Self-Assembling Protein Arrays Using Electronic Semiconductor

Multiplexed analyte and oligonucleotide detection on microarrays using several redox enzymes in conjunction with electrochemical detection. Kilian Dil...
0 downloads 0 Views 187KB Size
Download PDF
Self-Assembling Protein Arrays Using Electronic Semiconductor Microchips and in Vitro Translation Andrew V. Oleinikov,* Matthew D. Gray, Jun Zhao, Donald D. Montgomery, Andrey L. Ghindilis, and Kilian Dill CombiMatrix Corporation, 6500 Harbor Heights Pkwy, Suite 301, Mukilteo, Washington 98275 Received January 9, 2003; Revised Manuscript Received February 12, 2003

Protein arrays will greatly accelerate research and development in medical and biological sciences. We have used cell-free protein biosynthesis and a parallel immobilization strategy for producing protein biochips. We demonstrate a model two-protein microarray using luciferase and green fluorescent protein, both expressed in a cell-free system and specifically immobilized on CombiMatrix semiconductor oligonucleotide microarrays. This demonstration provides evidence for the appropriate folding, activity, robust presentation, and efficient flexible detection of proteins on the microscale. Keywords: semiconductor microchip • protein microarray • in vitro translation • self-assembly • fluorescence • electrochemical detection.

Introduction Fast and parallel immobilization of multiple proteins in an array format will accelerate the development of diagnostic assay panels, high-throughput screening of drug-candidates, and screening for catalytic or inhibitory effects of various enzymes, among other applications.1 Most conventional approaches to making such arrays typically utilize deposition strategies through mechanical spotting or ink-jet delivery of purified proteins onto modified glass slides, micro/nano-titer plates, or gel pads affixed on glass slides.2-6 These techniques, which are encumbered by several technical problems (e.g., protein drying, mechanical shearing, thermal denaturation, etc.), have been extensively discussed in a recent review.1 Further, and most importantly, these approaches have limited flexibility for preparing unique custom arrays. Self-assembling approaches7,8 to making protein arrays have many advantages over mechanical (or spotting) approaches. The most important of these advantages include the simplicity of the assembly process and the use of mild aqueous conditions for all of the steps. This may afford a commercially viable manufacturing process. The primary challenge here is the development of an approach to prepare a mixture of functional proteins labeled with orthogonal tags. Proteins to be used in array construction are either extracted from tissues/cells, or synthesized in vivo using recombinant methods and bacterial or other expression systems followed by purification.1,4,9 These approaches are not facile, difficult to automate, and are expensive, labor intensive and timeconsuming. They require several steps for purification and/or recombinant manipulations, as well as chemical modification of the proteins to enable their immobilization, all of which may affect protein integrity. Alternatively, biosynthesis of proteins in cell-free systems is quite flexible and can produce numerous proteins, while * To whom correspondence should be addressed. Tel: (425) 493-2218. Fax: (425) 493-2010. E-mail: [email protected]. 10.1021/pr0300011 CCC: $25.00

 2003 American Chemical Society

avoiding the problems mentioned above. Recent improvements in this approach10-12 make it efficient enough to produce the amount of protein required for construction of a microarray. Another advantage of cell-free protein biosynthesis is the ability to incorporate specific moieties, like biotin, co-translationally. These specific moieties can then be used as sites for specific tagging of the synthetic proteins. We have employed a combination of advances in PCR, in vitro transcription/translation, and a self-assembling array technology using a highly flexible semiconductor microarray platform (D. Montgomery, US patent 5,280,595) to prepare custom protein arrays in a fast, efficient, robust, automatable, and economical manner.

