Self-Assembling Chimeric Protein for the ... - ACS Publications

The poor survival of neural stem/progenitor cells following transplantation into the brain is the major problem limiting the effect of cell-based ther...
0 downloads 0 Views 3MB Size
Download PDF
Biomacromolecules 2008, 9, 1411–1416

1411

Self-Assembling Chimeric Protein for the Construction of Biodegradable Hydrogels Capable of Interaction with Integrins Expressed on Neural Stem/Progenitor Cells Tadashi Nakaji-Hirabayashi, Koichi Kato, and Hiroo Iwata* Institute for Frontier Medical Sciences, Kyoto University, 53 Kawahara-cho, Shogoin, Sakyo-ku, Kyoto 606-8507, Japan Received December 27, 2007; Revised Manuscript Received February 12, 2008

The poor survival of neural stem/progenitor cells following transplantation into the brain is the major problem limiting the effect of cell-based therapy for Parkinson’s disease. To overcome this problem, we are involved in designing keratin-based hydrogels that serve as physical barriers to prevent the infiltration of inflammatory cells. Another feature of the hydrogels is to contain a polypeptide that promotes integrin-mediated cell adhesion. To construct such hydrogels, a chimeric protein consisting of an R-helical polypeptide and a globular domain derived from laminin was synthesized by means of recombinant DNA technology and coassembled with extracted keratins that form hydrogels through intermolecular coiled-coil association of R-helical segments. It was found that neurosphere-forming cells specifically adhered to the keratin-based composite hydrogel and actively proliferated at a high survival rate. These results suggested that the composite hydrogel provides microenvironments suitable for the survival and proliferation of neural progenitor cells.

Introduction Stem cell-based therapy has received much attention due to its potential as a therapeutic strategy for neurodegenerative disorders, especially for Parkinson’s disease. In particular, dopamine neurons or their precursors derived from tissue or embryonic stem cells have been transplanted into the striatum of Parkinson’s disease model animals with promising outcomes.1 However, the low level of cell survival and thus poor engraftment following transplantation are the matter of utmost concern with current treatments.2,3 It is considered that cell death after transplantation is attributed in part to anoikis-induced apoptosis caused by the destruction of cell-substrate and cell-cell interactions upon cell preparation.4 Other factors include acute inflammatory responses associated with infiltration of activated microglia.5 To address these adverse effects, Marchionini et al.6 studied the implications of extracellular matrix molecule tenascin-C and cell adhesion molecule L1 in the survival of embryonic mesencephalic dopamine neurons. Diffusible factors such as brain-derived neurotrophic factor7 and caspase inhibitors8 were examined for their potential to protect transplanted cells. These studies, however, could not significantly improve cell survival after transplantation. Our approach to overcome this problem is to encapsulate cells in biodegradable hydrogels that act as temporal barriers against infiltrating inflammatory cells and, at the same time, provide substrate for integrin-mediated cell adhesion. To meet these requirements, the present study is directed to designing the protein-based building block that can be integrated into regenerated keratin hydrogels, automatically presenting a cell adhesive polypeptide within a hydrogel microenvironment. Keratins are family members of intermediate filament-forming proteins and identified as type I and II homology groups.9 It is known that type II keratin, such as keratin-14, associates with * To whom correspondence should be addressed. E-mail: iwata@ frontier.kyoto-u.ac.jp. Telephone/Fax: +81-75-751-4119.

