Semirational Approach for Ultrahigh Poly(3-hydroxybutyrate

Research Article pubs.acs.org/synthbio

Semirational Approach for Ultrahigh Poly(3-hydroxybutyrate) Accumulation in Escherichia coli by Combining One-Step Library Construction and High-Throughput Screening Teng Li,† Jianwen Ye,† Rui Shen,† Yeqing Zong,‡ Xuejin Zhao,‡ Chunbo Lou,*,‡ and Guo-Qiang Chen*,†,§ †

MOE Key Lab of Bioinformatics, Department of Biological Science and Biotechnology, School of Life Science, Tsinghua-Peking Center for Life Sciences, Tsinghua University, Beijing 100084, China ‡ Key Laboratory of Microbial Physiological and Metabolic Engineering, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, China § Center for Synthetic and Systems Biology, Tsinghua University, Beijing 100084, China S Supporting Information *

ABSTRACT: As a product of a multistep enzymatic reaction, accumulation of poly(3-hydroxybutyrate) (PHB) in Escherichia coli (E. coli) can be achieved by overexpression of the PHB synthesis pathway from a native producer involving three genes phbC, phbA, and phbB. Pathway optimization by adjusting expression levels of the three genes can influence properties of the final product. Here, we reported a semirational approach for highly efficient PHB pathway optimization in E. coli based on a phbCAB operon cloned from the native producer Ralstonia entropha (R. entropha). Rationally designed ribosomal binding site (RBS) libraries with defined strengths for each of the three genes were constructed based on high or low copy number plasmids in a one-pot reaction by an oligo-linker mediated assembly (OLMA) method. Strains with desired properties were evaluated and selected by three different methodologies, including visual selection, high-throughput screening, and detailed in-depth analysis. Applying this approach, strains accumulating 0%−92% PHB contents in cell dry weight (CDW) were achieved. PHB with various weight-average molecular weights (Mw) of 2.7−6.8 × 106 were also efficiently produced in relatively high contents. These results suggest that the semirational approach combining library design, construction, and proper screening is an efficient way to optimize PHB and other multienzyme pathways. KEYWORDS: polyhydroxyalkanoates, PHB, high-throughput screening, ribosomal binding site calculator

P

L) to cell dry weight (g/L). PHB content of a typical industrial production process is 60−80% of cell dry weight (CDW).9 The realization of more than 90% content will increase recovery yield and eliminate most purification cost. Previous attempts were made to increase PHB content, including growth medium optimization,9 fermentation process control,10,11 metabolic engineering of host strain,12 or pathway optimization.13 Till now, one can hardly achieve more than 90% PHB content in repeatable ways. Meanwhile, as a polymer, the molecular weight of PHB is critical for its application. Higher molecular weight PHB has better crystallization properties and increased strength compared with those of lower molecular weight PHB.5 Recombinant E. coli harboring the phbCAB operon from Ralstonia entropha (R. entropha) can produce ultrahigh molecular

olyhydroxyalkanoates (PHAs) are a family of polyesters that are naturally produced by microorganisms as carbon and energy storage materials.1,2 Because of their biodegradability and biocompatibility, PHA are widely accepted as eco-friendly biomaterials that could replace traditional plastics with environmental problems.2,3 Poly(3-hydroxybutyrate) (PHB) bioplastic is the most common type of PHA produced in large quantities by bacterial fermentation processes. Its synthesis from acetyl coenzyme A (acetyl-CoA) is achieved by a pathway involving three enzymes including 3-ketothiolase (PhbA), NADPHdependent acetoacetyl-CoA reductase (PhbB), and PHA synthase (PhbC)4,5 (Figure 2A). Heterologous expression of phbCAB operon cloned from native PHB producer leads to PHB accumulation in Escherichia coli (E. coli).6 However, the high production cost associated with a low yield and a complex purification process limits its commercialization.7,8 One efficient way of improving yield and reducing purification cost is to increase PHB content in the cells grown in fermentors. PHB content (wt %) is defined as the ratio of PHB concentration (g/ © XXXX American Chemical Society

Special Issue: 2015 Metabolic Engineering Summit Received: March 12, 2016

A

DOI: 10.1021/acssynbio.6b00083 ACS Synth. Biol. XXXX, XXX, XXX−XXX

Research Article

ACS Synthetic Biology

Figure 1. Scheme for PHB pathway optimization. Applying proper rational design approaches like RBS library design, we reduced the capacity of possible variations in a library from random combinations to a smaller number of combinations (103), and we then successfully constructed the rational designed library through a one-step OLMA method. On-plate visual selection was involved to identify pathways accumulating PHB and reduce the library capacity to 102. High-throughput screening via FACS to screen PHB producers can further reduce the pathways of interest for further detailed analysis to about 101. Detailed analysis can be carried out according to different requirements, and the desired optimized pathway can thus be selected from the library.