Materials and Methods CombiMatrix Platform: Preparation of Oligonucleotide Array Biochips Using Electrochemistry. The CombiMatrix electrode array biochip (CME9608I) has been described previously.13 Briefly, the semiconductor CME9608I chip has 1024 microelectrodes that are each 100 microns in diameter and are each separated by 100 microns. Every microelectrode in the array can be addressed independently using a 10-bit addressing scheme. The CME9608I chip is controlled by custom hardware and software developed by CombiMatrix. Switching an electrode “ON” generates protons, which, in turn, causes a change in local pH. This pH change can be confined to individual electrodes by using an appropriate buffer system (D. Montgomery, US patent 5 280 595), forming so-called “virtual flasks”. Within this “virtual flask” any chemical reaction dependent on pH can be controlled, including common phosphoramidite chemistry used in the chemical synthesis of oligonucleotides. Another feature of CombiMatrix biochips is a proprietary porous reaction layer (1 to 20 µm thick) that is coated onto the surface of the chip. There are numerous advantages to immobilizing and synthesizing biomolecules within a thick porous layer. These include a much larger number of moieties Journal of Proteome Research 2003, 2, 313-319

313

Published on Web 04/05/2003

research articles

Oleinikov et al.

Figure 1. Scheme for electrochemical synthesis of oligonucleotides using the electronic semiconductor microchip platform.

per unit area, a three-dimensional geometry, and the potential for a well hydrated and “biofriendly” milieu. In the present work, we have successfully used different types of membranes. The results presented, however, were all obtained using a modified controlled pore glass (CPG) membrane. Common β-cyanoethyl phosphoramidites were used to synthesize different on-chip oligonucleotides using Glenn Research chemicals for 3′ to 5′ synthesis. This procedure takes only 24 h to prepare an array of 50-mer oligonucleotides. Figure 1 shows, schematically, how this procedure works. The 3′ ends of oligos are attached to the membrane above each electrode. Thirty adenosine residues were placed at the 3′ end of each oligo to create an extension, which reduces steric hindrance between self-assembling molecules. The following twelve oligonucleotides (shown in 5′ to 3′ direction) were synthesized in a repeating checkerboard pattern, with one specific oligo per column, within the membrane on the surface of CombiMatrix microelectronic chips: O1 TACGCCACCAGCTCC-A30 O2 ACGGAGACCTAATCG-A30 O3 GGTAGTGCGAAATGC-A30 O4 CCGGACATCCTCAAG-A30 O5 CATGAACATACAGGG-A30 O6 AAACAACTAGCAATG-A30 O7 GACCTTTGTTGGATT-A30 O8 TAAGGATACACTAGA-A30 O9 CACAATAGGAGAATG-A30 O10 CTCGTAACTCTCGCG-A30 O11 GCATAAATCCGCTGA-A30 O12 AGGCTACGAAGACTT-A30 Oligo O1 was also synthesized in the 8th row on some chips and served as an internal quality control. 314

Journal of Proteome Research • Vol. 2, No. 3, 2003

Prototype Protein Array Microchip: Two-Protein Chip Preparation. All steps of this process are shown, schematically, in Figure 2. (a) Luciferase-FLAG Fusion Protein Preparation. Luciferase control DNA (Promega) was used to prepare DNA coding for a Luciferase-FLAG fusion protein by conventional PCR using the appropriate primers in a single step. The following oligonucleotide primers were used (all primer sequences are shown in the 5′ to 3′ direction): Forward63-mer TACGTAATACGACTCACTATAGGGAAAGTCGCCACCATGGACCCCTCCAAGGACTCGAAGGCC, and Reverse38-mer TTCTCGAGTTAGCACTGCTGAACGGCGTCGAGCGGGTT. The final construct included a T7 RNA-polymerase promoter, Kozak sequence for initiation of translation, the Luciferase coding sequence fused to a FLAG-tag coding sequence, followed by a stop-codon. This DNA construct was transcribed into mRNA, which was then purified, using an in vitro mRNA synthesis kit (Promega). Five micrograms of this mRNA was translated in vitro using the Flexi Rabbit Reticulocyte Lysate Translation System (Promega) supplemented with 6 µL of biotinylated lysine-tRNA (Transcend t-RNA, Promega) in a total volume of 300 µL. (b) EGFP-FLAG Fusion Protein Preparation. Plasmid pEGFP-N2 (Clontech) was used to amplify, by PCR, the EGFPcoding DNA segment. As in the previous example, we added a FLAG-coding sequence fused to the 3′-terminus of the EGFP open reading frame, and T7 promoter and Kozak sequences at the 5′-end of the DNA construct. The following oligonucleotide primers were used: Forward58-mer TAATACGACTCACTATAGGGAAAGTCGCCACCATGGTGAGCAAGGGCGAGGAGCTG, and Reverse55-mer CTATTACTTGTCGTCATCGTCTTTGTAGTCCTTGTACAGCTCGTCCATGCCGAG. This protein construct was expressed by coupled transcription/translation using the TnT T7 PCR Quick Transcription/Translation System (Promega), which was also supplemented with 6 µL of Transcend biotinylated lysine-tRNA (Promega) in a total volume of 300 µL. (c) Capture of Synthetic Proteins on Solid-Phase for Preparation of Oligonucleotide-Tagged Complexes. Anti-FLAG M2 resin (Sigma) was used to capture synthetic proteins, each

