Article pubs.acs.org/JAFC
Selenium Alleviates Aflatoxin B1‑Induced Immune Toxicity through Improving Glutathione Peroxidase 1 and Selenoprotein S Expression in Primary Porcine Splenocytes Shu Hao, Junfa Hu, Suquan Song, Da Huang, Haibing Xu, Gang Qian, Fang Gan, and Kehe Huang* Institute of Nutritional and Metabolic Disorders in Domestic Animals and Fowls and College of Veterinary Medicine, Nanjing Agricultural University, Nanjing 210095, Jiangsu Province, China ABSTRACT: Selenium (Se) is generally known as an essential micronutrient and antioxidant for humans and animals. Aflatoxin B1 (AFB1) is a frequent contaminant of food and feed, causing immune toxicity and hepatotoxicity. Little has been done about the mechanisms of how Se protects against AFB1-induced immune toxicity. The aim of this present study is to investigate the protective effects of Se against AFB1 and the underlying mechanisms. The primary splenocytes isolated from healthy pigs were stimulated by anti-pig-CD3 monoclonal antibodies and treated by various concentrations of different Se forms and AFB1. The results showed that Se supplementation alleviated the immune toxicity of AFB1 in a dose-dependent manner, as demonstrated by increasing T-cell proliferation and interleukin-2 production. Addition of buthionine sulfoximine abrogated the protective effects of SeMet against AFB1. SeMet enhanced mRNA and protein expression of glutathione peroxidase 1 (GPx1), selenoprotein S (SelS), and thioredoxin reductase 1 without and with AFB1 treatments. Furthermore, knockdown of GPx1 and SelS by GPx1specific siRNA and SelS-specific siRNA diminished the protective effects of SeMet against AFB1-induced immune toxicity. It is concluded that SeMet diminishes AFB1-induced immune toxicity through increasing antioxidant ability and improving GPx1 and SelS expression in splenocytes. This study suggests that organic selenium may become a promising supplementation to protect humans and animals against the decline in immunity caused by AFB1. KEYWORDS: selenomethionine, aflatoxin B1, immune toxicity, oxidative stress, selenoprotein
■
INTRODUCTION Aflatoxin B1 (AFB1), produced by the fungi Aspergillus flavus and Aspergillus parasiticus, is commonly found in foods and feedstuffs and is considered accountable for the increased incidence of health impairment and economic losses.1,2 For example, Lai surveyed the occurrence of aflatoxins (AFs) in rice collected from six provinces in China at 63.5%, and the average concentrations was 0.65 μg/kg.3 Wu described that over 100 nations have AFB1 contamination, which incurs economic losses including export maize and other AFB1-contaminated commodities.4 Numerous epidemiological studies have linked consumption of aflatoxin-contaminated food and feedstuffs to immune toxicity,5 carcinogenicity,6 genotoxicity,7 hepatotoxicity,8 and reproductive disorders.9 Among these, a consensus is growing that chronic toxin poisoning has become an interesting topic in public life because chronic toxin poisoning, which is associated with a reduction of immune function and an increase of susceptibility to infectious diseases, is widespread and covert. Therefore, chronic toxin poisoning brings more serious economic losses in livestock husbandry.10 That is why AFB1induced immune toxicity will be worth studying in the present work. Selenium (Se), although initially considered a toxin, is now viewed as an essential trace element linked to many health benefits in humans and other mammals.11 In recent years, there has been growing interest in selenium in relation to chemopreventive effects,12 oxidant defense,13 and protective effects against cancer and other chronic diseases.14 The biological effects of Se are exerted through covalent bonding within the amino acid selenocysteine (Sec),15 the 21st amino © XXXX American Chemical Society
acid used for selenoprotein synthesis. Numerous selenoprotein families participate in antioxidant defense and redox state regulation, such as cytosolic glutathione peroxidase (GPx), selenoprotein S (SelS), and thioredoxin reductases (TR).16,17 Several previous pieces of evidence have shown that selenoprotein is a key factor in the modulation of the immune system, suggesting that dietary Se levels modulate free thiol levels and specific signaling events during CD4+ T cell activation, thus influencing their proliferation and differentiation.18 However, further work is needed to provide insight into the role of selenium and specific selenoproteins in relation to diverse diseases. From the results of previous studies, the doses of AFB1 and SeMet were determined.19,20 As we know, pigs are extremely sensitive to AFB121 and considered to be a tractable model for human immunity. The spleen is the center of cellular immunity and humoral immunity in body, accounting for 25% of total body lymphatic tissue, containing many lymphocytes and macrophages. That is why this species and tissue for the assays were chosen for the present work. The objectives of this study were to investigate the effect of organic selenium on the AFB1-induced immune toxicity in primary porcine splenocytes and to explore the mechanisms by which selenoprotein affects AFB1-induced immune toxicity. Received: November 26, 2015 Revised: January 23, 2016 Accepted: January 23, 2016
