Self-Assembling RNA Nanoparticle for Gene Expression Regulation in

Subscriber access provided by Iowa State University | Library

Article

Self-assembling RNA Nanoparticle for Gene Expression Regulation in a Model System Dominika Jedrzejczyk, and Arkadiusz Chworos ACS Synth. Biol., Just Accepted Manuscript • DOI: 10.1021/acssynbio.8b00319 • Publication Date (Web): 16 Jan 2019 Downloaded from http://pubs.acs.org on January 17, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 10 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Synthetic Biology

Self-assembling RNA Nanoparticle for Gene Expression Regulation in a Model System Dominika Jedrzejczyk and Arkadiusz Chworos* Centre of Molecular and Macromolecular Studies, Polish Academy of Sciences, Sienkiewicza 112, 90-363 Lodz, Poland Supporting Information ABSTRACT: In the search for enzymatically processed

RNA fragment, we found the novel three-way junction motif. The structure prediction suggested the arrangement of helixes at acute angle ~ 60o. This allows the design of trimeric RNA nanoparticle that can be functionalized with multiple regulatory fragments. Such RNA nano-object of equilateral triangular shape was applied for gene expression regulation studies in two independent cellular systems. Biochemical and functional studies confirmed predicted shape and structure of the nanoparticle. The regulatory siRNA fragments incorporated into the nanoparticle were effectively released and triggered gene silencing. The regulatory effect was prolonged when induced with structuralized RNA compared to unstructured siRNAs. In these studies, the enzymatic processing of the motif was utilized for function release from the nanoparticle, enabling simultaneous delivery of different regulatory functions. This methodology of sequence search, RNA structural prediction and application for rational design opens a new way for creating enzymatically processed RNA nanoparticles. KEYWORDS: RNA nanostructures, RNA nanoparticle, RNA architectonics, aRNA, Dicer substrate RNA, gene expression regulation, gene silencing.

The past years witnessed the outburst of nanosciences, including nanobiotechnology and along with that RNA nanotechnology. The search for an effective, biocompatible and reliable system for delivery of bioactive compounds, which can be used for gene expression regulation in pharmacological applications, is still evolving1, 2. Natural polymers, DNA, RNA, polypeptides, have been examined towards utilization in engineered, artificial particles of desired properties3-11. In this search RNA proved to have several advantages. Apart from its biocompatibility, biodegradability and ubiquitous occurrence in the cell, it performs the regulatory function in gene expression pathways12-15. The structural properties of RNA, particularly the predictable folding and formation of stable structural motifs, predispose this biomolecule as a construction material for nanoscaffolds construction 7, 8, 15-22. Numerous RNA motifs were identified and many of their structures were determined by x-ray

crystallography or NMR. RNA structural data can be found in various databases23-28 and such motifs are commonly used in RNA-tectonics approach29. In fact, RNA alone, and in complexes with other biomolecules, were used to design and create various nanostructures7, 17, 18, 20, 30-39. Few of such structures were shown to successfully deliver functional RNA fragments to the eukaryotic cells18, 19, 38, 40-44. However, the RNA particles were used merely as structural scaffolds without biological function. In majority of cases the regulatory fragments were activated via nucleolytic removal of the dsRNA from the scaffold19, 30, 35, 45 or interaction with the cognate partner41, 42, 46-48 without indication that the motif itself had been processed. Recently the three-arm Y-RNA has been obtained with rolling circle transcription (RCT) and Dicer released siRNA fragments used for FP silencing49. Finding enzymatically processed RNA motif would open a new road towards construction of biologically active nanoparticles that could be fully utilized in the cell. Here, the key idea was to introduce the motif that can be processed in cellular environment (e.g. being the substrate for nucleases), determine its structure and engineer for the nanoparticle construction. For that we selected the novel three-way junction motif of unknown structure, that has been shown to be a substrate for dsRNA specific ribonuclease, Dicer50. This ensured the possibility for cellular processing of the RNA fragments containing such a motif and therefore complete utilization of the delivered RNA. The secondary structure of the motif (Figure 1A) was predicted by theoretical analysis and then utilized for the RNA nanoparticle design. The resulting nanoparticle of equilateral triangular shape was designed to incorporate the RNA regulatory fragments (Figure 1B, S1) with an assumption that enzymatic processing of the motif would allow the release of regulatory molecules and induction of RNA interference (RNAi) phenomenon. For the gene expression regulation studies, two cellular model systems have been applied: (1) with reference enhanced GFP (eGFP) gene delivered with plasmid, pmaxGFP and (2) the cell line stably expressing copGFP. The nanoparticle carrying the RNA regulatory fragments targeting either the plasmid section for eGFP or endogenous copGFP protein were applied. The results support the fact that the newly defined motif was effectively processed by Dicer enzyme and the release of

