GGTGCGGCGGGACTAGTGGGTGTG GCGTGTGGGGCTTGGGCAGCTGGG CAGGGGTGGGCAAAGGGCGGTGGTG GCCTGTGGTGTTGGGGCGGGTGCG GCGGTAGGGTGTGAGCGGAAGGGG

decrease the influence of the primer region on the configuration of the randomized region, both primer regions of the DNA library were blocked using its cDNA. Selected 24-mer sequences with directly modified FITC and the 5-mer of thymine at the 5′-terminus specifically recognized α-syn oligomers, but not α-syn monomers and fibrils (Figure 2).

■

RESULTS AND DISCUSSION SELEX by Gel-Shift and Competitive Assays. In this study we combined two selection methods; one is based on the gel-shift assay (first and second rounds), and the other is an original screening method based on the aptamer blotting assay (third, fourth, and fifth rounds). In this selection, DNA bound to α-syn oligomers in the aqueous solution was concentrated using a screening technique based on the gel-shift assay. We previously reported a screening protocol against native, unfolded α-syn monomer using a gel-shift assay.24 In this

Figure 2. Dot-blot analysis of the binding of FITC-labeled aptamers to different α-syn species. A 1 μg sample of α-syn was immobilized on a nitrocellulose membrane (α-syn monomer, M; α-syn oligomer, O; αsyn fibril, F). FITC-labeled aptamers without the primer-binding regions were used. 5544

dx.doi.org/10.1021/ac300330g | Anal. Chem. 2012, 84, 5542−5547

Analytical Chemistry

Article

incubated for 48 h, spots started appearing, with the spot intensity increasing in a time-dependent manner. Spots resulting from the binding of aptamers were generated shortly before an increase in TfT fluorescence (Figure 3A). All α-syn samples were immobilized on the membrane, which was confirmed by using an anti-α-syn antibody (Figure 3B). These results indicated that the aptamers validated the generation of α-syn oligomers late in the course of α-syn fibrillization, although this could not prove the production of small oligomeric species such as dimers and trimers. Highmolecular-weight α-syn oligomers can disrupt cell viability by forming porelike structures on a cell membrane, and their binding has been observed previously using atomic force microscopy (AFM) imaging.8 High-molecular-weight α-syn oligomers can thus serve as the key targets for PD therapy, and aptamers can be employed as powerful tools in developing drugs for the treatment of PD. Aptamers Bind to Amyloid β Oligomers and Not to Proteins with β-Sheet-Rich Structures. Previous attempts to develop oligomer-binding antibodies revealed that amyloid oligomers fold into common structures regardless of their primary structure. To investigate whether aptamers bind to other amyloid oligomers, the binding of aptamers for Aβ1−40 oligomer was evaluated. As a result of ELONA, all aptamers showed strong chemiluminescent signals from well-immobilized Aβ1−40 oligomers (Figure 4), and the Kd value of T-SO508

We determined the dissociation constants of two aptamers for α-syn oligomers: the Kd values of T-SO508 and T-SO530 for αsyn oligomers were estimated to be 68 and 63 nM, respectively (Figure S2, Supporting Information). Their sequences were not conserved, but all have guaninerich sequences (Table 1). The CD spectra of the aptamers showed two particular peaks, one positive peak at 210 nm and a negative peak at 240 nm (Figure S3, Supporting Information). Because G-quadruplex-forming DNA displays a characteristic positive peak at 210 nm,27,28 it was hypothesized in this study that the aptamers formed G-quadruplex structures. A negative peak at 240 nm and a positive peak at 260 nm are often shown in the spectrum of a parallel type of G-quadruplex. Three aptamers also showed a positive peak at 260 nm in their spectra. However, that peak of three aptamers was weak (Figure S3A,D,H), and two aptamers did not have that peak (Figure S3F,G). Therefore, we expect the guanine bases may generate a scaffold such as a G-quadruplex structure for the aptamer, and the aptamers did not form a unique quadruplex but could mainly form a parallel type of G-quadruplex. From these results, G-quadruplex forms may also be suitable for recognition of a certain β-sheet structure. Oligomer-Specific Reactivity against Incubated α-Syn Samples. For the process of α-syn fibrillization, α-syn oligomers were generated by the aggregation of monomeric α-syn. We analyzed α-syn oligomer generated by in vitro incubation using oligomer-specific aptamers (Figure 3). Immobilization of α-syn samples was confirmed by dot-blot analysis using an anti-α-syn antibody that recognizes the C terminus of α-syn. When α-syn samples were subjected to aptamers, no spot was observed in the α-syn that was collected at the start of the incubation. However, for α-syn samples