Scheme 1. Schematic Diagram Showing the Self-Assembly of Keratins in the Presence of LG3K14

type I keratin to form heterodimers. The dimerization is through the formation of coiled-coil structure due to an internal R-helical rod domain10 (Scheme 1). Keratin heterodimers further assemble to form nanofilaments (∼10 nm in diameter) by lateral association. These processes can also be initiated in vitro and have been utilized to prepare keratin-based hydrogels.11 In this study, a protein-based building block was designed to contain a long R-helical polypeptide, keratin-14 (K14), so as to integrate the protein into regenerated keratin hydrogels through intermolecular coiled-coil association.12 Furthermore, the K14 was fused with a globular domain 3 of laminin R3 chain (LG3) because the domain is known to interact with several forms of integrins.13 To examine the feasibility of our strategy, the chimeric protein composed of LG3 and K14 (LG3K14) and the LG3-deficient control protein (K14) were synthesized by means of recombinant

10.1021/bm701423d CCC: $40.75  2008 American Chemical Society Published on Web 04/23/2008

1412

Biomacromolecules, Vol. 9, No. 5, 2008

DNA technology and incorporated into regenerated keratin hydrogels. The adhesion and immortality of neurosphereforming cells were examined in vitro on the keratin-based hydrogels incorporating LG3K14 or K14. The neurosphereforming cells obtained from the rat embryonic brain are a heterogeneous population that contains neural stem cells to a large fraction. We will show that the neural stem cells specifically adhered to and grown on the LG3K14-incorporated keratin hydrogel at a sufficiently high survival rate.

Experimental Section Expression Constructs. Complementary DNAs (cDNAs) encoding the LG3 domain (642 bp) and K14 (1413 bp) were generated by polymerase chain reaction (PCR) using a human skin cDNA library as a template. The PCR primers were designed to introduce a NdeI restriction site at the 5′ end (forward primers: LG3, ggtacatatgtgctcggaagactggaagcttg; K14, cgtgaaggtgtggcaagatgctccaggccctactacctgcagccgccagttcac) and a XhoI restriction site at the 3′ end (reverse primers: LG3, gtgaactggcggctgcaggtagtagggcctggagcatcttgccacaccttcacg; K14, ggtgctcgaggttcttggtgcgaaggacctgc). For subsequent overlap extension, the reverse primer for LG3 and the forward primer for K14 contained additional 20-mer sequences that overlap each other (LG3 was fused to the N-terminal of K14). PCR was carried out under the following cycling conditions: for LG3, 35 cycles, denaturation at 94 °C for 30 s, annealing at 57 °C for 30 s, extension at 72 °C for 45 s, and for K14, 35 cycles, denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, extension at 72 °C for 90 s. The overlapping fragments thus obtained were denatured, annealed to generate heteroduplexes, and extended to obtain full-length chimeric DNA. For the fill-in reaction, the following thermal cycling conditions were employed: 7 cycles, denaturation at 94 °C for 1 min, and annealing and extension at 63 °C for 4 min. Then, the products from the fill-in reaction were used to amplify chimeric DNA by priming with outer primers (forward: ggtacatatgtgctcggaagactggaagcttg; reverse: ggtgctcgaggttcttggtgcgaaggacctgc) under the following cycling conditions: 35 cycles, denaturation at 94 °C for 30 s, annealing at 57 °C for 30 s, extension at 72 °C for 2 min. The amplified DNA was digested with NdeI and XhoI and then unidirectionally ligated to pET-22b(+) (Novagen) previously linearized by the same restriction enzymes. The plasmid was cloned in Escherichia coli (E. coli) strain DH5R to obtain the expression construct (pET22-LG3K14). The correctness of the insert was verified by sequencing. To prepare plasmid DNA for the control protein lacking the LG3 domain (pET22-K14), K14 cDNA was generated by PCR using the following primer sets: forward, ggccggatccactacctgcagccgccagttc, and reverse, ggtgctcgaggttcttggtgcgaaggacctg. The amplified DNA was inserted to the BamHIXhoI site of pET22b(+) to obtain pET22-K14. Protein Expression. E. coli strain BL21-CodonPlus (Stratagene) was transformed with pET22-LG3K14 and pET22-K14 and grown using Overnight Express autoinduction system (Novagen). LG3K14 and K14 expressed as inclusion bodies were extracted with 20 mM phosphate buffer containing 8 M urea and 10 mM 2-mercaptoethanol, and purified by Ni-chelate chromatography using a Prime AKTA system (Amersham) equipped with a His Trap HP column (Amersham). The purity and the molecular size of the proteins were analyzed by sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Reconstructed Keratin. According to the method by Fujii et al.,9,14 hard R-keratin was extracted from human hairs and reconstructed to obtain hydrogel. In brief, human hairs were washed with ethanol to remove impurities and soaked in 25 mM Tris-HCl buffer (pH 8.5) containing 2.6 M thiourea, 5 M urea, and 5% 2-mercaptoethanol at 60 °C for 5 h to extract keratins. After filtration, the liquid phase was centrifuged at 13000g for 10 min to remove possible aggregates. The yellowish solution containing hard R-keratin thus obtained (6.0 mg/ mL) was mixed with LG3K14 or K14 solution (1.2 mg/mL) at a volume ratio of 2:1. The mixed solution (150 µL) was cast into 30 mM MgCl2 solution (5 mL) in a 35 mm tissue culture dish at room temperature to