Self-Assembling Protein Arrays

research articles

Figure 2. Scheme for the preparation of protein-tag complexes and their self-assembly to create the protein array.

in a separate tube, after translation. 25 µL of resin was added to each translation reaction and mixtures were incubated overnight at 4 °C. All resin washing steps were performed at room temperature using 20 resin volumes of buffer by gentle vortexing for several seconds and pelleting the resin by brief spinning in a low-speed tabletop centrifuge. Resin was washed 5 times in TBS buffer (10 mM Tris-HCl, pH 7.6, 150 mM NaCl). EGFP protein bound to the resin was visible after this step as green fluorescence under the appropriate blue excitation light (FITC filter set). (d) Tagging of Synthetic Proteins with Specific Oligonucleotides. 100 µL of 0.1 mg/mL streptavidin (SA) with 10% BSA in 1 × PBS buffer was added to each tube and incubated for several hours at 4 °C to bind the biotinylated synthetic proteins captured on the anti-FLAG resin. The resin was washed 6 times with TBS and then an excess of a different biotinylated

oligonucleotide (at 5 µM final concentration in 100 µL of 10% BSA in PBS) was added to each tube to bind and tag the synthetic protein-SA complexes. Each oligonucleotide, containing a TEG-biotin at its 3′ end (synthesized by Operon Technologies), was designed to minimize cross-hybridization between each other, as well as to the noncomplementary oligonucleotides synthesized on the chip for capturing the tagged protein complexes. Each synthetic protein was tagged with a specific 15-mer oligonucleotide (Luc with oligo complementary to oligo O4 on the chip, and GFP with oligo complementary to oligo O11). Tagged protein complexes were washed 5 times in TBS and then eluted using 50 µL of 0.3 mg/mL 3 × FLAG peptide (Sigma) in 10% BSA-PBS solution. (e) Functional Activity of the Tagged Complexes. Green fluorescence of the tagged proteins (bound to the resin or eluted) was detected directly in microcentrifuge tubes under Journal of Proteome Research • Vol. 2, No. 3, 2003 315

research articles

Oleinikov et al.

Figure 3. Functional activity of model proteins during and after preparation of the oligo-tagged complexes.

the microscope using a FITC filter set. Luciferase activity was assayed using 1 µL of sample (bead suspension with bound protein or protein sample after elution) and 20 µL of Luciferase Assay Reagent (Promega) mixed on the surface of a Petri dish. Chemiluminescence signal was integrated using the CCD-based Alpha Innotech Corp. Imaging System FluorChem 8000. (f) Self-Assembly of Tagged Protein Complexes on Oligonucleotide Arrays. Eluted tagged complexes were mixed together and the NaCl concentration of the mixture was adjusted to 0.15-0.3 M. This mixture was incubated with an oligonucleotide microarray containing twelve different capturing oligonucleotides, two of which were complementary to the two biotinylated oligonucleotides used to tag the synthetic proteins. Microarray chips were preincubated briefly with blocking solution (10% BSA in PBS) to reduce nonspecific protein binding. Hybridization of tagged protein complexes was performed at 37-40 °C for 2-16 h. All chip-washing steps were performed for 5 min each in 0.5 mL of buffer at room temperature (RT). After washing 3 times in 2 × TBS solution to remove nonbound complexes, chips were ready for analysis of the bound proteins by different biochemical assays. (g) Detection of Specific Assembly and Functional Activity of the Synthetic Proteins. (g1) Detection by Antibody Reactivity. Proteins Immobilized on the Microarray were detected in an indirect immunofluorescence assay. The protein array was incubated with anti-luciferase goat antibody (Promega) (1:200 dilution) and anti-GFP rabbit antibody (Clontech, 1:200 dilution) in 2 × TBS, 10% BSA solution for 2 h at room temperature. Chips were washed 4 times in 2 × TBS and then incubated with secondary antibodies (1:200 dilution) labeled with different fluorescent tags (Jackson ImmunoResearch Laboratories). Mouse anti-Rabbit antibody was labeled with Cy-5, and mouse antigoat antibody was labeled with Texas Red. After 1 h incubation chips were washed 2 times in 2 × TBS. Signals from bound antibodies were visualized by fluorescent microscopy at the appropriate wavelengths. Results are shown in Figure 4. (g2) Detection by Functional Activity. EGFP immobilized on the array was detected by self-fluorescence activity under the appropriate blue light (FITC filter set, see Figure 5). Luciferase activity immobilized on the array was detected using 20 µL of chemiluminescent Lucifearase Assay Reagent (Promega) placed on the surface of the prepared array. Chemiluminescence was detected using a CCD camera and software from Alpha Innotech Corp. (FluorChem 8000 Imaging System). 316