Figure 4. ELONA analysis of the binding of FITC-labeled aptamers to Aβ1−40 oligomer. A 0.43 μg sample of Aβ1−40 oligomer was immobilized in a 96-well microtiter plate.

that showed the strongest signal in the ELONA was estimated as 25 nM (Figure S4, Supporting Informaiton). Therefore, the aptamers recognized the common region of amyloid oligomers and not the amino acid sequences of α-syn. The Kd value of TSO508 for the Aβ1−40 oligomer (25 nM) was slightly lower than that for the α-syn oligomers (68 nM), but the difference was not significant. α-Syn has a negatively charged region at its Cterminus, and the negatively charged region was exposed on the surface of the oligomer.29 The exposed C-terminus of α-syn might affect binding of DNA aptamers to α-syn oligomers. Therefore, the aptamer without primer regions might have shown a slightly lower Kd value. A11, a commercial antioligomer antibody, recognizes several amyloid oligomers, such as Aβ, α-syn, human insulin, and prions. However, A11 also binds to the other proteins with a specific structure called a “β-sheet edge”,30 and it was observed in this study that A11 binds to IgG as described below. The

Figure 3. Oligomer-specific reactivity during the fibrillization process. (A) The time course of α-syn fibrillization was determined by TfT fluorescence assay analysis. The spot intensity resulting from T-SO517 binding is also shown in the graph. (B) Results of dot-blotting analysis using the anti-α-syn antibodies T-SO517 and T-SO606. A 1 μg sample of incubated α-syn was immobilized on a membrane and subjected to each ligand. 5545

dx.doi.org/10.1021/ac300330g | Anal. Chem. 2012, 84, 5542−5547

Analytical Chemistry

■

binding specificities of the aptamers and A11 were thus compared with those of oligomers and other β-sheet-rich proteins (Figure 5). The aptamers were shown to strongly bind

Article

ASSOCIATED CONTENT

* Supporting Information S

Tables S1 and S2 and four figures. This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author

*Phone: +81-42-388-7030. Fax: +81-42-388-7030. E-mail: [email protected]. Notes

Figure 5. Comparison of binding specificities of commercially available antibodies. A 0.5 μg aliquot of α-syn oligomer and 5 pmol aliquots of PQQGDH, CRP, luciferase, and IgG were spotted onto a nitrocellulose membrane and reacted with A11, T-SO517, and T-SO606.

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS

■

REFERENCES

This work was supported by a 2009 Grant for Industrial Technology Research (financial support for young researchers) from the New Energy and Industrial Technology Development Organization (NEDO) and Japan Society for the Promotion of Science (JSPS).

to α-syn oligomers and not to PQQGDH, CRP, and luciferase. IgG was shown to weakly bind to the aptamers. On the other hand, A11 showed strong binding to α-syn oligomers and other proteins, particularly IgG. It is possible that the aptamers recognized the β-sheet structure characteristic of soluble amyloid oligomers, but this might be different from the predicted epitope structure of A11. Additionally, these results indicated that the DNA aptamers showed good selectivity and thus might be more suitable than the A11 antibody in immunoassay-based analyses. In addition to the results of this screening, several Gquadruplex-forming aptamers binding to β-structure proteins were also observed in this study. For example, in our published studies, the PQQGDH-binding aptamer31 and an isoform of vascular endothelial growth factor (VEGF121)-binding aptamer32 folded a G-quadruplex structure and bound to PQQGDH and VEGF121, respectively. PQQGDH forms a βpropeller structure consisting of 35 β-strands, whereas the VEGF121 structure is β-sheet-rich, with over 50% of its secondary structure consisting of β-strands. These results suggest that the G-quadruplex form of nucleic acids tends to preferentially bind to the β-structures of proteins, thus allowing a better understanding of DNA−protein interactions.