Nakaji-Hirabayashi et al. allow the formation of a reconstructed keratin hydrogel at the bottom of the dish. After 3 h, the hydrogel was extensively washed with distilled water. To refold the LG3 domain, the hydrogel was soaked in 50 mM Tris-HCl buffer (pH 8.5) containing 4 M urea, 0.375 mM oxidized glutathione, and 3.75 mM reduced glutathione at 4 °C for 12 h, and then in 50 mM Tris-HCl buffer (pH 8.0) for 3 h. Finally, the buffer solution was replaced with phosphate buffered saline (PBS) of pH 7.4. Characterization of Reconstructed Keratin. To examine the incorporation of LG3K14, reconstructed keratin hydrogels were prepared at various compositions. To remove unincorporated proteins, the hydrogels were extensively washed with distilled water for 2 days. The hydrogels were then added to Laemmli SDS-PAGE sample buffer containing 10% (v/v) 2-mercaptoethanol and heated at 95 °C for 20 min. By this procedure, physically cross-linked hydrogels were dissolved. Then the solutions were analyzed by SDS-PAGE using 12.5% polyacrylamide gel. The relative intensities of protein bands were determined using Scion Image software (Scion Corporation, MD). As a control, a hydrogel was prepared from keratin solution in the presence of bovine serum albumin (BSA) and analyzed by SDS-PAGE as just described. Cell Isolation and Culture. The striatum was isolated from fetus (E16) of Fischer 344 rats.15 All animal experiments were conducted according to the guidelines of the Animal Welfare Committee of the institute. The tissue was dissociated into single cells by treating with 0.05% trypsin solution containing 0.53 mM ethylenediamine-N,N,N′,N′tetraacetic acid (EDTA). Single cells obtained were suspended in DMEM/F12 (1:1) (Gibco) containing 2% B27 supplement (Gibco), 5 µg/mL heparin, 100 U/mL penicillin, and 100 µg/mL streptomycin (base medium), supplemented with 20 ng/mL basic fibroblast growth factor (bFGF; Invitrogen) and 20 ng/mL epidermal growth factor (EGF; Invitrogen), and cultured at 37 °C under 95% air and 5% CO2 for 4–5 days to form neurospheres containing nestin-expressing undifferentiated cells (50–60% of total cells).15 Neurospheres at passage 2 were dissociated into single cells by treating with 0.05% trypsin-EDTA solution. These neurosphereforming cells were suspended in base medium and then seeded onto the keratin-based hydrogel at a density of 30000 cells/cm2. Cells were cultured on the surface of hydrogels because we could microscopically observe cells much easier on 2D surfaces than in 3D hydrogels. The cells were cultured on the hydrogels at 37 °C under 95% air and 5% CO2 for 6 h and washed gently with DMEM/F12 (1:1) to remove weakly adhering cells. To evaluate cell adhesion, cells were stained with Hoechst 33258 (Dojindo, Kumamoto, Japan) and observed with an epifluorescent microscope (DP70, Olympus). To examine the growth activity, the cells were cultured for an additional 10 days in base medium containing 20 ng/mL bFGF and 20 ng/mL EGF. Cell Viability. The live/dead assay16 was performed using 3′,6′-di(O-acetyl)-4′,5′-bis[N,N-bis(carboxymethyl)aminomethyl]fluorescein, tetraacetoxymethyl ester (calcein-AM; Dojindo), and propidium iodide (PI; Millipore). These chemicals were dissolved to a concentration of each 1 µg/mL in PBS containing 0.05 mM MgCl2 and 0.9 mM CaCl2. Cells cultured on hydrogels for 1 day were exposed to the calcein-AM/PI solution for 20 min and then washed with PBS containing 0.05 mM MgCl2 and 0.9 mM CaCl2. The assay was also performed for cells unattached to the hydrogels by exposing the cells to calcein-AM/PI solution for 20 min in suspension. In the live/dead assay, calcein-AM penetrates into the cytosol of living cells and fluorescently stains them in green, while PI fluorescently stains the nucleus of dead cells in red. The microphotographs of cells stained in green and red were recorded using the epifluorescent microscope. The numbers of green (alive) and red (dead) cells were determined for 10 different sites on one sample. Cell viability was determined as percent living cells to the total cells and presented as the mean ( standard deviation for five independent samples. Immunocytochemistry. Cells on hydrogels were fixed with PBS containing 4% paraformaldehyde and 0.1% glutaraldehyde, and permeabilized by treating with 0.5% TritonX-100 solution at room