A
DOI: 10.1021/acs.jafc.5b05621 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Article
Journal of Agricultural and Food Chemistry
■
MATERIALS AND METHODS
Table 1. Primers Used for Real-Time Quantitative PCR
Animal and Cell Culture. The experimental animals were approved by the Nanjing Agricultural University Animal Care Committee. A total of 80 normal Meishan pigs with half males and half females, aged 30 days and weighing 8 ± 2 kg, were collected from the breeding center of Jiangsu Polytechnic College of Agriculture and Forestry and killed. The following procedures were performed as previously described.19 Isolated spleen lymphocytes were cultivated with enriched RPMI-1640 medium (Invitrogen, Paisley, Scotland, UK), were added to 10% fetal bovine serum (FBS) and penicillin− streptomycin (20 mg/mL), and cultivated at 37 °C in the incubator with 5% CO2. The viability of isolated spleen lymphocyte was evaluated by 0.4% trypan blue dye exclusion, and the standard of cell viability was used by 95%. Spleen Lymphocyte Proliferation Assay. Spleen lymphocytes (1 × 106 cells/well) were stimulated by anti-pig-CD3 mAb (Abcam, Cambridgeshire, UK) and cultivated in 96-well plates for 60 h. Sodium selenite and SeMet were exposed at 0, 0.5, 1, 2, 4, 8, and 16 μM concentrations. AFB1 was treated at 0, 1, 2, 4, and 8 μg/mL concentrations. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) soluion (Sigma, St. Louis, MO, USA) was later added at 5 mg/mL concentration. Finally, the optical density (OD) value was assessed as absorbance at 490 nm by enzyme-labeled instrument (Bio-Rad, Hercules, CA, USA). Proliferative activity should be expressed as percent of viability. All samples were assayed in quadruplicate. A total of 1 ×106 cells/well carboxyfluorescein succinimidylester (CFSE) (Invitrogen, Paisley, Scotland, UK)-stained splenocytes was cultivated in 24-well plates for 60 h. Subsequently, splenocytes were centrifuged and stained with anti-CD3-PEcy5 (Abcam) and then prepared for flow cytometry analysis. Flow cytometry was performed using FACSCalibur (BD Biosciences, San Jose, CA, USA) flow cytometers with acquisition enabled by CellQuest Pro software (BD Biosciences, San Jose, CA, USA). Color compensation was achieved using an appropriate single fluorochrome-labeled sample. Data were analyzed using FlowJo 7.6.5 (TreeStar). Determination of IL-2 in Splenocytes. Splenocytes (1 × 106 cells/well) were cultivated in 96-well plates and treated with various concentrations of SeMet (0, 0.5, 1, 2, and 4 μM) in the absence (controls) or presence of 4 μg/mL AFB1 for 60 h. The cell supernatants were then collected and assayed for IL-2 by ELISA (BD Biosciences). All samples were assayed in triplicate. GSH Level Analysis. Primary porcine splenocytes at a density of 2 × 106 cells/well in 6-well plates were treated with SeMet at 0, 0.5, 1, 2, and 4 μM with or without 4 μg/mL AFB1 for 60 h. Intracellular glutathione (GSH) in splenocyte cytosol was measured as previously described,19,20 using commercially available kits (Jiancheng, Nanjing, Jiangsu, China). Data were expressed as micromoles of GSH per gram of protein. All samples were assayed in triplicate. Determination of Selenoprotein mRNA Levels by Real-Time PCR. PCR primers (β-actin, GPx1, GPx4, SelS, and TR1) (Table 1) were designed using Beacon Designer (Palo Alto, CA, USA) and synthesized by Invitrogen on the basis of known porcine sequences. A total of 2 ×106 cells/wells were seeded in 6-well plates and cultured as described above. Total RNA was isolated from splenocytes using the RNAiso Plus kit (TaKaRa, Dalian, Liaoning, China) according to the manufacturer’s protocol. The RNA pellet was dissolved in diethyl pyrocarbonate-treated water, and the RNA quality was measured by the absorbance ratio at 260/280 nm. First-strand cDNA was synthesized from 1 μg of total RNA using Oligo dT primers and MMLV reverse transcriptase (TaKaRa) according to the manufacturer’s instructions. Reactions were followed in an ABI Prism Step One Plus detection system (Applied Biosystems, Foster City, CA, USA). In short, reactions were performed in a 20 μL reaction mixture containing 10 μL of 2 × SYBR Green I PCR Master Mix (TaKaRa), 2 μL of cDNA, 1 μL of each primer (10 μM), and 6.8 μL of PCR-grade water. The PCR procedure consisted of a 95 °C step for 30 s followed by 40 cycles consisting of 95 °C for 5 s and 60 °C for 30 s. A dissociation curve was run for each plate to confirm the production of a single
gene
accession no.