ACS Paragon Plus Environment


C C X G X

C G X X

3’

5’

3’

trimer ABC

R n

dimer AC

X A A

dimer BC

X U

C

3’

dimer AB

5’

monomer C

A

monomer B

the siRNA function triggered the RNAi mechanism for GFP gene expression regulation. monomer A

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 10

trimeric nanoparticle (360nt) dimers (240nt) single monomers (120nt)

5’

B 3wj-nRA

helices

D monomer A monomer B

siRNA

coaxial loops

100nm

monomer C

Figure 1. Design and imaging of triangle shape RNA nanoparticle. (A) The secondary structure of the 3wj-nRA motif. Solid lines represent RNA strands with arrows indication 5’ to 3’ ends; dashed lines represent non-canonical interactions within the motif; red circled nucleotides are required for the motif construction; green are regular WC pairs; n is any nucleotide; and R is a purine. (B) Schematic representation the nanoparticle construction from tertiary motifs including 3wj-nRA motif; (C) Investigation of the nanoparticle assembly by native PAGE electrophoresis; RNAs were stained with Stains-all dye solution. (D) AFM image of triangle-shaped RNA nanoparticles; estimated size of the triangle is 9.6±0.2nm

In our studies, we applied the RNA fragment that has been shown to be processed by a specific endonuclease, Dicer. The CASP8 mRNA fragments, were selected and extensively tested for Dicer processing50, study showed that those fragments were processed with various efficiencies. One of efficiently cleaved fragments was selected for further analysis. Sequence analysis strongly suggested that this was a novel three-way junction motif (Figure 1A). The secondary structure was predicted by the mfold software51 and verified with the RNAfold web server52. The tertiary structure was calculated by RNAComposer53, 54. It appeared that two helices are in continuous stack with the third one protruding under 60o angle. Closer analysis indicated that the four-nucleotide bulge, located between two adjacent arms, is stabilized with a set of non-canonical interactions, which requires a CnRA (n-any nucleotide, R-purine) sequence pattern

(3wj-nRA)55. Determined by the angle between helices to be 60o, this motif was used to design tecto-RNAs assembling into triangular RNA nanoparticle suitable for further functionalization. Following the RNA tectonics29, 56-58 and rational design8 approaches, two arms in the 3wj-nRA motif were extended with 16 bp helices closed by 6 nt loops, which ensures coaxial loop-loop interactions59. The specific sequence design of different loops7, 17 enforced specific interactions between monomers and formation of the stable trimer (Figure 1C). The structure of the monomers and the trimeric nanoparticle was designed to ensure the planar, equilateral triangle shape. The third arm in the 3wj-nRA motif was functionalized with regulatory RNA fragment (Figure 1B, S1). The sequence targeting the Green Fluorescence Protein (GFP) gene was embedded into each monomer, extending effective concentration of


Page 3 of 10

regulatory RNAs after Dicer processing. The computergenerated model showed no structure deformation after functionalization (Figures S2), leading to the final

A

design of equilateral triangle shaped nanoparticle (Figure 1B). Although, similar nanoparticles have been reported30, 35, 43, 45, 60 none of them have been constructed 100%