Chimeric Protein for the Construction of Hydrogels

Biomacromolecules, Vol. 9, No. 5, 2008

1413

Figure 1. Result of SDS-PAGE analysis for synthesized proteins and extracted keratins. Lane 1: LG3K14; lane 2: K14; lane 3: human hair keratins. M: Molecular weight standard was electrophoresed in two lanes at the both sides.

Figure 2. Photographs of disk-shaped hydrogels (diameter: ∼2 cm, thickness: ∼1 mm) formed from regenerated keratins in (A) the presence (400 µg/mL) and (B) absence of LG3K14.

temperature for 20 min. Then, the cells were treated with 2% skim milk solution for 2 h to block nonspecific adsorption of antibodies, followed by binding of primary antibodies against nestin (1:200, mouse monoclonal Rat 401, BD Pharmingen) and class III β-tubulin (βIII; 1:600, rabbit polyclonal, Covance, Princeton, NJ) for 1 h at room temperature. After washing with PBS containing 0.05% Tween 20, cells were treated with a solution containing Alexa Fluor 594 antimouse IgG and Alexa Fluor 488 antirabbit IgG (both from Molecular Probes) at a dilution of 1:500 for 1 h at room temperature and washed with PBS containing 0.05% Tween 20. Then, cell nuclei were counterstained with Hoechst 33258. The localization of secondary antibodies was analyzed with the epifluorescent microscope.

Results Chimeric Proteins and Keratins. The chimeric protein, LG3K14, and the LG3-deficient control protein, K14, were expressed in E. coli and purified by metal chelate chromatography. These proteins were analyzed by SDS-PAGE. As shown in Figure 1, LG3K14 (lane 1) and K14 (lane 2) were separated as a single band. The molecular weight of LG3K14 and K14 was estimated to be 77 and 65 kDa, respectively, being in accordance with the molecular weight predicted from their primary structure. The result of SDS-PAGE analysis is also shown for extracted human hair keratins (Figure 1, lane 3). Two protein bands visualized in lane 3 are assigned to human type I (40–50 kDa) and type II (55–65 kDa) keratins.9 Formation of Keratin-Based Hydrogel. As shown in Figure 2, when cast into MgCl2 solution, extracted keratins coagulated to form opaque hydrogels. Similar results were obtained for the mixture of keratins with LG3K14 or K14. All these hydrogels were fragile but self-supporting in the hydrated state.

