Self-Assembled Double-Bundle DNA Tetrahedron ... - ACS Publications

Subscriber access provided by NEW MEXICO STATE UNIV

Biological and Medical Applications of Materials and Interfaces

Self-assembled Double Bundle DNA Tetrahedron for Efficient Antisense Delivery Juanjuan Yang, Qiao Jiang, Lin He, Pengfei Zhan, Qing Liu, Shaoli Liu, Meifang Fu, Jianbing Liu, Can Li, and Baoquan Ding ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.8b07889 • Publication Date (Web): 02 Jul 2018 Downloaded from http://pubs.acs.org on July 2, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Self-assembled Double Bundle DNA Tetrahedron for Efficient Antisense Delivery Juanjuan Yang,† Qiao Jiang,‡ Lin He,† Pengfei Zhan,‡ Qing Liu,‡ Shaoli Liu,‡ Meifang Fu,‡ Jianbing Liu,*,‡ Can Li,*,† and Baoquan Ding*,‡,§ †

Bio-X Institutes, Key Laboratory for the Genetics of Developmental and Neuropsychiatric Dis-

orders (Ministry of Education), Shanghai Jiao Tong University, Shanghai, China. ‡

CAS Key Laboratory of Nanosystem and Hierarchical Fabrication, CAS Center for Excellence

in Nanoscience, National Center for Nanoscience and Technology, Beijing 100190, China. §

University of Chinese Academy of Sciences, Beijing 100049, China.

Keywords: Double bundle DNA tetrahedron, antisense oligonucleotides, drug delivery, cancer therapy, self-assembly

Abstract DNA nanostructures are promising biomaterials capable of arranging multiple functional components with nanometer precision. Here, a double bundle DNA tetrahedron is rationally designed to integrate with antisense oligonucleotides silencing proto-oncogene c-raf and nuclear targeting peptides. The functionalized DNA tetrahedron can be internalized by A549 cells and assists the

ACS Paragon Plus Environment

1

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 24

delivery of antisense oligonucleotides towards the nucleus to increase the chance to downregulate target mRNA in nucleus and cytoplasm. Antisense strands released from the tetrahedron in response to the intracellular reducing environment can inhibit cell proliferation at a low concentration without transfection reagent. Finally, efficient knockdown of c-raf gene is observed, which verified our design. This designer DNA-based nanocarrier system will open a new avenue for efficient delivery of nucleic acid drugs.

1. Introduction DNA nanotechnology demonstrated substantial advantage in the rational design of nanostructures with controlled sizes and shapes.1 Due to the addressability and programmability, DNA nanostructures can be used to organize a variety of functional components.2 Additionally, DNA nanostructures with designed sequences do not exhibit obvious cytotoxicity and immunogenicity to live cells, thus were widely employed in the biomedical researches such as bio-imaging,3-5 cellular immunity,6, 7 disease diagnosis8, 9 and drug delivery.10-14 Antisense oligonucleotides (ASOs) are a series of small DNA single strands that are complementary to target mRNA sequences. ASOs can be used for the regulation of gene expression,15 and have great potential to work as therapeutic agents for gene therapy in human diseases such as viral diseases, dominant hereditary diseases, malignancies and so on.16 Unfortunately, negative charge, serum instability and off-target effect of ASOs are the main obstacles to limit their clinical application.17 With enhanced stability, phosphorothioate oligonucleotides have been approved by FDA (Food and Drug Administration) for clinical studies.18 However, low affinity towards target mRNAs 19 and toxic side-effect remain as the great challenge for its broad clinical


2

Page 3 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


application.20 In order to deliver the classic antisense oligonucleotides with natural activity, the rational design and construction of efficient delivery system are in great demand. Various carriers have been constructed for antisense delivery, such as liposomes,21 micelles,22 dendrimers,23 polymeric nanoparticles,24 inorganic nanoparticles25 and DNA hydrogels.26 The programmability and bio-compatibility of DNA nanostructure make it a promising candidate for antisense drug delivery.27 DNA tetrahedron, in which each edge is made of DNA duplex, demonstrated outstanding mechanical rigidity and structural stability due to its pyramid-like structure with four triangle faces and six edges.28-30 Over the past decades, various DNA tetrahedrons were constructed and investigated for their delivery capability.31-33 Turberfield et al. discovered that tetrahedral DNA can be internalized by mammalian cells despite the negative charges of phosphate backbone.34 Fan’s group delivered a CpG loaded DNA tetrahedron into RAW264.7 cells to induce the immunostimulatory response.7 Traditional duplex DNA tetrahedron has been widely employed for the biomedical applications. Double bundle DNA tetrahedron invented by Mao et al35 has demonstrated enhanced stability and rigidity in comparison with duplex DNA tetrahedron. With more binding sites for chemical modification and drug loading, double bundle DNA tetrahedron structure can be applied for the development of efficient drug delivery system. Here, we report for the first time that a double bundle DNA tetrahedron consisting of four three-point-star tiles is used to deliver ASOs (silencing proto-oncogene c-raf) into live cells. Different from previously reported DNA tetrahedrons, we constructed DNA tetrahedron with double bundle edges, which allow it to carry more ASOs to increase the effective concentration. In consideration of the stability, ASOs are rationally organized at the inside surface of the double bundle DNA nanocarrier to decrease the access of DNA digestive enzymes. Besides, the double