Journal of Proteome Research • Vol. 2, No. 3, 2003

Figure 4. Detection of proteins immobilized on the microarray by indirect immunofluorescence. Row #8 contains O1 control oligonucleotide; therefore, there are no signals across this row.

Figure 5. Detection of proteins immobilized on the microarray by their functional activities. Image with GFP detection is enlarged compared to luciferase image. Arrowheads indicate electrodes containing EGFP.

(g3) Electrochemical Detection. A protein microarray prepared with a single protein, luciferase, as described above, was

Self-Assembling Protein Arrays

Figure 6. Electrochemical detection of luciferase immobilized on the microarray. S1 through S8 indicate the positions of different oligonucleotide columns on the chip. Luciferase was self-assembled onto column S4, probed with R-luciferase antibody, and electrochemically detected using anti-spieces HRP-labeled secondary antibody. A ) amperes.

incubated with goat anti-luciferase antibody (Promega) in 2 × TBS, 10% BSA solution for 2 h at room temperature. The array was washed 4 times in 2 × TBS and incubated with anti-goat secondary antibodies labeled with horseradish peroxidase (Jackson ImmunoResearch Laboratories). After 1 h incubation, the array was washed in 2 × TBS as described above. Electrochemical detection was performed in 50 mM citrate-phosphate buffer (pH 5.0) containing 0.2 M NaCl. The solution also contained 0.003% hydrogen peroxide and 1mM of o-Phenylenediamine (OPD). The measurement duration was 0.5 s, the delay was 0.3 s. Voltage set between the electrode and Pt wire counter electrode was -0.3 V. The electrical output was consecutively addressed for each individual electrode on the chip. The data obtained was then plotted as electrode position (S) versus electrical signal “I - I background”, where “I background” is the average current value obtained from irrelevant electrodes, i.e., electrodes with oligos noncomplementary to the target oligo (Figure 6).

Results Twelve-Oligonucleotide Microchip for Protein Array SelfAssembly. An array with twelve different oligonucleotide sequences synthesized in rows was prepared. The set of 12 oligo sequences used to tag the proteins were complementary to the sequences on the chip, and were designed to minimize their cross-hybridization with the noncomplementary oligos located on microarray. Control experiments, where 3′-Texas Redlabeled tag oligos were separately hybridized at 1 µM concentrations with the oligonucleotide array described above and subsequently washed using conditions described above for protein-oligo tag complexes, revealed no detectable crosshybridization between any of the twelve oligonucleotide tags used and noncomplementary oligos on the array (data not shown). Preparation of Complexes of Tagged Synthetic Proteins. A scheme for the preparation of the complexes of synthetic tagged proteins is shown in Figure 2. All procedures used in this process are known and well established. In principle, SA can be chemically pre-conjugated to a number of oligonucleotide tags for preparation of tagged complexes, as described before.14 However, this step is inconvenient for automation; it