Figure 3. Incorporation of LG3K14 and K14 into reconstructed keratin hydrogels. (A) Result of SDS-PAGE analysis for various keratin hydrogels. Hydrogels were extensively washed with distilled water for 2 days and then subjected to SDS-PAGE. Lane 1: hydrogel prepared from keratin alone; lane 2: keratin with K14; lane 3: keratin with LG3K14; lane 4: keratin with BSA. (B) The intensity of protein bands in (A) plotted as a function of the feed concentration of (O) LG3K14, (0) BSA, and (4) type II keratin. Band intensities were normalized with those of type I keratin visualized in the respective lane.

The reconstructed keratin hydrogels were again dissolved and subjected to SDS-PAGE analysis (Figure 3A). Two protein bands seen in lane 1 (reconstructed from pure keratin) are assigned to type I and II keratins. In lanes 2 and 3, additional protein bands are visualized at positions corresponding to the molecular weight higher than those of keratins. It is apparent that these higher molecular weight bands are assigned to K14 (lane 2) and LG3K14 (lane 3). In lane 4, only two keratin bands are focused, but no bands are seen for BSA (66 kDa) cast together with keratins. As shown in Figure 3B, LG3K14 was incorporated into hydrogels in a concentration dependent manner, with a gradual decrease in the fraction of type II keratins. On the other hand, a negligible amount of BSA was contained in reconstructed keratins. These results suggest that LG3K14 and K14 are selectively incorporated into reconstructed keratin hydrogels and that the incorporation involves the interaction of self-assembling keratins with the K14 domain in both chimeric and control proteins. Cell Adhesion to Hydrogels. It was observed that neurosphere-forming cells settled on the surface of keratin-based hydrogels. These cells, however, could not be suitably focused by phase-contrast imaging due to the rough surface of hydrogels. Therefore, after washing out unattached cells, the nucleus of adhering cells were stained with the Hoechst dye and imaged

1414

Biomacromolecules, Vol. 9, No. 5, 2008

Figure 4. Adhesion of neurosphere-forming cells on the keratin hydrogels with or without incorporated chimeric proteins. (A-C) Fluorescent images of cells cultured on the keratin hydrogels for 6 h and stained with Hoechst dye. (A) Keratin, (B) keratin with K14, and (C) keratin with LG3K14. Cell seeding density: 3 × 104 cells/cm2. Scale bar: 100 µm. (D) Number of cells adhered to the keratin hydrogels. *Statistically significant with p < 0.01 (Student’s t test).

by the fluorescent microscope. Parts A-C of Figure 4 show the images of cells cultured for 6 h on keratin-based hydrogels with or without incorporated chimeric proteins. As can be seen, the density of adhering cells is varied depending on the type of hydrogels. The quantitative data are shown in Figure 4D. The density of adhering cells is 3-fold higher on the keratin hydrogel incorporating LG3K14 than both on the pure keratin hydrogel and on the hydrogel with K14. The live/dead assays were performed for cells adhering to the keratin-based hydrogels. The fraction of living cells was determined to be 90 ( 2.4% on pure keratin, 94 ( 4.8% on keratin/K14, and 93 ( 1.9% on keratin/LG3K14 with no significant difference between hydrogels. These results imply that the total number of living cells was 3-fold larger on the keratin-LG3K14 than the pure keratin and keratin/K14 hydrogels. The live/dead assays further revealed that approximately half of the unattached cells were PI-stained dead cells, regardless of the type of hydrogels. This finding suggests the importance of adhesion signaling for the survival of neurosphere-forming cells. In Figure 5, the results of immunofluorescent staining of nestin and βIII are shown for cells attached to the keratin-based hydrogels. Nestin is known to be expressed in neural stem cells,17 while βIII is a marker for neuronal differentiation.18 It is seen that most of the cells are positive for nestin on three types of hydrogels. However, the number of total cells is again much larger on the keratin-LG3K14 hydrogel than on the pure keratin and keratin-K14 hydrogels. On keratin-LG3K14, we frequently observed cells with extended shapes, while most of cells exhibited round shapes on the other hydrogels. These results suggest that the LG3 domain plays a critical role in cell adhesion. Cells adhering to the keratin hydrogels were cultivated additionally for 10 days in the presence of bFGF and EGF and then immunocytochemically stained. As shown in parts A and C of Figure 6, nestin-expressing cells considerably proliferated on keratin-LG3K14 hydrogel, extending dendrites in three dimension and occasionally forming neurosphere-like colonies. This is marked contrast to the pure keratin hydrogel (Figure 6B,D) on which significantly less number of cells are proliferated.