3


Page 4 of 24

bundle edges are more resistant to enzyme degradation than duplex DNA. Functionalized with nuclear localization signal peptide (NLS)36 and ASO strands containing disulfide bond, the ASOs loaded DNA tetrahedron with NLS conjugation can deliver ASOs towards the nucleus and subsequently release the ASOs mainly around the nucleus in response to reducing environment for enhanced down-regulation of target mRNA in nucleus and cytoplasm. The induced cytotoxicity, reduced mRNA and protein expression levels of c-raf gene were carefully studied in A549 lung epithelial cells.

Figure 1. Schematic illustration of multi-functional double bundle DNA tetrahedron and its cellular uptake fate. NLS peptides are conjugated to the vertices of the tetrahedron, and ASOs silencing proto-oncogene c-raf are appended to the inside surface of tetrahedron (nasTET). 2. Results and Discussion


4

Page 5 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Our double bundle DNA tetrahedron is modified from previous reports from Mao’s group37-38 and Yan’s group6 (Figures 1 and S1-S3). The edges of the tetrahedron with 43 base pairs (bp) (about 14 nm in length) are double bundle DNA. NLSs were efficiently coupled to the terminal of DNA strand through “click” reaction (Figure S4). Based on hybridization of NLS conjugated DNA strands (NLS-linker), 12 exposed NLS peptides on four vertices were obtained. As shown in Figures S1-S3, 12 capture strands were extended from the inside surface of tetrahedron to assemble the corresponding ASOs. Then, ASOs will be loaded at the inside surface of tetrahedron and partly protected from enzyme degradation. As shown in Figure S3, strands L, NLS-linker, Cy5-linker, S and Antisense were mixed together with a molar radio of 1: 3: 3: 3: 3 and annealed from 95 °C to 25 °C for 24 hours to assemble the ASOs loaded NLS-tetrahedrons (nasTET). The one-pot assembled DNA nanostructure was also verified by native polyacrylamide gel electrophoresis (PAGE), agarose gel electrophoresis, atomic force microscopy (AFM) transmission electron microscope (TEM), and dynamic light scattering (DLS).


5


Page 6 of 24

Figure 2. Characterization of nasTET. (a) 4% native polyacrylamide gel electrophoresis (PAGE) analysis of step-by-step construction of the tetrahedron structure. (b) AFM image of nasTET. (Scale bar = 100 nm) (c) DLS characterization of nasTET (PDI, 0.386). As shown in Figure 2a, 4% native PAGE demonstrated the step-by-step construction of nasTET. A distinct band with the mobility slightly lower than 500 bp was present, indicating the formation of the intended structure. The efficiency of assembly was calculated to be 92% by Image J analysis. Agarose gel electrophoresis was also used to examine the formation of DNA tetrahedron (TET), ASOs loaded DNA tetrahedron (asTET) and nasTET. The clear single band in each lane indicated the successful assembly of corresponding nanostructures (Figure S5). Clear nanoparticle-like morphology of nasTET (Figures 2b, S6a and S6b) was observed by AFM and TEM, which verified the formation of monodispersed nanostructures of nasTET. The size and height of nasTET (Figure S6a) was measured to be 24.12±2.23 nm and 4.33±0.22 nm in the dried state, respectively. Additionally, DLS was performed to characterize the size of functional TET structure in solution (Figures 2c and S6c). The hydrodynamic diameter of nasTET


6

Page 7 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


was 18.72±5.21 nm. Zeta potential measurements demonstrated the negative charge of nasTET was greatly reduced in comparison with that of TET and asTET nanostructures due to the assembly of positively charged NLS peptides (Figure S6d). After the successful assembly of nasTET nanostructures, we investigated their serum stability in 10% human serum (HS) and 10% fetal bovine serum (FBS) at 37 °C, respectively. Gel electrophoresis showed that the band of the TET structures can be clearly observed after 12 hours incubation, reflecting the presence of intact nanostructure (Figure S7a). As shown in Figure S7b, ASOs released from nasTET demonstrated enhanced stability than the free unprotected ASOs. Clathrin-dependent and caveolin-dependent pathways are the two major receptor-mediated endocytic process.39 According to a previous report, double helix DNA tetrahedrons (diameter = 9.08±0.67 nm) are internalized by breast cancer cells via caveolin-mediated pathway.40 In this study, flowcytometry analysis was employed to investigate cellular uptake pathway of functional DNA tetrahedrons. Treatment of A549 cells with methy-β-cyclodextrin (MβCD, inhibitor of caveolin-mediated endocytosis) greatly reduced the uptake of Cy5-labeled nasTET, while sucrose (inhibitor of clathrin-mediated endocytosis) and 5-(N-Ethyl-N-isopropyl)-Amiloride (EIPA, inhibitor of macropinocytosis) had little effect on nasTET uptake (Figure S8). Since MβCD disrupts caveolin-dependent endocytosis by depleting cholesterol, our result indicated that double bundle DNA tetrahedrons enter A549 cells mainly via caveolin-dependent endocytosis.