B

plate reader 48h

80% 60% random seq 2nM

40%

C

M AB

C

2/

2n

3n

3n C

AB

AB

4%

M

M

M 2n B

si R

5%

160

ra

200

nd

om

7%

6%

M 1n B

q se

untreated cells

C

NA

2n

2n

M

M

0%

11%

1/

12%

20%

100%

Counts 80 120

M1

D

flow cytometer 48h

80% 60% 36%

40%

40

25%

16%

20%

23%

19%

12%

siRNA 2nM

B 2nM

untreated cells

M 2n C AB

3n 2/ C

AB

C

1/

3n

M

M

M B

2n

M 1n B

NA

2n

2n siR

AB

ABC 2/3nM

q

104

se

103

om

random seq 2nM

102 FL1-H

nd

101

ra

100

M

M

0% 0

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2. The eGFP expression assay in HeLa cells. (A) Fluorescence microscopic images of the HeLa cells, collected 48h after treatment using Nikon Eclipse Ti-U with FITC filter, 800ms exposition time, picture size 832 x 665.5 µm. The DIC pictures, together with whole panel images, are enclosed in supplementary information (Figure S18). (B) Results from fluorescence intensity measurement using a plate reader collected 48h after treatment. The mean fluorescence intensities based on six technical repeats. (C) The histogram plot from fluorescence intensity measurement with flow cytometer; green filled peak represent negative control, cells treated with plasmid DNA and non-regulatory RNA (random seq.). (D) Graphical representation of the geometric mean fluorescence values (gMFI) from the flow cytometry measurements; based on three technical repeats, 10 000 counts each. The error bars represent standard error of the mean (SEM), data were normalized to negative silencing control, cells treated with plasmid DNA, and non-regulatory RNA (random seq.). The one-way ANOVA statistics indicated that all fluorescence intensity changes were statistically relevant (p < 0.0000001). The eGFP expression assay optimization results and raw data from presented experiments are enclosed in supplementary information Figures S6S21.

based on the enzymatically-processed motif. The designed triangular nanoparticle with the side length of approximately 20 nm holds a potential to be used in nanobiotechnology as a carrier of multiple functionalities or the platform for more complex, supramolecular constructs. The polyacrylamide gel electrophoresis (PAGE) and atomic force microscopy (AFM) were applied to confirm the composition and the shape of the nanoparticles (Figure 1C, 1D, S2, S3, and S5).

Enzymatic processing assay was used to prove that these nano-objects would release the regulatory fragments when delivered into cells. RNA Dicer substrates (DS RNA), including monomer B, were radioactively labelled with 32P at the 5’-end and subjected to the ribonuclease digestion. The radioautographic studies confirmed that the monomers containing the 3wj-nRA motif and regulatory RNA fragments are processed by Dicer (Figure S4),


ACS Synthetic Biology 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

supporting the utility of the nanoparticle for the gene expression regulation. The eGFP gene coding plasmid (pmaxFP-Green-C) was introduced to HeLa cells, which naturally do not express GFP. The transfection was facilitated by custom liposomes, Saint-Red (Synvolux Therapeutics). The expression of GFP gene was investigated by

Page 4 of 10

fluorescence microscopy and fluorescence intensity measurements using a plate reader and flow cytometer. The green fluorescence was visible 24 hours after transfection and, enhancing over time, reaching the maximum value after 48 hours (Figure S6).