Nakaji-Hirabayashi et al.

Figure 5. Fluorescent images of cells cultured for 6 h on the keratin hydrogels made of (A,D) pure keratin, (B,E) keratin with K14, and (C,F) keratin with LG3K14. Cells were (A,B,C) immunocytochemically stained using primary antibodies against nestin (red) and βIII (green) and (D,E,F) counterstained with Hoechst dye (blue). Scale bar: 200 µm.

Figure 6. Fluorescent images of cells cultured for 10 days on the hydrogels made of (A,C) keratin with LG3K14 and (B,D) pure keratin. Cells were (A,B) immunocytochemically stained using primary antibodies against nestin (red) and βIII (green) and (C,D) counterstained with Hoechst dye (blue). Scale bar: 100 µm.

Discussion This study demonstrates that the chimeric protein, LG3K14, is integrated into reconstructed keratins, forming a composite hydrogel on which neurosphere-forming cells adhere and proliferate. As we expected, the building block engineered by recombinant DNA technology facilitates the creation of celladhesive hydrogels composed of self-assembled keratins. Such bottom-up strategy will provide novel class of biomaterials capable of regulating neural cell functions at molecular and cellular levels. In particular, the keratin-LG3K14 hydrogel is expected to provide a substrate for integrin-mediated cell adhesion and physical impediments against inflammatory cells, leading to the improved survival of neural progenitor cells following transplantation into the brain for the treatment of Parkinson’s disease. Our results show that keratins extracted here are able to form hydrogel, most likely through the intermolecular association of