Actb
DQ845171.1
GPx1
NM_214201
GPx4
NM_214407.1
TR1
NM_214154
SelS
DQ845171.1
primer sequence (5′−3′) forward: CTGCGGCATCCACGAAACT reverse: AGGGCCGTGATCTCCTTCTG forward: TGGGGAGATCCTGAATTG reverse: GATAAACTTGGGGTCGGT forward: GATTCTGGCCTTCCCTTGC reverse: TCCCCTTGGGCTGGACTTT forward: CCCTGGTGACAAAGAGTA reverse: GTCCTGGTCAAATCCTCT forward: GGAAGCGTCAGGAAGAAG reverse: TTAGCCTCATCCACCAGAT
product (bp) 147
172
183
184
102
product. The ratio of the level of various selenoproteins to that of the β-actin internal control was used for statistical comparison of the different treatments. Western Blot Analysis. Spleen lymphocyte suspension was cultured in a 6-well plate at a density of 2 × 106 cells/well for 60 h. After separation by 15% sodium dodecyl sulfate−polyacrylamide gel electrophoresis (SDS-PAGE), protein molecules were transferred to a polyvinylidene difluoride (PVDF) membrane (Bio-Rad Trans-Blot SD) and then incubated using a specific antibody to quantitatively detect GPx1 (1/500) (goat anti-GPx1 from Santa Cruz Biotechnology, Dallas, TX, USA) and SelS (1/500) protein (rabbit anti-actin from Santa Cruz Biotechnology) in TBST. After the first antibody reaction overnight, the PVDF membrane was washed by TBST three times and incubated in horseradish peroxidase (HRP)-labeled anti-rabbit secondary antibody (Cell Signaling Technology, Danvers, MA, USA), diluted 1/5000 in 5 TBST. Blots were visualized according to the standard enhanced chemiluminescence system (Bio-Rad, Hercules, CA, USA). Small Interfering RNA (siRNA) Transfection. Specific siRNA was designed using the sequence of Sus scrofa GPx1 mRNA (GenBank accession no. NM_214201.1) and SelS mRNA (GenBank accession no. NM_001164113) by Invitrogen BlockiT RNAi designer. The GPx1-specific siRNA sequence was 5′-GGGACUACACCCAGAUGAATT-3′. The control siRNA had the sequence 5′-UUCUCCGAACGUGUCACGUTT-3′. The SelS-specific siRNA sequence was 5′GCUUUAGCAGCAGCUCGUUTT-3′. The control siRNA had the sequence 5′-AACGAGCUGCUGCUAAAGCTT-3′. Duplexes were resuspended in DEPC-treated water to obtain 20 μM solutions before use. Primary porcine splenocytes in RPMI-1640 10% FBS without antibiotics were seeded in 6-well plates at a density of 2 × 106 cells/ well and incubated at 37 °C. X-tremeGene siRNA transfection reagent (Roche, Basel, Switzerland) (2.5 μL) and 0.5 μg of siRNA were added to each well and incubated for 5 h. The cells were then washed and transferred to RPMI-1640 + 10% FBS. Statistical Analysis. Statistical analyses were performed by a oneway analysis of variance (ANOVA) followed by Tukey’s b (K) posttest to separate the means using the SPSS 18.0 computer program for Windows (Statistical Product and Service Solutions, Inc., Chicago, IL, USA). Results are expressed as the mean ± standard error (SEM). p values of 90% organic selenium and >75% SeMet.28 The aim of the current study is to provide a theoretical foundation for the wide application of selenium-riched yeast and selenium-enriched probiotics, so we chose SeMet as the organic selenium resource in our cell experiment. Both Se resources have lower immune toxicity; however, SeMet showed a wider safe range and better protective effects than sodium selenite. Chen et al. showed that SeMet exhibited significantly lower toxicity compared with sodium selenite over a range of concentrations in PK15 cells, which was consistent with a previous study.29 Besides, Anjum demonstrated that