Page 5 of 10

A

random seq 15nM

untreated cells

B

C

plate reader 72h

100% 80%

59%

59%

60% monomer B with siRNA1

monomer A with siRNA2

34%

37%

M 5n C9

15 A2

-B

1-

C9

ta ck co

ra

E

100

100%

80

80%

95% 80%

M1

Counts 40 60

nM

nM B1

A2

15

15

5n 9

15

il 1 +2 +

9 NA siR

nM

M

nM

nM 15 2 NA

siR

nd

siR

om

NA

se

1

q

15

15

nM

nM

0%

flow cytometer 72h

79%

76%

60% 38%

40%

37%

32%

31%

20%

20

C9

A2

-B

1-

C9

ta ck co

G

flow cytometer 144h 100

100%

80

80%

M1

Counts 40 60

5n

nM 15

15 B1

A2

15

nM

nM

M 5n +9

il 1 +2

NA

NA

9

2

15

15

nM

nM

nM 15

siR

nd ra

B1 2nM

cocktail 1+2+9 5nM

1

se om

A2-B1-C9 5nM

siRNA9 15nM

F

q

FL1-H random seq 15nM

M

0%

4

10

siR

3

10

NA

2

10

siR

1

10

nM

0

10

15

0

37%

32%

20%

trimer A2-B1-C9

D

56%

44%

40%

monomer C with siRNA9

64%

57%

60% 40%

56%

52%

31%

27%

22%

22%

20

20%

cocktail 1+2+9 5nM

M C9 1-

-B A2

C9

15

5n

nM

nM 15

15

nM B1

il 1 + ta


A2

5n 9

9 NA siR

M

nM 15

15 siR

NA

2

1

2+

nM 15

15

nM

ck

B1 2nM

NA

A2-B1-C9 5nM

co

siRNA9 15nM

10

q

FL1-H

10

siR

random seq 15nM

10

4

se

10

3

om

2

nd

10

1

ra

0

nM

0% 0

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60



Page 6 of 10

Figure 3. The copGFP expression assay in MDA-MB-231/GFP-RFP cells. (A) Fluorescence microscopic images of the MDA-MB-231/GFP-RFP cells, collected 72h after treatment using Nikon Eclipse Ti-U with FITC filter, 800ms exposition time, picture size 832 x 665.5 µm. The DIC pictures, together with whole panel images, are enclosed in supplementary information (Figure S26). (B) Schematic representation of the trimer nanoparticle A2-B1-C9 functionalized with siRNAs 1, 2, and 9. (C) Results from fluorescence intensity measurement using a plate reader collected 72h after treatment. The mean fluorescence intensities based on six technical repeats. (D) The histogram plot from fluorescence intensity measurement with flow cytometer 72h after treatment; green filled peak represent negative control, cells treated with non-regulatory RNA (random seq.). (E) Graphical representation of the geometric mean fluorescence values (gMFI) from the flow cytometry measurements at 72h; based on three technical repeats, 10 000 counts each. (F) The histogram plot from fluorescence intensity measurement with flow cytometer 144h after treatment; green filled peak represent negative control, cells treated with non-regulatory RNA (random seq.). (G) Graphical representation of the geometric mean fluorescence values (gMFI) from the flow cytometry measurements at 144h; from three technical repeats, 10 000 counts each. The error bars represent standard error of the mean (SEM), data were normalized to negative silencing control, cells treated with plasmid DNA and non-regulatory RNA (random seq). The one-way ANOVA statistics indicated that all fluorescence intensity changes were statistically relevant (p < 0.0000001). The copGFP expression assay optimization results and raw data from presented experiments are enclosed in supplementary information Figures S22-S32.

Benefiting from the low cytotoxicity in the presence of antibiotic supplemented media, liposomal transfection agent appeared to be suitable for long time exposure, 5 days without media exchange. It allowed the prolonged cells’ exposure to transfection mixtures increasing the effectiveness of the cell transfection. Further trials showed no cytotoxic effect of the transfection agent and plasmid DNA at tested concentrations (Figure S9). This cellular model system with enhanced green fluorescent protein gene delivered on plasmid was developed for the eGFP gene regulation studies and can be safely applied to other than HeLa cell lines. Second model used in the copGFP gene expression studies was based on human breast adenocarcinoma cells, MDA-MB-231/GFP-RFP (Cell Biolabs, Inc.), with stable expression of the green and red fluorescent proteins. Both GFP model systems were used for gene expression regulation studies. HeLa cells were cotransfected with the eGFP gene coding plasmid, pmaxGFP, and RNA fragments: siRNA, monomers or triangular RNA nanoparticle. As a negative control the random non-regulatory dsRNA was used. Cells were cultivated in a standard RPMI media containing antibiotics. 48 h after the transfection the green fluorescence intensity was measured; cells were analyzed via fluorescence microscopy and plate reader, and harvested for flow cytometry measurements (Figure S10-S21). As expected, the highest fluorescence intensity was observed for the negative control. Further observations showed that transfection of non-regulatory RNA (negative control) had no effect on eGFP expression or cells proliferation and viability. Regulatory dsRNA fragments effectively silenced the eGFP expression in HeLa cells (Figure 2, S10-S21). The strongest effect was observed for trimeric RNA nanoparticle (plate reader) and monomers (flow cytometry), compering the same effective RNAs concentrations. The results obtained with the plate reader and by flow cytometer may vary. Plate reader collects data from a particular area on a cultivation plate

whereas flow cytometer examines single cell fluorescence intensity. Despite slight difference, the effect is compatible. Those results support the hypothesis of synergetic effect that the functionalized trimeric nanoparticles downregulate gene expression as efficiently as unstructured siRNAs. The structuralized RNA objects and RNA nanoparticles show enhanced stability towards non-specific nucleolytic digestion15, 35. However, in this case they showed efficient release of the regulatory fragments, most likely under Dicer processing. In the case of MDA-MB-231/GFP-RFP, each cell contains copGFP gene and the fluorescence intensity is higher than in plasmid gene delivered system. To ensure the most effective regulation of the copGFP, additional siRNAs were tested, resulting in selection of three regulatory fragments (Figure S22-S24). The regulation of copGFP gene expression not only required multiple siRNAs, but also higher effective RNA concentrations and longer experimental time. Benefiting from the possibility to introduce 3-6 independent functions on the trimer, the siRNA mixtures were design to test which part of the copGFP transcript is the most susceptible to RNA interference. The triangular nanoparticle was functionalized with three RNA fragments from the most effective mixture, resulting in highly efficient copGFP silencing (Figure 3, S25). In summary, the novel regulatory nanoparticle was designed based on the newly identified structure of three-way junction motif (3wj-nRA). The sequence of the motif was used for the secondary and tertiary structures prediction. As the motif can be enzymatically digested by naturally occurring ribonuclease Dicer, its incorporation ensured cellular processing of the particle. It enables construction of novel RNA constructs that could have been fully processed and applied for effective gene expression regulation. The structure of equilateral triangular nanoparticle assembly was confirmed in biochemical studies and by means of atomic force microscopy (AFM). These allowed the