7


Page 8 of 24

Figure 3. Cellular uptake and controlled release of functional DNA tetrahedrons. (a) Flowcytometry analysis of A549 cells treated with Cy5-labeled ssDNA (single-strand DNA), TET and nTET (NLS-conjugated tetrahedron) for 6 hours. (b) Confocal microscopy images of A549 cells incubated with Cy5-labeled ssDNA, TET and nTET (red) for 6 hours (scale bars = 40 µm). The nucleus was stained with Hoechst 33342 (blue). (c) 4% native polyacrylamide gel electrophoresis (PAGE) analysis of Alexa 488-labeled antisense (green) released from Cy5-labeled nasTET


8

Page 9 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(red) incubated with 5 mM GSH (glutathione). (d) Confocal microscopy images of A549 cells incubated with nasTETs including Alexa 488-labeled ASO (green) and Cy5-labeled TET (red) for 1 hour or 12 hours, respectively (scale bars = 5 µm). Cellular uptake efficiency was then carefully studied by flowcytometry. Cy5-labeled ssDNA (single-strand DNA, Cy5 linker), TET and nTET (NLS-conjugated tetrahedron) were incubated with A549 cells for 6 hours. As shown in Figure 3a, the mean fluorescent intensity (MFI) of cells treated with nTET was significantly higher than TET treated group, indicating that conjugation of NLS increased the cellular uptake of DNA tetrahedrons. This is partly due to the reduced negative surface charge of nTET. The confocal microscopy images showed the similar result (Figure 3b). NLS is a peptide derived from Simien virus (SV40), the internalization of which is related to the caveolin-mediated pathway.41 Researches have also shown that NLS conjugation facilitated the cellular uptake of nanoparticles towards the nucleus in a highly ordered manner with the help of molecular motors and reduced the possibility to the lysosomes.36, 42 To achieve stimuli responsiveness, ASOs containing disulfide linkages were used for the assembly of asTET and nasTET, which can be cleaved in the reducing environment of cytosol. The tetrahedron was labeled with a Cy5 dye (red) on strand Cy5-linker and the antisense strand was modified with an Alexa 488 dye (green) at its 3’ end. Native PAGE (Figure 3c) was employed to analyze the 5 mM GSH (glutathione) treated samples and imaged under fluorescence channels. At the time of 0 hour, a yellow band (merged with red and green) demonstrated the successful assembly of antisense into the tetrahedron. As time passed, more antisense oligonucleotides (displayed in green) were present at the bottom of the gel, indicating the successful release of therapeutic ASOs from nasTET.


9


Page 10 of 24

Delivery of antisense oligonucleotides to the target mRNAs is one of the major challenges in antisense therapy. Our design aimed to deliver ASOs towards the nucleus to increase the chance to down-regulate its target mRNA in nucleus and cytoplasm. For further investigation of the subcellular location of ASOs loaded DNA tetrahedrons with NLS peptides, we employed confocal fluorescence microscopy to study the subcellular localization of Alexa 488-labeled ASO (green) and Cy5-labeled TET (red) in A549 cells. At the time of 1 hour, merged yellow color was clearly visible in confocal images, which indicated the co-localization of ASOs (green) and tetrahedron structure (red) (Figures 3d and S9a). After 12 hours incubation, ASOs were released from the nasTET, thus the yellow color disappeared and separated into red (nTET) and green (ASOs). Many of the green spots were overlapped with the blue region (nucleus), which indicated that the ASOs were mainly located in the nucleus (Figures 3d, S9a and S9b). Additionally, the overlapped fluorescence signal of nucleus (blue) and ASOs (green) in the Z-scan model was also observed (Figure S9c).

Figure 4. Cell viability and c-raf gene silencing effect in A549 cells. (a) Cell viability of A549 cells treated with TET, asTET, nasTET or ISIS 5132 (transfected with lipofectamine), respectively. (*P < 0.05) (b) Analysis of mRNA level of c-raf gene in A549 cells after treatment with TET, asTET, nasTET or ISIS5132 (transfected with lipofectamine), respectively. (c) Western blot analysis of c-Raf protein expression in A549 cells after treatment with TET, asTET, nasTET