(1) Gong, Y.; Chang, L.; Viola, K. L.; Lacor, P. N.; Lambert, M. P.; Finch, C. E.; Krafft, G. A.; Klein, W. L. Proc. Natl. Acad. Sci. U.S.A. 2003, 100, 10417−22. (2) Lambert, M. P.; Barlow, A. K.; Chromy, B. A.; Edwards, C.; Freed, R.; Liosatos, M.; Morgan, T. E.; Rozovsky, I.; Trommer, B.; Viola, K. L.; Wals, P.; Zhang, C.; Finch, C. E.; Krafft, G. A.; Klein, W. L. Proc. Natl. Acad. Sci. U.S.A. 1998, 95, 6448−53. (3) Lesne, S.; Koh, M. T.; Kotilinek, L.; Kayed, R.; Glabe, C. G.; Yang, A.; Gallagher, M.; Ashe, K. H. Nature 2006, 440, 352−7. (4) Lesne, S.; Kotilinek, L.; Ashe, K. H. Neuroscience 2008, 151, 745− 9. (5) Demuro, A.; Mina, E.; Kayed, R.; Milton, S. C.; Parker, I.; Glabe, C. G. J. Biol. Chem. 2005, 280, 17294−300. (6) Kelly, B. L.; Ferreira, A. J. Biol. Chem. 2006, 281, 28079−89. (7) Volles, M. J.; Lee, S. J.; Rochet, J. C.; Shtilerman, M. D.; Ding, T. T.; Kessler, J. C.; Lansbury, P. T., Jr. Biochemistry 2001, 40, 7812−9. (8) Ding, T. T.; Lee, S. J.; Rochet, J. C.; Lansbury, P. T., Jr. Biochemistry 2002, 41, 10209−17. (9) Danzer, K. M.; Haasen, D.; Karow, A. R.; Moussaud, S.; Habeck, M.; Giese, A.; Kretzschmar, H.; Hengerer, B.; Kostka, M. J. Neurosci. 2007, 27, 9220−32. (10) Takamura, A.; Okamoto, Y.; Kawarabayashi, T.; Yokoseki, T.; Shibata, M.; Mouri, A.; Nabeshima, T.; Sun, H.; Abe, K.; Urisu, T.; Yamamoto, N.; Shoji, M.; Yanagisawa, K.; Michikawa, M.; Matsubara, E. Mol. Neurodegener. 2011, 6, 20. (11) Fukumoto, H.; Tokuda, T.; Kasai, T.; Ishigami, N.; Hidaka, H.; Kondo, M.; Allsop, D.; Nakagawa, M. FASEB J. 2010, 24, 2716−26. (12) El-Agnaf, O. M.; Salem, S. A.; Paleologou, K. E.; Curran, M. D.; Gibson, M. J.; Court, J. A.; Schlossmacher, M. G.; Allsop, D. FASEB J. 2006, 20, 419−25. (13) Tokuda, T.; Qureshi, M. M.; Ardah, M. T.; Varghese, S.; Shehab, S. A.; Kasai, T.; Ishigami, N.; Tamaoka, A.; Nakagawa, M.; ElAgnaf, O. M. Neurology 2010, 75, 1766−72. (14) Kayed, R.; Head, E.; Thompson, J. L.; McIntire, T. M.; Milton, S. C.; Cotman, C. W.; Glabe, C. G. Science 2003, 300, 486−9. (15) Zhang, X.; Sun, X. X.; Xue, D.; Liu, D. G.; Hu, X. Y.; Zhao, M.; Yang, S. G.; Yang, Y.; Xia, Y. J.; Wang, Y.; Liu, R. T. Biochim. Biophys. Acta 2011, 1814, 1703−12. (16) Ellington, A. D.; Szostak, J. W. Nature 1990, 346, 818−22. (17) Tuerk, C.; Gold, L. Science 1990, 249, 505−10. (18) Proske, D.; Gilch, S.; Wopfner, F.; Schatzl, H. M.; Winnacker, E. L.; Famulok, M. ChemBioChem 2002, 3, 717−25. (19) Ylera, F.; Lurz, R.; Erdmann, V. A.; Furste, J. P. Biochem. Biophys. Res. Commun. 2002, 290, 1583−8.