Page 7 of 10 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


construction of regulatory nanoparticles, which were used to deliver RNA fragments and the regulatory effect was investigated in two cellular systems: (1) HeLa cell line with eGFP gene delivered on pmaxFP-Green-C plasmid and (2) MDA-MB-231/GFP-RFP cell line endogenously expressing copGFP. In the first model, eGFP gene downregulation has reached over 90% efficiency. In the second model, the MDA-MB231/GFP-RFP cells, with endogenous copGFP were effectively transfected, however the GFP gene downregulation required 2.5 fold higher RNA concentrations and longer exposure time, which in the view of potential application might be profitable. Trimeric nanoparticle enables simultaneous delivery of 3-6 independent regulatory fragments. Here the single gene was downregulated and the prolonged silencing effect was observed for the nanoparticles compering to unstructured RNAs, supporting the extended stability of RNA nanoparticles in cellular conditions. Such multifunctional nanoparticles can be utilized either to enhance the single protein gene expression regulation or targeting multiple genes. ASSOCIATED CONTENT The Supporting Information is available free of charge on the ACS Publications website. Experimental details, data supporting presented results, DNA and RNA sequences used in the studies, additional PAGE analysis, fluorescence and AFM microscopic images and raw data from flow cytometry experiments are all enclosed in Supporting Information file.

AUTHOR INFORMATION Corresponding Author

Arkadiusz Chworos ([email protected]) Author Contributions

The manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript. Funding Sources

This research was supported by Statutory Funds and Funds for Young Researches Development from Centre of Molecular and Macromolekular Studies Polish Academy of Sciences and the National Science Centre in Poland (NCN2015/19/B/ST5/03087)

ACKNOWLEDGMENT This research was supported by Statutory Funds and Funds for Young Researches Development from Centre of Molecular and Macromolekular Studies Polish Academy of Sciences and the National Science Centre in Poland (NCN2015/19/B/ST5/03087). Authors also thank Dr. Lukasz Peczek for the help with statistic analysis.