10

Page 11 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


or ISIS5132 (transfected with lipofectamine), respectively. β-actin serves as an internal control for equal protein loading. To further assess the effect of ASO-loaded DNA tetrahedron on cell proliferation, standard MTT (3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyl tetrazolium bromide) assay was performed on A549 cells. A clinical proved antisense drug (ISIS 5132, silencing c-raf gene) was used as control. Studies have shown that silencing of c-raf gene can lead to the inhibition of cell proliferation.43 As shown in Figure 4a, DNA tetrahedron alone did not show obvious cytotoxicity in the indicated dosage, indicating the bio-compatibility of DNA nanostructures. Antisense loaded DNA tetrahedron asTET and nasTET greatly inhibited A549 cell proliferation with the cell viability of 38% and 23% under the administration of 480 nM drugs, respectively. The inhibition effects of nasTET and lipo transfected ISIS 5132 (positive control) were comparative in the higher level of dosage. We also performed cell apoptosis detection through flow cytometry analysis (Figure S10). Obvious cell apoptosis signal was observed both in asTET and nasTET treated groups. DNA tetrahedron partly protected ASOs are more difficult to be degraded than single strand ASOs in cells. Moreover, nasTET increased the chance for ASOs to bind to its target mRNA in nucleus and cytoplasm, as indicated by our cellular uptake experiment. The enhanced cytotoxicity in MTT experiment indicated that functional DNA tetrahedron serves well as the carrier for antisense delivery. Antisense oligonucleotides silence the target gene by hybridizing with corresponding mRNA, resulting in a subsequent decrease in protein expression. To test the gene silencing efficiency of our designed DNA nanocarrier, we examined mRNA levels and subsequent protein expression in A549 cells. As shown in Figures 4b, 4c and S11, the much lower expression level of c-raf mRNA and protein expression (Figure S12) was observed in nasTET treated A549 cells. TET


11


Page 12 of 24

itself had negligible effect on the expression of c-Raf protein in A549 cells, indicating the biocompatibility of DNA nanostructures. The results demonstrated that nasTET was capable of modulating protein expression in a target-specific manner. The ability to specifically trigger both mRNA degradation and protein down-regulation are important steps in establishing DNA nanostructures as potential antisense delivery vehicles.

3. Conclusion In summary, we constructed a double bundle DNA tetrahedron nanostructure loaded with antisense oligonucleotides for efficient target gene knockdown without transfection agents. Our designed functionalized DNA tetrahedron shows several advantages for antisense delivery. Firstly, the NLS conjugated DNA tetrahedron can be efficiently internalized in cells for the following nucleus transportation process. Secondly, the antisense strands can be designed to contain stimuli-responsive disulfide linkage and organized to the inside surface of DNA tetrahedron. Lastly, the antisense strands loaded DNA tetrahedron exhibits effective cell proliferation inhibition at a low concentration. These results represent progress in efforts to deliver antisense oligonucleotides and open up a new avenue for gene therapy. Customized DNA nanostructures can be rationally designed and modified with multiple functional groups, such as active targeting aptamer, various imaging probes and versatile therapeutic elements. Further investigation of multifunctionalized self-assembled DNA nanostructures will greatly facilitate the development of DNA-based drug delivery system.

4. Experimental Section


12

Page 13 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Materials: All chemicals and solvents used were in analytic level. Millipore water was used to prepare all aqueous solutions. All unmodified oligonucleotides used in this study were synthesized and purified by Zixi Biotech Co., Ltd. (Beijing, China). Azide-modified oligonucleotide was purchased from TAKARA Ltd. NLS peptide was purchased from ZiYu Biotech (Shanghai, China). Cooper/TBTA reagent was purchased from Lumiprobe. A549 (non-small cell lung cancer) cell lines was purchased from the National Cell Center for Experimental Cell Resource (Beijing, China). Anti-mouse c-raf antibody was purchased from Santa Cruz. Hoechst 33342 was purchased from Invitrogen. Thiazolyl blue tetrazolium bromide (MTT), sodium dodecyl sulfate (SDS), dimethyl sulfoxide (DMSO) and all other chemical reagents were purchased from SigmaAldrich (USA). DNA sequences: DNA sequences used in this study are as follows: L: 5’-CAGGCACCATCGTAGGTTTCTTGCCAGGCACCATC GTAGGTTTCTTGCCAGGCACCATCGTAGGTTTCTTGC-3’; NLS-linker: N3-5’-CAGAGGCGCTGCAAGCCTACGATGGACACGGTAACGACT-3’; Cy5-linker: 5’-AGCAACCTGCCTGTTAGCGCCTCTGT-3’-Cy5; S: 5’-AGAACTCCTTACCGTGTGGTTGCTAGTCGTT-3’; Antisense: 5’-GGAGTTCT (S-S) TCCCGCCTGTGACATGCATT-3’-Alexa 488; Antisense (mismatch): 5’-GGAGTTCT (S-S) TCACATTGGCGCTTAGCCGT-3’-Alexa 488. Preparation of NLS-DNA conjugates: NLS peptides were coupled to an ssDNA strand using “Click” chemistry. In brief, the azide-modified oligonucleotide (TAKARA Ltd) was diluted with PBS pH 7.4. A 10 µL solution of 200 µM was mixed with NLS peptide containing a propargylglycine residue at its end (200 µM, 20 µL) and DMSO (10 µL). Then Cu2+/TBTA (10 mM, 10 µL), and ascorbic acid (10 mM, 10 µL) were successively added to the mixture. The resulting