research articles may also reduce the biotin-binding activity of SA. By performing all binding reactions on a solid phase and exploiting the tetrameric nature of SA, possessing four biotin-binding sites, we eliminated the need for this chemical coupling reaction. As illustrated in Figure 2 (panel C), when the synthetic protein is bound to the solid support through its peptide tag (FLAG epitope in our work), or by any other means, the SA tetramers can bind this protein through its incorporated biotin moieties, most likely via one biotin-binding site, leaving the other three sites still available for interaction with biotin. These sites can then be filled in using specific oligonucleotides chemically coupled to biotin moieties and, hence, providing specific tagging for the complex of synthetic protein with incorporated biotins bound to SA. The use of solid-phase for the formation of these complexes makes the whole procedure robust and suitable for automation. It actually becomes very simple, consisting merely of several cycles of component addition, incubation, washing, and finally elution. This process is also less dependent on the protein synthesis yield because larger volumes of translation mixture can be used for poorly synthesized proteins. Moreover, the yield can be standardized by saturation of the solid phase. Each synthetic protein is first bound to the solid support after its synthesis through polypeptide features, which are common for each protein and added to their sequence during PCR, such as a peptide epitope (FLAG in this work). After binding of the synthetic protein to the solid phase, the other components of the translation mixture, including any free biotinylated lysine-tRNA used to incorporate specific moieties (biotin) into the synthetic protein, are removed by washing. The activity and yield of synthetic proteins can be evaluated at this step, if desired, using appropriate methods (such as enzymatic reaction, immunoblotting, etc.). Then an excess of bridging, or linker, molecules (SA) is added. The excess guarantees that all, or most, of the synthetic proteins will be bound by the linker molecules; it also accelerates the kinetics of this binding step as well. After completion of binding, free SA molecules are removed by washing. An excess of specific oligonucleotide conjugated to biotin is then added to bind and tag the synthetic protein-SA complexes. After completion of this binding step, the free (unbound) oligos are removed by washing. The completely formed specifically tagged complexes of synthetic proteins are eluted from the solid phase in gentle conditions (by competition with high concentration of soluble FLAG peptide epitope). The complexes can be monitored for functional activity before the elution, while on the solid phase, as well as after the elution (Figure 3). In our experiments, both proteins retained their functional activity throughout the manipulations required to form the tagged complexes (Figure 3). The eluted complexes are then mixed together and then self-assembled by hybridization on the microarray, which contains oligonucleotides complementary to the protein tagging oligos. Free biotins can be added to the complexes before this mixing step in order to block any residual free biotin-binding sites on SA and, hence, to prevent any subsequent cross-interaction between complexes. Two-protein Array Construction and Validation. The scheme described above was performed to construct a two-protein array. As shown in Figure 4, both synthetic proteins are immobilized in their designated places on the array with high specificity. Oligonucleotides with and without an extender (A30) have been used for protein array preparations, though oligonucleotide arrays with an extender produce better yields of immobilized proteins, as determined by detection with antiJournal of Proteome Research • Vol. 2, No. 3, 2003 317

research articles bodies (data not shown). Other kinds of molecular extenders without polynucleotide hybridization capability (e.g., poly(ethylene glycol)) can be used to reduce steric hindrance between immobilized molecules and the surface of the membrane, and may also increase the yield of bound proteins. Immobilized proteins were detected by indirect immunofluorescence assay, as well as by their individual activities (Figure 5). GFP activity was demonstrated by green fluorescence under the appropriate blue excitation light (FITC filter set). The bright yellowish background observed in this case is due to the auto-fluorescence of the chip surface under this excitation light, though control electrodes without immobilized GFP remain dark. The activity of luciferase was demonstrated using a chemiluminescent substrate. In this case, strong signals were observed with no background. In addition to fluorescence detection, we have demonstrated that specifically immobilized proteins can be detected using an electrochemical method (Figure 6). This is a unique feature of the CombiMatrix microarray platform because it uses semiconductor biochips. The signals, which are obtained for all chip electrodes in about 3 min, are in digital format and can span 4 orders of magnitude depending on the amount of material immobilized on the array (data not shown). The indirect immunofluorescence design for detection of immobilized proteins on the array also represents a demonstration of on-chip protein-protein interaction detection. Here, the primary anti-protein antibody is considered a protein, which interacts with the immobilized protein. This interaction is then detected directly by a labeled detecting molecule (i.e., the fluorescently labeled secondary antibody). Several different ligands can be assayed simultaneously on a single array by using different compounds to label the detecting molecules. Assay conditions employing salt concentrations above 150 mM monovalent salt at neutral pH can be used without disruption of the immobilized complexes. If, however, lower salt concentrations or high pH conditions are to be used, protein complexes should first be cross-linked through their tags after selfassembly using inducible cross-linkers, such as psoralen.