REFERENCES

[1] Williford, J. M., Archang, M. M., Minn, I., Ren, Y., Wo, M., Vandermark, J., Fisher, P. B., Pomper, M. G., and Mao, H. Q. (2016) Critical Length of PEG Grafts on lPEI/DNA Nanoparticles for Efficient in Vivo Delivery, ACS Biomater Sci Eng 2, 567-578. [2] Uz, M., Alsoy Altinkaya, S., & Mallapragada, S. (2017) Stimuli responsive polymer-based strategies for polynucleotide delivery., Journal of Materials Research 32, 2930-2953. [3] Seeman, N. C. (1982) Nucleic acid junctions and lattices, J Theor Biol 99, 237-247. [4] Seeman, N. C. (1996) The design and engineering of nucleic acid nanoscale assemblies, Current opinion in structural biology 6, 519-526. [5] Seeman, N. C., and Sleiman, H. F. (2017) DNA nanotechnology, Nature Reviews Materials 3, 17068. [6] Rothemund, P. W. (2006) Folding DNA to create nanoscale shapes and patterns, Nature 440, 297-302. [7] Chworos, A., Severcan, I., Koyfman, A. Y., Weinkam, P., Oroudjev, E., Hansma, H. G., and Jaeger, L. (2004) Building programmable jigsaw puzzles with RNA, Science 306, 2068-2072. [8] Chworos, A. (2014) Rational Design of RNA Nanoparticles and Nanoarrays, In RNA Nanotechnology (Wang, B., Ed.), pp 213-234, Pan Stanford Publishing Pte. Ltd. [9] Severcan, I., Geary, C., Verzemnieks, E., Chworos, A., and Jaeger, L. (2009) Square-shaped RNA particles from different RNA folds, Nano Lett 9, 1270-1277. [10] Jaeger, L., Verzemnieks, E. J., and Geary, C. (2009) The UA_handle: a versatile submotif in stable RNA architectures, Nucleic Acids Res 37, 215-230. [11] Dibrov, S. M., McLean, J., Parsons, J., and Hermann, T. (2011) Self-assembling RNA square, Proc Natl Acad Sci U S A 108, 6405-6408. [12] Berg, J. M., Tymoczko, J. L., Stryer, L., and Stryer, L. (2002) Biochemistry, 5th ed., W.H. Freeman, New York. [13] Brown, T. A. (2002) Genomes, 2nd ed., Bios, Oxford. [14] Prasanth, K. V., and Spector, D. L. (2007) Eukaryotic regulatory RNAs: an answer to the 'genome complexity' conundrum, Genes Dev 21, 11-42. [15] Jedrzejczyk, D., Gendaszewska-Darmach, E., Pawlowska, R., and Chworos, A. (2017) Designing synthetic RNA for delivery by nanoparticles, J Phys Condens Matter 29, 123001. [16] Guo, P., Zhang, C., Chen, C., Garver, K., and Trottier, M. (1998) Inter-RNA interaction of phage phi29 pRNA to form a hexameric complex for viral DNA transportation, Molecular cell 2, 149-155. [17] Severcan, I., Geary, C., Chworos, A., Voss, N., Jacovetty, E., and Jaeger, L. (2010) A polyhedron made of tRNAs, Nat Chem 2, 772-779. [18] Afonin, K. A., Bindewald, E., Yaghoubian, A. J., Voss, N., Jacovetty, E., Shapiro, B. A., and Jaeger, L. (2010) In vitro assembly of cubic RNA-based scaffolds designed in silico, Nat Nanotechnol 5, 676-682. [19] Afonin, K. A., Viard, M., Koyfman, A. Y., Martins, A. N., Kasprzak, W. K., Panigaj, M., Desai, R., Santhanam, A., Grabow, W. W., Jaeger, L., Heldman, E., Reiser, J., Chiu, W., Freed, E. O., and Shapiro, B. A. (2014) Multifunctional RNA nanoparticles, Nano Lett 14, 5662-5671. [20] Grabow, W. W., Zakrevsky, P., Afonin, K. A., Chworos, A., Shapiro, B. A., and Jaeger, L. (2011) Self-assembling RNA nanorings based on RNAI/II inverse kissing complexes, Nano Lett 11, 878-887. [21] Grabow, W. W., and Jaeger, L. (2014) RNA Self-Assembly