among the organic forms of selenium, SeMet was bioavailable to a higher extent than selenocysteine,30 and Le31 reported that Se derived from SeMet showed the highest digestibility and bactericidal activities, significantly higher than those of Se from selenite and selenocysteine (57.47 to 45.95 and 46.56%). In contrast, the physiological concentration of Se in humans and pigs was 2 μM.32 Above all, SeMet at concentrations between 0.5 and 4 μM was selected in the present study. In this range of concentrations, SeMet does not have any toxic effect on primary porcine splenocytes. In anti-CD3-induced T cells, we found that SeMet supplementation was effective in protecting cells from 4 μg/ mL AFB1-induced immune toxicity as demonstrated by increasing cell proliferation and IL-2 production activity. To ensure the accuracy of the results, both MTT and flow cytometry were used as effective methods to measure the proliferation of T cells in the present experiment. Our current results strongly indicated SeMet could alleviate AFB1-induced immune toxicity in primary porcine splenocytes. To our knowledge, AFB1 treatment induced intracellular oxidative stress in the splenocytes, and the AFB1-induced immunotoxic effects were due to an increase of redox status. GSH was measured as an indicator of redox status;33 previous research indicated that GSH, a major intracellular thiol, will arise under more reduced conditions when more selenium is supplemented.34 We hypothesized that SeMet protected splenocytes against AFB1-induced immune toxicity by improving the intracellular oxidative stress. Our data show that supplementation with SeMet significantly alleviated AFB1induced GSH depletion. Moreover, we observed that BSO addition could enhance AFB1-induced immune toxicity and diminished the protective effects of SeMet against AFB1induced immune toxicity as measured by decreasing cell proliferation and IL-2 production. Both strongly indicated that SeMet could protect splenocytes against AFB1-induced immune toxicity by improving antioxidant capacity.
■
AUTHOR INFORMATION
Corresponding Author
*(K.H.) Mail: College of Veterinary Medicine, Nanjing Agricultural University, Nanjing 210095, Jiangsu Province, China. Phone: +86-25-84395507. Fax: +86-25-84398669. Email:
[email protected]. G
DOI: 10.1021/acs.jafc.5b05621 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Article
Journal of Agricultural and Food Chemistry Funding
kappaB DNA-binding promoted by selenite. Antioxid. Redox Signaling 2007, 9, 115−121. (18) Hoffmann, F. W.; Hashimoto, A. C.; Shafer, L. A.; Dow, S.; Berry, M. J.; Hoffmann, P. R. Dietary selenium modulates activation and differentiation of CD4+ T cells in mice through a mechanism involving cellular free thiols. J. Nutr. 2010, 140, 1155−1161. (19) Hao, S.; Pan, S.; Hu, J.; Qian, G.; Gan, F.; Huang, K. Aflatoxin B1 suppressed T-cell response to anti-pig-CD3 monoclonal antibody stimulation in primary porcine splenocytes: a role for the extracellular regulated protein kinase (ERK1/2) MAPK signaling pathway. J. Agric. Food Chem. 2015, 63, 6094−7101. (20) Ren, F.; Chen, X.; Hesketh, J.; Gan, F.; Huang, K. Selenium promotes T-cell response to TCR-stimulation and ConA, but not PHA in primary porcine splenocytes. PLoS One 2012, 7, e35375. (21) Weaver, A. C.; See, M. T.; Hansen, J. A.; Kim, Y. B.; De Souza, A. L.; Middleton, T. F.; Kim, S. W. The use of feed additives to reduce the effects of