Discussion We have described a method for the preparation of protein array microchips using a combination of advances in PCR, in vitro transcription/translation, and self-assembling array technology. A procedure for preparation of oligonucleotide-tagged SA-biotinylated protein complexes, and their suitability for construction of protein arrays through hybridization with DNA chips, has been described previously.14 However, this procedure relied upon commercially available chemically biotinylated proteins. There are several disadvantages of conventional purification and chemical modification of proteins (described above). The use of in vitro protein biosynthesis in conjunction with co-translational incorporation of specific moieties, biotins in this work, has a dramatic advantage over other methods of preparation and modification of proteins to be placed on microarrays. This approach provides for virtually any protein or its fragment(s) to be placed on the array, either by amplification of the corresponding gene from a natural source like mRNA, cDNA or a plasmid preparation, or by assembly of the gene from synthetic oligonucleotides.15 The co-translational incorporation of biotinylated lysines occurs at the level of 1 to 3 residues per 200 amino acid residues of an average protein molecule (estimation taken from the Manual to “TranscendTM non-radioactive translation detection systems”, Promega). 318

Journal of Proteome Research • Vol. 2, No. 3, 2003

Oleinikov et al.

This level can be adjusted by varying the amount of biotinylated lysine-tRNA added to the translation reaction. However, this level hardly appears to affect the folding and activity of the protein preparations (Promega’s Manual), due to the random incorporation of the modified residues. Co-translational modification of synthetic proteins is also advantageous over chemical modification because proteins do not have to be exposed to harsh chemical substances, which can negatively affect their folding and activity. Moreover, random incorporation of the biotin moieties provides random orientations of the molecules of the synthetic proteins when they are complexed with SA and immobilized on the microarray. This may greatly improve the ability to interrogate the activity of the proteins, since only a fraction of protein molecules will likely be bound in orientations that negatively affect the activity of the proteins. The approach suggested previously14 has other drawbacks for protein array manufacturing including a necessity for the chemical pre-conjugation of SA to the tagging oligos, and a requirement to balance the molar ratio between the SA-oligo conjugates and the biotinylated proteins of interest. This requirement presumes the availability of highly purified proteins and knowledge of exact protein concentrations. Our approach for construction of tagged protein complexes on solid-phase solves these problems and provides an error-free robust procedure. In the aforementioned work of Neimeyer and co-workers,14 they actually demonstrate a two-protein prototype of protein array made on a nano-titer plate, not on a microchip. Another recent work describes the use of in vitro transcription/translation for construction of a protein array in micro-titer plates.16 In this work different DNAs are transcribed and translated in separate micro-titer plate wells followed by immobilization of the de novo synthesized proteins through peptide tags in the same wells. Clearly, this approach is not suitable for microchipbased arrays due to the absence of a physical separation between the individual sites where synthetic proteins are placed. In our work, we have demonstrated the construction of a two-protein prototype of protein array using an actual microchip, and by taking advantage of both in vitro protein biosynthesis and the principles of self-assembly. Naturally, cell-free translation, like any method of protein preparation, has its own restrictions. Not all of the proteins, which are synthesized in a cell-free translation system, would be active or have proper folding. Nevertheless, this system provides for the preparation of virtually any desirable protein or protein fragment, active or not, for their use in appropriate studies and, hence, significantly widens the spectrum of proteins available for the manufacturing of protein microarrays. Our results with Luciferase and Green Fluorescent Protein, at least, suggest that this expression system is acceptable for the sufficient production of appropriately folded, active proteins to be used in microarray approaches. Another clear advantage of the procedure we describe is the use of a three-dimensional membrane to support the synthesis of the array of capturing oligos. This provides a higher volume density of molecules on the array. Also, the chemical nature of the membrane can be changed in response to the requirements of particular applications, providing more flexibility in examining a variety of biochemical processes. Due to the flexibility of the CombiMatrix oligonucleotide synthesis’s platform, any custom oligonucleotide array can be synthesized in a matter of a day because the re-configuration of sequences on a chip requires merely re-entering the sequences on a