■

CONCLUSIONS In this study we have employed competitive screening to isolate DNA aptamers that specifically bind to α-syn oligomers. The eight aptamers did not share any sequences in common but can form G-quadruplex structures such as scaffolds because of their guanine-rich sequences. Surprisingly, the aptamers were shown to bind not only to α-syn oligomers but also to Aβ1−40 oligomers. This binding property is similar to those of A11 and oligomer-specific scFV antibodies that have a broad range of recognition for amyloidogenic oligomers. This result supports the theory that amyloid oligomers form a common structure during oligomerization/fibrillization. Because of some advantages of aptamers, these oligomer-specific aptamers can be more efficient than oligomer-binding antibodies and scFVs in the development of drugs and diagnostic assays for AD and PD. In this paper we also propose that the simple competitive screening method could generate highly selective aptamers. Aptamers can potentially serve as analytical tools in research investigations on neurodegenerative diseases. 5546

dx.doi.org/10.1021/ac300330g | Anal. Chem. 2012, 84, 5542−5547

Analytical Chemistry

Article

(20) Rhie, A.; Kirby, L.; Sayer, N.; Wellesley, R.; Disterer, P.; Sylvester, I.; Gill, A.; Hope, J.; James, W.; Tahiri-Alaoui, A. J. Biol. Chem. 2003, 278, 39697−705. (21) Murakami, K.; Nishikawa, F.; Noda, K.; Yokoyama, T.; Nishikawa, S. Prion 2008, 2, 73−80. (22) Takahashi, T.; Tada, K.; Mihara, H. Mol. Biosyst. 2009, 5, 986− 91. (23) Rahimi, F.; Murakami, K.; Summers, J. L.; Chen, C. H.; Bitan, G. PLoS One 2009, 4, e7694. (24) Tsukakoshi, K.; Harada, R.; Sode, K.; Ikebukuro, K. Biotechnol. Lett. 2010, 32, 643−8. (25) Hasegawa, H.; Sode, K.; Ikebukuro, K. Biotechnol. Lett. 2008, 30, 829−34. (26) Jan, A.; Hartley, D. M.; Lashuel, H. A. Nat. Protoc. 2010, 5, 1186−209. (27) Paramasivan, S.; Rujan, I.; Bolton, P. H. Methods 2007, 43, 324− 31. (28) Kypr, J.; Kejnovska, I.; Renciuk, D.; Vorlickova, M. Nucleic Acids Res. 2009, 37, 1713−25. (29) van Rooijen, B. D.; van Leijenhorst-Groener, K. A.; Claessens, M. M.; Subramaniam, V. J. Mol. Biol. 2009, 394, 826−33. (30) Yoshiike, Y.; Minai, R.; Matsuo, Y.; Chen, Y. R.; Kimura, T.; Takashima, A. PLoS One 2008, 3, e3235. (31) Osawa, Y.; Takase, M.; Sode, K.; Ikebukuro, K. Electroanalysis 2009, 21, 1303−1308. (32) Nonaka, Y.; Sode, K.; Ikebukuro, K. Molecules 2010, 15, 215− 25.

5547

dx.doi.org/10.1021/ac300330g | Anal. Chem. 2012, 84, 5542−5547