aflatoxin and deoxynivalenol on pig growth, organ health and immune status during chronic exposure. Toxins 2013, 5, 1261− 1281. (22) Parveen, F.; Nizamani, Z. A.; Gan, F.; Chen, X.; Shi, X.; Kumbhar, S.; Zeb, A.; Huang, K. Protective effect of selenomethionine on aflatoxin B1-induced oxidative stress in MDCK cells. Biol. Trace Elem. Res. 2014, 157, 266−274. (23) Zimmermann, C. E.; Cruz, I. B.; Cadona, F. C.; Machado, A. K.; Assmann, C.; Schlemmer, K. B.; Zanette, R. A.; Leal, D. B.; Santurio, J. M. Cytoprotective and genoprotective effects of beta-glucans against aflatoxin B1-induced DNA damage in broiler chicken lymphocytes. Toxicol. In Vitro 2015, 29, 538−543. (24) You, L.; Liu, C.; Yang, Z. J.; Li, M.; Li, S. Prediction of selenoprotein T structure and its response to selenium deficiency in chicken immune organs. Biol. Trace Elem. Res. 2014, 160, 222−231. (25) Pietschmann, N.; Rijntjes, E.; Hoeg, A.; Stoedter, M.; Schweizer, U.; Seemann, P.; Schomburg, L. Selenoprotein P is the essential selenium transporter for bones. Metallomics: Integrated Biometal Sci. 2014, 6, 1043−1049. (26) Agar, G.; Alpsoy, L.; Bozari, S.; Erturk, F. A.; Yildirim, N. Determination of protective role of selenium against aflatoxin B1induced DNA damage. Toxicol. Ind. Health 2013, 29, 396−403. (27) Chen, K.; Shu, G.; Peng, X.; Fang, J.; Cui, H.; Chen, J.; Wang, F.; Chen, Z.; Zuo, Z.; Deng, J.; Geng, Y.; Lai, W. Protective role of sodium selenite on histopathological lesions, decreased T-cell subsets and increased apoptosis of thymus in broilers intoxicated with aflatoxin B1. Food Chem. Toxicol. 2013, 59, 446−454. (28) Pan, C. L.; Zhao, Y. X.; Liao, S. F. F.; Chen, F.; Qin, S. Y.; Wu, X. S.; Zhou, H.; Huang, K. H. Effect of selenium-enriched probiotics on laying performance, egg quality, egg selenium content, and egg glutathione peroxidase activity. J. Agric. Food Chem. 2011, 59, 11424− 11431. (29) Chen, X.; Ren, F.; Hesketh, J.; Shi, X.; Li, J.; Gan, F.; Huang, K. Selenium blocks porcine circovirus type 2 replication promotion induced by oxidative stress by improving GPx1 expression. Free Radical Biol. Med. 2012, 53, 395−405. (30) Anjum, K.; Platel, K. Bioaccessibility of selenium, selenomethionine and selenocysteine from foods and influence of heat processing on the same. Food Chem. 2016, 194, 1293−1299. (31) Le, K. T.; Fotedar, R. Bioavailability of selenium from different dietary sources in yellowtail kingfish (Seriola lalandi). Aquaculture 2014, 420, 57−62. (32) Pillai, R.; Uyehara-Lock, J. H.; Bellinger, F. P. Selenium and selenoprotein function in brain disorders. IUBMB Life 2014, 66, 229− 239. (33) Chowdhury, A. A.; Chaudhuri, J.; Biswas, N.; Manna, A.; Chatterjee, S.; Mahato, S. K.; Chaudhuri, U.; Jaisankar, P.; Bandyopadhyay, S. Synergistic apoptosis of CML cells by buthionine sulfoximine and hydroxychavicol correlates with activation of AIF and GSH-ROS-JNK-ERK-iNOS pathway. PLoS One 2013, 8, e73672. (34) Cao, F.; Wang, N.; Zhang, M.; Dai, H.; Dawood, M.; Zhang, G.; Wu, F. Comparative study of alleviating effects of GSH, Se and Zn
This work was funded by the National Natural Science Foundation of China (31272627, 31472253), the Research Fund for Doctoral Program of Higher Education in China (20110097110014 and 20120097130002), and the Priority Academic Program Development of Jiangsu Higher Education Institutions (Jiangsu, China). Notes
The authors declare no competing financial interest.