13


Page 14 of 24

mixture was incubated at room temperature overnight, and then purified with 10% denatured PAGE. The obtained DNA-NLS conjugates were then store at -20 ºC for further use. Assembly of DNA tetrahedron: The DNA strands (Strand-L, Strand-NLS-linker, Strand-Cy5linker, Strand-S and Strand-antisense) were mixed at a molar ratio of 1:3:3:3:3 in a Tris-acetic acid-EDTA-Mg2+ buffer and the mixture was slowly cooled from 95 °C to 25 °C over 24 hours. The assembled DNA structure is designated as “DNA Tetrahedron” and characterized by 4% non-denatured PAGE and 1% agarose gel at 4 °C. Ladders are 20 bps (Takara). Purification of DNA tetrahedron: After assembly of multi-functional DNA tetrahedrons, the samples were separated by 1% agarose gel. Then, the desired product was collected and further concentrated with 30 kDa Centrifugal Filter Units. Atomic force microscopy (AFM) imaging: 30 µL of DNA sample was deposited onto freshly cleaved mica for 15 min, washed with 3 mL of water and then dried with compressed air. A MultiMode 8 AFM (Bruker) was used to image the samples under ScanAsyst-Air mode, using a SNL-10 probe (Bruker). Dynamic light scattering and zeta-potential analysis: DLS and zeta-potential measurement of DNA tetrahedrons (1 mL, 100 nM) was performed on a Malvern Zetasizer Nano-ZS (Malvern Instruments, UK) at 25 °C. The measurement was repeated at least three times and the results were expressed as the mean ± standard deviation (SD). Cell culture: A549 (non-small cell lung cancer) cell lines were purchased from the National Cell Center for Experimental Cell Resource (Beijing, China). A549 cells were cultured in McCoy’s 5A medium modified with tricine (50 mg/L), supplemented with 10% FBS and 100 IU/mL penicillin-streptomycin. All the cells were cultured in an atmosphere of 5% CO2 at 37 °C.


14

Page 15 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Flow cytometry analysis: For flow cytometry analysis of cellular uptake, the cells were seeded and incubated with drug and drug-loaded carriers (antisense concentration = 120 nM) for 6 h after adhesion. The cells were subsequently washed with PBS and harvested. All the treated cells were analyzed by a BD FACS Calibur flow cytometry system (BD Bioscience). Confocal fluorescence microscopy imaging: The cells were incubated with ssDNA, TET and nTET for indicated times. The incubation concentration of Cy5-labeled ssDNA, TET and nTET was 120 nM based on Cy5-labeled ssDNA. All cellular fluorescent images were collected on fluorescence microscope (Leica, DMI3000) and analyzed by a Leica IMAGE version workstation with a 60× oil immersion objective. Excitation wavelength and emission filters: Cy5, 649 nm laser line excitation, emission BP (580±20) nm filter; Hoechst 33342, 405 nm laser line excitation, emission BP (425±20) nm filter; Alexa 488, 488 nm laser line excitation, emission BP (520±20) nm filter. Cells were incubated at 37 °C with individual nanostructure, followed by washing with PBS (1 mL) twice and suspension in PBS (1 mL) before imaging. Each experiment was analyzed with Olympus software. Cell viability assay: A549 cells were seeded at 5×103 cells per well in a 96-well plate (Corning Brand), pre-incubated for 24 h, then incubated with TET, asTET (antisense concentration = 30, 60, 120, 240, and 480 nM), nasTET, or nasTET (mismatch) for 24 h. A549 cells was incubated with ISIS 5132 with lipofectamine for 6 hours and then replaced with fresh medium for 18 hours. The medium was then replaced with 100 µL of 0.5 mg/mL MTT, and after 3 h, the MTT solution was replaced with 150 µL of DMSO solution. The absorbance at 570 nm of each well was measured by a microplate reader (Infinite M200, Tecan, Durham, USA). The absorbance at 630 nm was also measured as a reference. Untreated cells in medium were used as control. All standard deviations were calculated from five replicates.


15


Page 16 of 24

Cell apoptosis analysis: A549 cells were seeded into a 24-well plate with 3 × 104 per well and treated with TET, asTET (antisense concentration = 480 nM), nasTET or nasTET (mismatch) for 24 hours. A549 cells was incubated with ISIS 5132 with lipofectamine for 6 hours and then replaced with fresh medium for 18 hours. After that, A549 cells were collected and washed with phosphate buffered saline (PBS). Then, the cells are stained with Annexin V-FITC/PI solution (Annexin V-FITC/PI apoptosis detection kit) for 15 min at room temperature away from the light. Cell apoptosis was detected using Flow cytometry (BD Bioscience) and data were analyzed using BD C6 software. RT-PCR: A549 cells were incubated with DNA tetrahedron at the antisense concentration of 480 nM for 24 h. Total RNA was extracted from A549 cell lines using TRIzol (Invitrogen). Reverse transcription was performed according to the manufacture’s instruction (Takara Cat: RR047A). PCR was performed using primers below: β-actin forward: GCGGGAAATCGTGCGTGACATT; β-actin reverse: GATGGAGTTGAAGGTAGTTTCGTG; Raf forward: TCAGACTTCTCCACGAACAC; Raf reverse: AACAGACTCTCGCATACGAT. qRT-PCR: The total RNA was extracted from cells using TRIzol reagent, according to the manufacturer's instructions. Reverse transcription of 1 µg total RNA was performed with the PrimeScript RT reagent kit (Takara) with gDNA Eraser, according to the manufacturer's instructions. Ampliﬁcation of target gene was performed by qPCR using the following conditions: denatura-