and RNA Nanotechnology, Accounts of Chemical Research 47, 1871-1880. [22] Jasinski, D., Haque, F., Binzel, D. W., and Guo, P. (2017) Advancement of the Emerging Field of RNA Nanotechnology, ACS Nano 11, 1142-1164. [23] Berman, H. M., Westbrook, J., Feng, Z., Gilliland, G., Bhat, T. N., Weissig, H., Shindyalov, I. N., and Bourne, P. E. (2000) The Protein Data Bank, Nucleic Acids Res 28, 235242. [24] Bindewald, E., Hayes, R., Yingling, Y. G., Kasprzak, W., and Shapiro, B. A. (2008) RNAJunction: a database of RNA junctions and kissing loops for three-dimensional structural analysis and nanodesign, Nucleic Acids Res 36, D392-397. [25] Popenda, M., Blazewicz, M., Szachniuk, M., and Adamiak, R. W. (2008) RNA FRABASE version 1.0: an engine with a database to search for the three-dimensional fragments within RNA structures, Nucleic Acids Res 36, D386-391. [26] Popenda, M., Szachniuk, M., Blazewicz, M., Wasik, S., Burke, E. K., Blazewicz, J., and Adamiak, R. W. (2010) RNA FRABASE 2.0: an advanced web-accessible database with the capacity to search the three-dimensional fragments within RNA structures, BMC Bioinformatics 11, 231. [27] Chojnowski, G., Walen, T., and Bujnicki, J. M. (2014) RNA Bricks--a database of RNA 3D motifs and their interactions, Nucleic Acids Res 42, D123-131. [28] Boccaletto, P., Magnus, M., Almeida, C., Zyla, A., Astha, A., Pluta, R., Baginski, B., Jankowska, E., Dunin-Horkawicz, S., Wirecki, T. K., Boniecki, M. J., Stefaniak, F., and Bujnicki, J. M. (2018) RNArchitecture: a database and a classification system of RNA families, with a focus on structural information, Nucleic Acids Res 46, D202-D205. [29] Jaeger, L., and Chworos, A. (2006) The architectonics of programmable RNA and DNA nanostructures, Current opinion in structural biology 16, 531-543. [30] Khaled, A., Guo, S., Li, F., and Guo, P. (2005) Controllable self-assembly of nanoparticles for specific delivery of multiple therapeutic molecules to cancer cells using RNA nanotechnology, Nano Lett 5, 1797-1808. [31] Turner, B., Melcher, S. E., Wilson, T. J., Norman, D. G., and Lilley, D. M. (2005) Induced fit of RNA on binding the L7Ae protein to the kink-turn motif, RNA 11, 1192-1200. [32] Yingling, Y. G., and Shapiro, B. A. (2007) Computational design of an RNA hexagonal nanoring and an RNA nanotube, Nano Lett 7, 2328-2334. [33] Shu, Y., Cinier, M., Fox, S. R., Ben-Johnathan, N., and Guo, P. (2011) Assembly of therapeutic pRNA-siRNA nanoparticles using bipartite approach, Mol Ther 19, 13041311. [34] Grabow, W. W., and Jaeger, L. (2014) RNA self-assembly and RNA nanotechnology, Acc Chem Res 47, 1871-1880. [35] Khisamutdinov, E. F., Jasinski, D. L., and Guo, P. (2014) RNA as a boiling-resistant anionic polymer material to build robust structures with defined shape and stoichiometry, ACS Nano 8, 4771-4781. [36] Ohno, H., Kobayashi, T., Kabata, R., Endo, K., Iwasa, T., Yoshimura, S. H., Takeyasu, K., Inoue, T., and Saito, H. (2011) Synthetic RNA-protein complex shaped like an equilateral triangle, Nat Nanotechnol 6, 116-120. [37] Ohno, H., and Inoue, T. (2015) Designed Regular TetragonShaped RNA-Protein Complexes with Ribosomal Protein L1 for Bionanotechnology and Synthetic Biology, ACS Nano 9, 4950-4956. [38] Xu, X., Wu, J., Liu, Y., Saw, P. E., Tao, W., Yu, M., Zope, H., Si, M., Victorious, A., Rasmussen, J., Ayyash, D., Farokhzad, O. C., and Shi, J. (2017) Multifunctional

Page 8 of 10

Envelope-Type siRNA Delivery Nanoparticle Platform for Prostate Cancer Therapy, ACS Nano 11, 2618-2627. [39] Halman, J. R., Satterwhite, E., Roark, B., Chandler, M., Viard, M., Ivanina, A., Bindewald, E., Kasprzak, W. K., Panigaj, M., Bui, M. N., Lu, J. S., Miller, J., Khisamutdinov, E. F., Shapiro, B. A., Dobrovolskaia, M. A., and Afonin, K. A. (2017) Functionally-interdependent shape-switching nanoparticles with controllable properties, Nucleic Acids Res 45, 2210-2220. [40] Afonin, K. A., Kireeva, M., Grabow, W. W., Kashlev, M., Jaeger, L., and Shapiro, B. A. (2012) Co-transcriptional assembly of chemically modified RNA nanoparticles functionalized with siRNAs, Nano Lett 12, 5192-5195. [41] Afonin, K. A., Viard, M., Martins, A. N., Lockett, S. J., Maciag, A. E., Freed, E. O., Heldman, E., Jaeger, L., Blumenthal, R., and Shapiro, B. A. (2013) Activation of different split functionalities on re-association of RNADNA hybrids, Nat Nanotechnol 8, 296-304. [42] Afonin, K. A., Viard, M., Kagiampakis, I., Case, C. L., Dobrovolskaia, M. A., Hofmann, J., Vrzak, A., Kireeva, M., Kasprzak, W. K., KewalRamani, V. N., and Shapiro, B. A. (2015) Triggering of RNA Interference with RNA-RNA, RNA-DNA, and DNA-RNA Nanoparticles, Acs Nano 9, 251-259. [43] Ohuchi, S. J., Sagawa, F., Sakamoto, T., and Inoue, T. (2015) Altering the orientation of a fused protein to the RNAbinding ribosomal protein L7Ae and its derivatives through circular permutation, Biochem Biophys Res Commun 466, 388-392. [44] Stewart, J. M., Viard, M., Subramanian, H. K., Roark, B. K., Afonin, K. A., and Franco, E. (2016) Programmable RNA microstructures for coordinated delivery of siRNAs, Nanoscale 8, 17542-17550. [45] Osada, E., Suzuki, Y., Hidaka, K., Ohno, H., Sugiyama, H., Endo, M., and Saito, H. (2014) Engineering RNA-protein complexes with different shapes for imaging and therapeutic applications, ACS Nano 8, 8130-8140. [46] Afonin, K. A., Bindewald, E., Kireeva, M., and Shapiro, B. A. (2015) Computational and experimental studies of reassociating RNA/DNA hybrids containing split functionalities, Methods Enzymol 553, 313-334. [47] Afonin, K. A., Viard, M., Tedbury, P., Bindewald, E., Parlea, L., Howington, M., Valdman, M., Johns-Boehme, A., Brainerd, C., Freed, E. O., and Shapiro, B. A. (2016) The Use of Minimal RNA Toeholds to Trigger the Activation of Multiple Functionalities, Nano Lett 16, 1746-1753. [48] Bui, M. N., Brittany Johnson, M., Viard, M., Satterwhite, E., Martins, A. N., Li, Z., Marriott, I., Afonin, K. A., and Khisamutdinov, E. F. (2017) Versatile RNA tetra-U helix linking motif as a toolkit for nucleic acid nanotechnology, Nanomedicine 13, 1137-1146. [49] Jang, B., Kim, B., Kim, H., Kwon, H., Kim, M., Seo, Y., Colas, M., Jeong, H., Jeong, E. H., Lee, K., and Lee, H. (2018) Enzymatic Synthesis of Self-assembled Dicer Substrate RNA Nanostructures for Programmable Gene Silencing, Nano Letters 18, 4279-4284. [50] Bergeron, L., Jr., Perreault, J. P., and Abou Elela, S. (2010) Short RNA duplexes guide sequence-dependent cleavage by human Dicer, RNA 16, 2464-2473. [51] Zuker, M. (2003) Mfold web server for nucleic acid folding and hybridization prediction, Nucleic Acids Res 31, 34063415. [52] Gruber, A. R., Lorenz, R., Bernhart, S. H., Neubock, R., and Hofacker, I. L. (2008) The Vienna RNA websuite, Nucleic Acids Res 36, W70-74.