research articles

Self-Assembling Protein Arrays

computer. Therefore, any DNA sequences problematic for selfassembly, which may have unwanted interactions with particular proteins due to sequence-specific affinity or the potential aptamer-binding mode of certain oligonucleotides, can be easily changed. The ability to perform electrochemical detection is another unique feature, which distinguishes CombiMatrix microelectrode chips from any other commercial platform for protein microarrays. This provides an accurate detection system that is significantly simpler, smaller, and cheaper than any device currently available for fluorescence detection. Electrochemical output data are immediately available in digital format; the sensitivity is similar, or better, than that achieved by optical detection methods; and the linearity of detection can span several orders of magnitude. In addition, electrochemical detection has the potential to be used for kinetic studies of protein-target interactions. Abbreviations. SA - streptavidin; FLAG - peptide tag sequence DYKDDDDK; EGFP - Enhanced Green Fluorescent Protein; oligo - oligonucleotide.

Acknowledgment. This work was supported in part by NIH SBIR Grant No. R43 HG 02461-01 to A.V.O. References (1) Zhu, H.; Snyder, M. Curr. Opin. Chem. Biol. 2003, 7, 55-63. (2) MacBeath, G.; Schreiber, S. L. Science 2000, 289, 1760-1763.

(3) Zhu, H.; Klemic, J. F.; Chang, S.; Bertone, P.; Casamayor, A.; Klemic, K. G.; Smith, D.; Gerstein, M.; Reed, M. A.; Snyder, M. Nat. Genet. 2000, 26, 283-289. (4) Zhu, H.; Bilgin, M.; Bangham, R.; Hall, D.; Casamayor, A.; Bertone, P.; Lan, N.; Jansen, R.; Bidlingmaier, S.; Houfek, T.; Mitchell, T.; Miller, P.; Dean, R. A.; Gerstein, M.; Snyder, M. Science 2001, 293, 2101-2105. (5) Arenkov, P.; Kukhtin, A.; Gemmell, A.; Voloshchuk, S.; Chupeeva, V.; Mirzabekov, A. Analytical Biochemistry 2000, 278, 123-131. (6) Houseman, B. T.; Huh, J. H.; Kron, S. J.; Mrksich, M. Nat. Biotechnol 2002, 20, 270-274. (7) Brenner, S.; Lerner, R. A. Proc. Natl. Acad. Sci. U.S.A. 1992, 89, 5381-5383. (8) Niemeyer, C. M.; Sano, T.; Smith, C. L.; Cantor, C. R. Nucleic Acids Res. 1994, 22, 5530-5539. (9) Braun, P.; Hu, Y.; Shen, B.; Halleck, A.; Koundinya, M.; Harlow, E.; LaBaer, J. Proc. Natl. Acad. Sci. U.S.A. 2002, 99, 2654-2659. (10) Martin, G. A.; Kawaguchi, R.; Lam, Y.; DeGiovanni, A.; Fukushima, M.; Mutter, W. Biotechniques 2001, 31, 948-950, 952-953. (11) Madin, K.; Sawasaki, T.; Ogasawara, T.; Endo, Y. Proc. Natl. Acad. Sci. U.S.A. 2000, 97, 559-564. (12) Shimizu, Y.; Inoue, A.; Tomari, Y.; Suzuki, T.; Yokogawa, T.; Nishikawa, K.; Ueda, T. Nat. Biotechnol. 2001, 19, 751-755. (13) Dill, K.; Montgomery, D. D.; Wang, W.; Tsai, J. C. Anal. Chim. Acta 2001, 444, 69-78. (14) Niemeyer, C. M.; Boldt, L.; Ceyhan, B.; Blohm, D. Anal. Biochem. 1999, 268, 54-63. (15) Stemmer, W. P.; Crameri, A.; Ha, K. D.; Brennan, T. M.; Heyneker, H. L. Gene 1995, 164, 49-53. (16) He, M.; Taussig, M. J. Nucleic. Acids. Res. 2001, 29, E73-E73.

PR0300011

Journal of Proteome Research • Vol. 2, No. 3, 2003 319