■
REFERENCES
(1) Flores-Flores, M. E.; Lizarraga, E.; de Cerain, A. L.; GonzalezPenas, E. Presence of mycotoxins in animal milk: a review. Food Control 2015, 53, 163−176. (2) Grace, D.; Mahuku, G.; Hoffmann, V.; Atherstone, C.; Upadhyaya, H. D.; Bandyopadhyay, R. International agricultural research to reduce food risks: case studies on aflatoxins. Food Secur. 2015, 7, 569−582. (3) Lai, X. W.; Liu, R. C.; Ruan, C. Q.; Zhang, H.; Liu, C. L. Occurrence of aflatoxins and ochratoxin A in rice samples from six provinces in China. Food Control 2015, 50, 401−404. (4) Wu, F. Global impacts of aflatoxin in maize: trade and human health. World Mycotoxin J. 2015, 8, 137−142. (5) Meissonnier, G. M.; Pinton, P.; Laffitte, J.; Cossalter, A. M.; Gong, Y. Y.; Wild, C. P.; Bertin, G.; Galtier, P.; Oswald, I. P. Immunotoxicity of aflatoxin B1: impairment of the cell-mediated response to vaccine antigen and modulation of cytokine expression. Toxicol. Appl. Pharmacol. 2008, 231, 142−149. (6) Lorico, A.; Nesland, J.; Emilsen, E.; Fodstad, O.; Rappa, G. Role of the multidrug resistance protein 1 gene in the carcinogenicity of aflatoxin B1: investigations using mrp1-null mice. Toxicology 2002, 171, 201−205. (7) Zeinvand-Lorestani, H.; Sabzevari, O.; Setayesh, N.; Amini, M.; Nili-Ahmadabadi, A.; Faramarzi, M. A. Comparative study of in vitro prooxidative properties and genotoxicity induced by aflatoxin B1 and its laccase-mediated detoxification products. Chemosphere 2015, 135, 1−6. (8) Lu, X.; Hu, B.; Shao, L.; Tian, Y.; Jin, T.; Jin, Y.; Ji, S.; Fan, X. Integrated analysis of transcriptomics and metabonomics profiles in aflatoxin B1-induced hepatotoxicity in rat. Food Chem. Toxicol. 2013, 55, 444−455. (9) Shuaib, F. M. B.; Ehiri, J.; Abdullahi, A.; Williams, J. H.; Jolly, P. E. Reproductive health effects of aflatoxins: a review of the literature. Reprod. Toxicol. 2010, 29, 262−270. (10) Bircan, C.; Koc, M. Aflatoxins in dried figs in Turkey: a comparative survey on the exported and locally consumed dried figs for assessment of exposure. J. Agric. Sci. Technol.−Iran 2012, 14, 1265− 1274. (11) Hatfield, D. L.; Tsuji, P. A.; Carlson, B. A.; Gladyshev, V. N. Selenium and selenocysteine: roles in cancer, health, and development. Trends Biochem. Sci. 2014, 39, 112−120. (12) Li, J. L.; Gao, R.; Li, S.; Wang, J. T.; Tang, Z. X.; Xu, S. W. Testicular toxicity induced by dietary cadmium in cocks and ameliorative effect by selenium. BioMetals 2010, 23, 695−705. (13) Bellinger, F. P.; Raman, A. V.; Reeves, M. A.; Berry, M. J. Regulation and function of selenoproteins in human disease. Biochem. J. 2009, 422, 11−22. (14) Nicastro, H. L.; Dunn, B. K. Selenium and prostate cancer prevention: insights from the selenium and vitamin E cancer prevention trial (SELECT). Nutrients 2013, 5, 1122−1248. (15) Kryukov, G. V.; Castellano, S.; Novoselov, S. V.; Lobanov, A. V.; Zehtab, O.; Guigo, R.; Gladyshev, V. N. Characterization of mammalian selenoproteomes. Science 2003, 300, 1439−1443. (16) Papp, L. V.; Lu, J.; Holmgren, A.; Khanna, K. K. From selenium to selenoproteins: synthesis, identity, and their role in human health. Antioxid. Redox Signaling 2007, 9, 775−806. (17) Ueno, H.; Kajihara, H.; Nakamura, H.; Yodoi, J.; Nakamuro, K. Contribution of thioredoxin reductase to T-cell mitogenesis and NFH