16

Page 17 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


tion at 95 °C for 2 min, followed by 40 cycles of 15 s at 95 °C, 15 s at 53 °C and 15 s at 68 °C. Ampliﬁcation of β-actin was used as a control. C-raf gene expression: C-raf gene expression in protein levels was determined by Western blot. A549 cells were incubated with DNA tetrahedron at the antisense concentration of 480 nM for 24 h. β-actin was used as a reference gene. Protein lysates were extracted in high performance RIPA lysis buffer provided by Solarbio (Beijing). Total protein (20 ng) was mixed with SDSloading buffer, boiled at 95 °C, and separated by 10% SDS-PAGE gel. Subsequently, proteins were transferred to a PVDF (0.45 µm) by electroblotting. Then the membrane was blocked with 5% FBS, treated with primary mouse monoclonal c-Raf antibody (Santa-Cruz), and then incubated with goat anti-mouse secondary antibody. After extensive washing, bound antibodies were detected by chemiluminescence using horseradish peroxidase-conjugated species-specific secondary antibodies as described by the manufacturer. Statistical analysis: One-way ANOVA followed by Sidak’s multiple comparison test was used to determine the statistical differences between the groups. *P < 0.05, **P < 0.01 and ***P < 0.001 were considered statistically significant. Statistical analysis was conducted using Prism 6.0 (San Diego, CA, USA).

ASSOCIATED CONTENT Supporting Information. The Supporting Information is available free of charge on the ACS Publications website at DOI:


17


Page 18 of 24

The supporting information contains the structure and sequence of DNA tetrahedron; Denaturing PAGE and SDS-PAGE analysis of click chemistry; Characterization of DNA tetrahedrons; Stability of the nanocarriers and antisense; Endocytic pathway analysis of DNA tetrahedron into A549 cells; Representative additional confocal images of A549 cells; Cell apoptosis analysis of A549 cells; Cell viability and c-raf gene silencing effect in A549 cells treated with nasTET (mismatch); Relative RNA expression (RT-PCR and qRT-PCR) and c-Raf protein expression (western blot) in A549 cells (PDF) AUTHOR INFORMATION Corresponding Author *E-mail: [email protected] (Jianbing Liu) *E-mail: [email protected] (Can Li) *E-mail: [email protected] (Baoquan Ding) Notes The authors declare no competing financial interests. ACKNOWLEDGMENT This work is supported by the National Basic Research Programs of China (2016YFA0201601), the National Natural Science Foundations of China (21573051, 21708004, 31700871), the Science Fund for Creative Research Groups of the National Natural Science Foundation of China (21721002,

81421061),

Beijing

Municipal

Science

&

Technology

Commission

(Z161100000116036), Key Research Program of Frontier Sciences, CAS, Grant QYZDB-SSWSLH029, K. C. Wong Education Foundation and CAS Interdisciplinary Innovation Team. The project of biomedical engineering research foundation of Shanghai Jiao Tong University.YG2016MS20.


18

Page 19 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


REFERENCES (1)

Seeman, N. C., DNA in a Material World. Nature 2003, 421, 427-431.

(2)

Pinheiro, A. V.; Han, D.; Shih, W. M.; Yan, H., Challenges and Opportunities for Struc-

tural DNA Nanotechnology. Nat. Nanotechnol. 2011, 6, 763-772. (3)

Bhatia, D.; Surana, S.; Chakraborty, S.; Koushika, S. P.; Krishnan, Y., A Synthetic Ico-

sahedral DNA-Based Host-Cargo Complex for Functional in vivo Imaging. Nat. Commun. 2011, 2, 339. (4)

Lee, H.; Lytton-Jean, A. K.; Chen, Y.; Love, K. T.; Park, A. I.; Karagiannis, E. D.;

Sehgal, A.; Querbes, W.; Zurenko, C. S.; Jayaraman, M.; Peng, C. G.; Charisse, K.; Borodovsky, A.; Manoharan, M.; Donahoe, J. S.; Truelove, J.; Nahrendorf, M.; Langer, R.; Anderson, D. G., Molecularly Self-Assembled Nucleic Acid Nanoparticles for Targeted in vivo SiRNA Delivery. Nat. Nanotechnol. 2012, 7, 389-393. (5)

Kim, K.-R.; Lee, Y.-D.; Lee, T.; Kim, B.-S.; Kim, S.; Ahn, D.-R., Sentinel Lymph Node

Imaging by a Fluorescently Labeled DNA Tetrahedron. Biomaterials 2013, 34, 5226-5235. (6)

Liu, X.; Xu, Y.; Yu, T.; Clifford, C.; Liu, Y.; Yan, H.; Chang, Y., A DNA Nanostructure

Platform for Directed Assembly of Synthetic Vaccines. Nano Lett. 2012, 12, 4254-4259. (7)

Li, J.; Pei, H.; Zhu, B.; Liang, L.; Wei, M.; He, Y.; Chen, N.; Li, D.; Huang, Q.; Fan, C.,

Self-Assembled Multivalent DNA Nanostructures for Noninvasive Intracellular Delivery of Immunostimulatory CpG Oligonucleotides. ACS Nano 2011, 5, 8783-8789. (8)

Chen, Y.-J.; Groves, B.; Muscat, R. A.; Seelig, G., DNA Nanotechnology from the Test

Tube to the Cell. Nat. Nanotechnol. 2015, 10, 748-760.