Chimeric Protein for the Construction of Hydrogels

R-helical segments. Importantly the presence of LG3K14 gives rise to the formation of composite hydrogel. This result indicates that the globular LG3 domain fused to the N-terminal of K14 does not totally hinder the R-helical segments for coiled-coil interactions. This result is not striking because fusion proteins consisting of keratin and green fluorescent protein expressed in mammalian cells were reported to organize normal cytokeratin networks.19 Accordingly, keratin-LG3K14 composite hydrogels are expected to display the LG3 domain on the surface of keratin nanofilaments (Scheme 1). Because the K14 is a C-terminal fusion, LG3K14 is anchored to the basement keratin exposing the LG3 domain toward cells. It was reported that the LG3 domain derived from laminin R3 chain (component of laminin-5) interacts with integrins13,20 such as R3β1, R6β1, and R6β4. On the other hand, an integrin subunit β1 is expressed on rat neural stem/progenitor cells21 as a variety of heterodimers22 such as R6Aβ1 and R6Bβ1. From these previous studies, we assume that integrins are involved in the adhesion of neurosphere-forming cells to the keratinLG3K14 hydrogels. As we observed in the live/dead assays, the total number of living cells is highest on the keratin-LG3K14 hydrogel among the hydrogels studied. Moreover, almost half of the unattached cells had died during 1-day culture. From these findings, it appears that adhesion signaling based on integrin-LG3 interactions serve to protect cells from anoikis-induced cell death. For understanding integrin-LG3 interactions in more detail, we need further mechanistic studies using blocking antibodies or agonistic peptides that specifically inhibit integrinmediated cell adhesion. Previous studies showed that the form of hydrogel provides a physical barrier against invading inflammatory cells in the central nervous system.23 Although our composite hydrogel has poor elastic property, we speculate that the mechanical strength is at a level compliant to the strength of brain tissues (100–200 Pa).24 In addition, the gravimetric sedimentation of cells through the hydrogel was not observed in cell culture experiments. From this observation, we expect that the hydrogel serves as physical barriers against the dislocation of transplanted cells and the infiltration of inflammatory cells. This property may be attributed to the small mesh size of nanofilament networks and also the intrinsic mechanical properties of intermediate filaments. In fact, living cells are reinforced by cytoskeletal networks made of intermediate filaments with a stiffness of ∼2 GPa.25 Alternatively, reconstructed keratins may be toughened by adding appropriate agents such as glycerol.26 Besides the barrier effect, we also need to consider the diffusional properties for nutrients, wastes, and chemical messengers, most of which are low molecular weight substrates, through the hydrogel system, when cells are encapsulated in the hydrogels for transplantation. Our present system for hydrogel preparation requires strong denaturants such as urea and thiourea to dissolve keratins. This would not be compatible to the cell transplantation if cells are suspended in sol prior to gel formation. The requirement of denaturants is primarily due to the fact that hair keratins are highly cross-linked by intermolecular disulfide bonds. Other intermediate filament proteins such as vimentin and desmin or de novo designed R-helical polypeptides may provide more compatible strategies. It was reported that regenerated keratins could be degraded in vitro by various proteases.9 However, it is not clear at present whether the in vivo degradation kinetics of our keratin-based materials meet requirements for the permanent treatment of neural degenerative diseases. Recombinant DNA

Biomacromolecules, Vol. 9, No. 5, 2008

1415

technology can also be used for incorporating more degradable sequences, such as protease cleavage sites, or replacing the K14 domain with another R-helical polypeptide with higher degradability.

Conclusions The chimeric protein consisting of LG3 and K14 domains is incorporated into the keratin-based hydrogels. The incorporation is due to the presence of the K14 domain, which suggests the involvement of intermolecular coiled-coil association between R-helical domains. The keratin-LG3K14 composite hydrogel provides substrates for the adhesion of neural stem/progenitor cells, promoting their proliferation in the presence of EGF and bFGF. Although the hydrogel system reported here needs further improvements, especially with regard to the requirement of strong denaturants, our strategy for constructing cell-adhesive hydrogels provides the bases for developing biomaterials that improve neural progenitor cell survival following transplantation into the brain for the treatment of Parkinson’s disease. Acknowledgment. This study was supported by Kobe Cluster, the Knowledge-Based Cluster Creation Project and Grant-in-Aid for Scientific Research (no. 19300171, 19 · 6117), MEXT. T.N.-H. acknowledges a research fellowship from JSPS.