DOI: 10.1021/acs.jafc.5b05621 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Article
Journal of Agricultural and Food Chemistry under combined contamination of cadmium and chromium in rice (Oryza sativa). BioMetals 2013, 26, 297−308. (35) Turanov, A. A.; Shchedrina, V. A.; Everley, R. A.; Lobanov, A. V.; Yim, S. H.; Marino, S. M.; Gygi, S. P.; Hatfield, D. L.; Gladyshev, V. N. Selenoprotein S is involved in maintenance and transport of multiprotein complexes. Biochem. J. 2014, 462, 555−565. (36) Takayama, H.; Misu, H.; Iwama, H.; Chikamoto, K.; Saito, Y.; Murao, K.; Teraguchi, A.; Lan, F.; Kikuchi, A.; Saito, R.; Tajima, N.; Shirasaki, T.; Matsugo, S.; Miyamoto, K.; Kaneko, S.; Takamura, T. Metformin suppresses expression of the selenoprotein P gene via an AMP-activated kinase (AMPK)/FoxO3a pathway in H4IIEC3 hepatocytes. J. Biol. Chem. 2014, 289, 335−345. (37) Speckmann, B.; Gerloff, K.; Simms, L.; Oancea, I.; Shi, W.; McGuckin, M. A.; Radford-Smith, G.; Khanna, K. K. Selenoprotein S is a marker but not a regulator of endoplasmic reticulum stress in intestinal epithelial cells. Free Radical Biol. Med. 2014, 67, 265−277. (38) Penglase, S.; Hamre, K.; Rasinger, J. D.; Ellingsen, S. Selenium status affects selenoprotein expression, reproduction, and F1 generation locomotor activity in zebrafish (Danio rerio). Br. J. Nutr. 2014, 111, 1918−1931. (39) Gupta, R.; Sharma, V. Ameliorative effects of tinospora cordifolia root extract on histopathological and biochemical changes induced by aflatoxin-b(1) in mice kidney. Toxicol. Int. 2011, 18, 94− 98. (40) Van Blarigan, E. L.; Ma, J.; Kenfield, S. A.; Stampfer, M. J.; Sesso, H. D.; Giovannucci, E. L.; Witte, J. S.; Erdman, J. W., Jr.; Chan, J. M.; Penney, K. L. Plasma antioxidants, genetic variation in SOD2, CAT, GPX1, GPX4, and prostate cancer survival. Cancer Epidemiol., Biomarkers Prev. 2014, 23, 1037−1046. (41) Crosley, L. K.; Bashir, S.; Nicol, F.; Arthur, J. R.; Hesketh, J. E.; Sneddon, A. A. The single-nucleotide polymorphism (GPX4c718t) in the glutathione peroxidase 4 gene influences endothelial cell function: interaction with selenium and fatty acids. Mol. Nutr. Food Res. 2013, 57, 2185−2194. (42) Gan, F.; Xue, H.; Huang, Y.; Pan, C.; Huang, K. Selenium alleviates porcine nephrotoxicity of ochratoxin A by improving selenoenzyme expression in vitro. PLoS One 2015, 10, e0119808. (43) Curran, J. E.; Jowett, J. B.; Elliott, K. S.; Gao, Y.; Gluschenko, K.; Wang, J.; Abel Azim, D. M.; Cai, G.; Mahaney, M. C.; Comuzzie, A. G.; Dyer, T. D.; Walder, K. R.; Zimmet, P.; MacCluer, J. W.; Collier, G. R.; Kissebah, A. H.; Blangero, J. Genetic variation in selenoprotein S influences inflammatory response. Nat. Genet. 2005, 37, 1234−1241. (44) Hall, J. A.; Bobe, G.; Vorachek, W. R.; Hugejiletu; Gorman, M. E.; Mosher, W. D.; Pirelli, G. J. Effects of feeding selenium-enriched alfalfa hay on immunity and health of weaned beef calves. Biol. Trace Elem. Res. 2013, 156, 96−110. (45) Fradejas, N.; Pastor, M. D.; Mora-Lee, S.; Tranque, P.; Calvo, S. SEPS1 gene is activated during astrocyte ischemia and shows prominent antiapoptotic effects. J. Mol. Neurosci. 2008, 35, 259−265.
I
DOI: 10.1021/acs.jafc.5b05621 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