19


(9)

Page 20 of 24

Zhang, C.-Y.; Yeh, H.-C.; Kuroki, M. T.; Wang, T.-H., Single-Quantum-Dot-Based

DNA Nanosensor. Nat. Mater. 2005, 4, 826-831. (10) Keum, J. W.; Ahn, J. H.; Bermudez, H., Design, Assembly, and Activity of Antisense DNA Nanostructures. Small 2011, 7, 3529-3535. (11) Jiang, Q.; Song, C.; Nangreave, J.; Liu, X.; Lin, L.; Qiu, D.; Wang, Z.-G.; Zou, G.; Liang, X.; Yan, H.; Ding, B., DNA Origami as a Carrier for Circumvention of Drug Resistance. J. Am. Chem. Soc. 2012, 134, 13396-13403. (12) Ma, W.; Shao, X.; Zhao, D.; Li, Q.; Liu, M.; Zhou, T.; Xie, X.; Mao, C.; Zhang, Y.; Lin, Y., Self-Assembled Tetrahedral DNA Nanostructures Promote Neural Stem Cell Proliferation and Neuronal Differentiation. ACS Appl. Mater. Inter. 2018, 10, 7892-7900. (13) Xie, X.; Shao, X.; Ma, W.; Zhao, D.; Shi, S.; Li, Q.; Lin, Y., Overcoming Drug-Resistant Lung Cancer by Paclitaxel Loaded Tetrahedral DNA Nanostructures. Nanoscale 2018, 10, 54575465. (14) Shi, S.; Lin, S.; Li, Y.; Zhang, T.; Shao, X.; Tian, T.; Zhou, T.; Li, Q.; Lin, Y., Effects of Tetrahedral DNA Nanostructures on Autophagy in Chondrocytes. Chem. Commun. 2018, 54, 1327-1330. (15) Ming, X.; Laing, B., Bioconjugates for Targeted Delivery of Therapeutic Oligonucleotides. Adv. Drug Delivery Rev. 2015, 87, 81-89. (16) Wagner, R. W., Gene Inhibition Using Antisense Oligodeoxynucleotides. Nature 1994, 372, 333-335. (17) Stein, C.; Cheng, Y., Antisense Oligonucleotides as Therapeutic Agents--is the Bullet Really Magical? Science 1993, 261, 1004-1012.


20

Page 21 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(18) Tamm, I.; Dörken, B.; Hartmann, G., Antisense Therapy in Oncology: New Hope for an Old Idea? Lancet 2001, 358, 489-497. (19) Yoo, B. H.; Bochkareva, E.; Bochkarev, A.; Mou, T. C.; Gray, D. M., 2’-O-methylModified Phosphorothioate Antisense Oligonucleotides have Reduced Non-Specific Effects in vitro. Nucleic Acids Res. 2004, 32, 2008-2016. (20) Opalinska, J. B.; Gewirtz, A. M., Nucleic-Acid Therapeutics: Basic Principles and Recent Applications. Nat. Rev. Drug Discov. 2002, 1, 503-514. (21) Wang, Y.; Miao, L.; Satterlee, A.; Huang, L., Delivery of Oligonucleotides with Lipid Nanoparticles. Adv. Drug Del. Rev. 2015, 87, 68-80. (22) Kakizawa, Y.; Kataoka, K., Block Copolymer Micelles for Delivery of Gene and Related Compounds. Adv. Drug Del. Rev. 2002, 54, 203-222. (23) Juliano, R.; Alam, M. R.; Dixit, V.; Kang, H., Mechanisms and Strategies for Effective Delivery of Antisense and SiRNA Oligonucleotides. Nucleic Acids Res. 2008, 36, 4158-4171. (24) Ding, H.; Inoue, S.; Ljubimov, A. V.; Patil, R.; Portilla-Arias, J.; Hu, J.; Konda, B.; Wawrowsky, K. A.; Fujita, M.; Karabalin, N.; Sasaki, T.; Black, K. L.; Holler, E.; Ljubimova, J. Y., Inhibition of Brain Tumor Growth by Intravenous Poly(β-l-malic acid) Nanobioconjugate with pH-Dependent Drug Release. Proc. Natl. Acad. Sci. USA 2010, 107, 18143-18148. (25) Giljohann, D. A.; Seferos, D. S.; Daniel, W. L.; Massich, M. D.; Patel, P. C.; Mirkin, C. A., Gold Nanoparticles for Biology and Medicine. Angew. Chem., Int. Ed. 2010, 49, 3280-3294. (26) Li, J.; Zheng, C.; Cansiz, S.; Wu, C.; Xu, J.; Cui, C.; Liu, Y.; Hou, W.; Wang, Y.; Zhang, L.; Teng, I. t.; Yang, H.-H.; Tan, W., Self-assembly of DNA Nanohydrogels with Controllable Size and Stimuli-Responsive Property for Targeted Gene Regulation Therapy. J. Am. Chem. Soc. 2015, 137, 1412-1415.