Page 9 of 10 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


[53] Popenda, M., Szachniuk, M., Antczak, M., Purzycka, K. J., Lukasiak, P., Bartol, N., Blazewicz, J., and Adamiak, R. W. (2012) Automated 3D structure composition for large RNAs, Nucleic Acids Res 40, e112. [54] Biesiada, M., Purzycka, K. J., Szachniuk, M., Blazewicz, J., and Adamiak, R. W. (2016) Automated RNA 3D Structure Prediction with RNAComposer, Methods Mol Biol 1490, 199-215. [55] Jedrzejczyk D., C. A. (2015) Structural identification of the novel 3 way-junction motif, DNA and RNA Nanotechnology 2, 36-41. [56] Westhof, E., Masquida, B., and Jaeger, L. (1996) RNA tectonics: towards RNA design, Fold Des 1, R78-88. [57] Jaeger, L., Westhof, E., and Leontis, N. B. (2001) TectoRNA: modular assembly units for the construction of RNA nano-objects, Nucleic Acids Res 29, 455-463.

[58] Ishikawa, J., Furuta, H., and Ikawa, Y. (2013) RNA Tectonics (tectoRNA) for RNA nanostructure design and its application in synthetic biology, Wiley Interdisciplinary Reviews: RNA 4, 651-664. [59] Lodmell, J. S., Ehresmann, C., Ehresmann, B., and Marquet, R. (2000) Convergence of natural and artificial evolution on an RNA loop-loop interaction: the HIV-1 dimerization initiation site, RNA 6, 1267-1276. [60] Geary, C., Chworos, A., Verzemnieks, E., Voss, N. R., and Jaeger, L. (2017) Composing RNA Nanostructures from a Syntax of RNA Structural Modules, Nano Lett 17, 70957101.



>NM_033358.3 CASP8, mRNA GUGCUCUGAGUUUUUGGUUUCUGU UUCACCUUGUGUCUGAGCUGGUCU GAAGGCUGGUUGUUCAGACUGAGC UUCCUGCCUGCCUGUACCCCGCCA ACAGCUUCAGAAGAAGGUGACUGG UGGCUGCCUGAGGAAUACCAGU...

Page 10 of 10

2o structure

in silico structure prediction

3o structure


10

Self-Assembling RNA Nanoparticle for Gene Expression Regulation in

Recommend Documents