References and Notes (1) Kim, S. U. Neuropathology 2004, 24, 159–171. (2) Piccini, P.; Pavese, N.; Hagell, P.; Reimer, J.; Björklund, A.; Oertel, W. H.; Quinn, N. P.; Brooks, D. J.; Lindvall, O. Brain 2005, 128, 2977–2986. (3) Lepore, A. C.; Neuhuber, B.; Connors, T. M.; Han, S. S. W.; Liu, Y.; Daniels, M. P.; Rao, M. S.; Fischera, I. Neuroscience 2006, 142, 287– 304. (4) Imitola, J.; Comabella, M.; Chandraker, A. K.; Dangond, F.; Sayegh, M. H.; Snyder, E. Y.; Khoury, S. J. Am. J. Pathol. 2004, 164, 1615– 1625. (5) Kim, D. E.; Tsuji, K.; Kim, Y. R.; Mueller, F.-J.; Eom, H.-S.; Snyder, E. Y.; Lo, E. H.; Weissleder, R.; Schellingerhout, D. Radiology 2006, 241, 822–830. (6) Marchionini, D. M.; Collier, T. J.; Camargo, M.; McGuire, S.; Pitzer, M.; Sortwell, C. E. J. Comp. Neurol. 2003, 464, 172–179. (7) Höglinger, G. U.; Widmer, H. R.; Spenger, C.; Meyer, M.; Seiler, R. W.; Oertel, W. H.; Sautter, J. Exp. Neurol. 2001, 167, 148–157. (8) Marchionini, D. M.; Collier, T. J.; Pitzer, M. R.; Sortwell, C. E. Cell Transplant. 2004, 13, 273–282. (9) Fujii, T.; Ide, Y. Biol. Pharm. Bull. 2004, 27, 1433–1436. (10) Kirfek, J.; Magin, T. M.; Reichelt, J. Cell. Mol. Life Sci. 2003, 60, 56–71. (11) Sierpinski, P.; Garrett, J.; Ma, J.; Apel, P.; Klorig, D.; Smith, T.; Koman, L. A.; Atala, A.; Van Dyke, M. Biomaterials 2008, 29, 118– 128. (12) Langbein, L.; Rogers, M. A.; Winter, H.; Praetzel, S.; Schweizer, J. J. Biol. Chem. 2001, 276, 35123–35132. (13) Baudoin, C.; Fantin, L.; Meneguzzi, G. J. InVest. Dermatol. 2005, 125, 883–888. (14) Nakamura, A.; Arimoto, M.; Takeuchi, K.; Fujii, T. Biol. Pharm. Bull. 2002, 25, 569–572. (15) Nakaji-Hirabayashi, T.; Kato, K.; Arima, Y.; Iwata, H. Biomaterials 2007, 28, 3517–3529. (16) Shang, M.; Koshikawa, N.; Schenk, S.; Quaranta, V. J. Biol. Chem. 2001, 276, 33045–33053. (17) Lendahl, U.; Zimmerman, L. B.; McKay, R. D. Cell 1990, 60, 585– 595. (18) Caccamo, D.; Katsetos, C. D.; Herman, M. M.; Frankfurter, A.; Collins, V. P.; Rubinstein, L. J. Lab. InVest. 1989, 60, 390–398. (19) Heid, H. W.; Werner, E.; Franke, W. W. Differentiation 1986, 32, 101–119. (20) Kariya, Y.; Tsubota, Y.; Hirosaki, T.; Mizushima, H.; PuzonMcLaughlin, W.; Takada, Y.; Miyazaki, K. Cell. Biochem. 2003, 88, 506–520.

1416

Biomacromolecules, Vol. 9, No. 5, 2008

(21) Campos, L. S.; Leone, D. P.; Relvas, J. B.; Brakebusch, C.; Fässler, R.; Suter, U.; ffrench-Constant, C. DeVelopment 2004, 131, 3433– 3444. (22) Jacques, T. S.; Relvas, J. B.; Nishimura, S.; Pytela, R.; Edwards, G. M.; Streuli, C. H.; ffrench-Constant, C. DeVelopment 1998, 125, 3167–3177. (23) Mahoney, M. J.; Anseth, K. S. J. Biomed. Mater. Res. A 2007, 81, 269–278.

Nakaji-Hirabayashi et al. (24) Georges, P. C.; Miller, W. J.; Meaney, D. F.; Sawyer, E. S.; Janmey, P. A. Biophys. J. 2006, 90, 3012–3018. (25) Hearle, J. W. Int. J. Biol. Macromol. 2000, 27, 123–138. (26) Tachibana, A.; Nishikawa, Y.; Nishino, M.; Kaneko, S.; Tanabe, T.; Yamauchi, K. J. Biosci. Bioeng. 2006, 102, 425–429.

BM701423D