21


Page 22 of 24

(27) Chandrasekaran, A. R.; Levchenko, O., DNA Nanocages. Chem. Mater. 2016, 28, 55695581. (28) Lapenta, F.; Aupic, J.; Strmsek, Z.; Jerala, R., Coiled Coil Protein Origami: from Modular Design Principles towards Biotechnological Applications. Chem. Soc. Rev. 2018, 47, 35303542. (29) Kim, K. R.; Kim, H. Y.; Lee, Y. D.; Ha, J. S.; Kang, J. H.; Jeong, H.; Bang, D.; Ko, Y. T.; Kim, S.; Lee, H.; Ahn, D. R., Self-assembled Mirror DNA Nanostructures for Tumor-specific Delivery of Anticancer Drugs. J. Control. Release 2016, 243, 121-131. (30) Xia, Z.; Wang, P.; Liu, X.; Liu, T.; Yan, Y.; Yan, J.; Zhong, J.; Sun, G.; He, D., TumorPenetrating Peptide-Modified DNA Tetrahedron for Targeting Drug Delivery. Biochemistry 2016, 55, 1326-1331. (31) Walsh, A. S.; Yin, H.; Erben, C. M.; Wood, M. J.; Turberfield, A. J., DNA Cage Delivery to Mammalian Cells. ACS Nano 2011, 5, 5427-5432. (32) Kim, K. R.; Hwang, D.; Kim, J.; Lee, C. Y.; Lee, W.; Yoon, D. S.; Shin, D.; Min, S. J.; Kwon, I. C.; Chung, H. S.; Ahn, D. R., Streptavidin-Mirror DNA Tetrahedron Hybrid as a Platform for Intracellular and Tumor Delivery of Enzymes. J. Control. Release 2018, 280, 1-10. (33) Zhang, Y.; Shuai, Z.; Zhou, H.; Luo, Z.; Liu, B.; Zhang, Y.; Zhang, L.; Chen, S.; Chao, J.; Weng, L.; Fan, Q.; Fan, C.; Huang, W.; Wang, L., Single-Molecule Analysis of MicroRNA and Logic Operations Using a Smart Plasmonic Nanobiosensor. J. Am. Chem. Soc. 2018, 140, 3988-3993. (34) Li, H.; Zhang, K.; Pi, F.; Guo, S.; Shlyakhtenko, L.; Chiu, W.; Shu, D.; Guo, P., Controllable Self-Assembly of RNA Tetrahedrons with Precise Shape and Size for Cancer Targeting. Adv. Mater. 2016, 28, 7501-7507.


22

Page 23 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(35) He, Y.; Ye, T.; Su, M.; Zhang, C.; Ribbe, A. E.; Jiang, W.; Mao, C., Hierarchical SelfAssembly of DNA into Symmetric Supramolecular Polyhedra. Nature 2008, 452, 198-201. (36) Liang, L.; Li, J.; Li, Q.; Huang, Q.; Shi, J.; Yan, H.; Fan, C., Single-Particle Tracking and Modulation of Cell Entry Pathways of a Tetrahedral DNA Nanostructure in Live Cells. Angew. Chem., Int. Ed. 2014, 53, 7745-7750. (37) Li, Y.; Liu, Z.; Yu, G.; Jiang, W.; Mao, C., Self-Assembly of Molecule-Like Nanoparticle Clusters Directed by DNA Nanocages. J. Am. Chem. Soc. 2015, 137, 4320-4323. (38) Zhang, C.; Su, M.; He, Y.; Leng, Y.; Ribbe, A. E.; Wang, G.; Jiang, W.; Mao, C., Exterior Modification of a DNA Tetrahedron. Chem. Commun. 2010, 46, 6792-6794. (39) Brandenburg, B.; Zhuang, X., Virus Trafficking - Learning from Single-Virus Tracking. Nat. Rev. Micro. 2007, 5, 197-208. (40) Kim, K.-R.; Kim, D.-R.; Lee, T.; Yhee, J. Y.; Kim, B.-S.; Kwon, I. C.; Ahn, D.-R., Drug Delivery by a Self-Assembled DNA Tetrahedron for Overcoming Drug Resistance in Breast Cancer Cells. Chem. Commun. 2013, 49, 2010-2012. (41) Tammam, S. N.; Azzazy, H. M. E.; Lamprecht, A., How Successful is Nuclear Targeting by Nanocarriers? J. Control. Release 2016, 229, 140-153. (42) Maity, A. R.; Stepensky, D., Efficient Subcellular Targeting to the Cell Nucleus of Quantum Dots Densely Decorated with a Nuclear Localization Sequence Peptide. ACS Appl. Mater. Inter. 2016, 8, 2001-2009. (43) Wang, H.-G.; Rapp, U. R.; Reed, J. C., Bcl-2 Targets the Protein Kinase Raf-1 to Mitochondria. Cell 1996, 87, 629-638.


23


Page 24 of 24

Table of Contents graphic


24

Self-Assembled Double-Bundle DNA Tetrahedron ... - ACS Publications

Recommend Documents