weight PHB with weight-average molecular weight (Mw) of approximately 3 × 106.13 Even higher molecular weights can be achieved by introducing different PHA synthase activities or modifying cultural conditions,14 yet in most cases, ultrahigh molecular weights lead to poor PHB content. Hiroe and colleagues showed that by adjusting the activities of three PHB synthesis enzymes at the same time through changing their gene order, ultrahigh molecular weight PHB could be produced in higher contents.13 As a product of a synthetic pathway involving three enzymes, the content and molecular weights of PHB rely heavily on the activities and relative ratios of these enzymes. Adjusting the activities of three enzymes simultaneously is the most straightforward way to optimize the polymer content, molecular weights, or the properties of PHB during its production. So far, no such attempt has been made. Meanwhile, as an energy storage compound, the synthesis of PHB is actively linked to core metabolic networks of the host strain through carbon flux and reducing power distribution. Because of the complex interactions, it is not possible to rationally design or predict the behavior of the modified PHB pathway. A semirational approach combining a rationally designed, easily constructed pathway library and a highly efficient screening method is effective for the optimization of the PHB pathway or other similar multienzyme pathways. Regulatory elements can be involved in pathway library design include promoters, ribosomal

binding sites (RBS), 5′-untranslated region (5′-UTR), coding sequences, plasmid origin of replicon, and terminators. Among them, RBS is critical for enzyme activity regulations at the translational level. The RBS calculator has been developed to generate RBS sequences with specific strengths and applied to multienzyme pathway design with high accuracy.15,16 However, the library construction involving RBS turns out to be laborintensive work. Therefore, a one-pot construction method called oligo-linker mediated assembly (OLMA) was applied to exploit much larger combinatorial space with a moderate-sized (103) library in a single reaction.17 Furthermore, visual selection, highthroughput screening, and detailed analysis were consecutively carried out to select a desired pathway from the library constructed. In this study, recombinants containing PHB pathways accumulating 0% to more than 90% PHB contents in CDW were identified. 92% PHB content in recombinant E. coli was achieved without any optimization of cultural conditions. PHB with significant variations of molecular weights was also obtained, including ultrahigh molecular weight PHB with Mw of approximately 6.8 × 106 in relative high content (45%). This has been the highest PHB content with a Mw of more than 6 × 106 produced in a shake flask reported so far. This semirational design approach provides a fast and convenient way to optimize multienzyme pathways without consideration of complex metabolic background of an organism. B


Research Article


Figure 2. Library construction and on-plate visual selection. (A) Heterologous PHB accumulation pathway in E. coli contains three enzymes encoding three genes phbA, phbB, and phbC in the phbCAB operon cloned from R. entropha. (B) OLMA plasmid library structure. Each plasmid in the library had the same plasmid backbone (with phbB ORF), phbC ORF fragment, phbA ORF fragment, and three randomly picked RBS oligos from three groups of the RBS library. The different sticky ends ensured the proper order of the fragments and oligos. The native phbCAB promoter and native terminator remained the same with the original phbCAB operon. The backbones had either pMB1 (high-copy-number) or p15A (low-copy-number) Origin of Replicon to generate Library H or Library L. S1−S6, 4-bp unique sticky ends for OLMA ligation. RBSsphbC/A/B, RBS Libraries for phbC/A/B. (C) On-plate visual selection. Each colony on the plate showed different colors and transparencies indicating different PHB accumulations. Colonies accumulating more than 10 wt % of PHB can be distinguished from others under sunlight. The whiteness and nontransparency varied due to different PHB accumulation levels.

■

RESULTS AND DISCUSSION Strategy for PHB Pathway Optimization Combining RBS Library Design and High-Throughput Screening. A semirational strategy for optimization of a multienzyme (PHB) synthesis pathway in an efficient and convenient way was developed (Figure 1). In this strategy, different library construction methods were involved to generate a library including different variables such as promoters, RBSs, CDSs, terminators, gene orders, and/or plasmid backbones. In this case, only RBSs and plasmid backbones were involved in the library design and construction process, while promoters, CDSs, gene orders, and terminators remained in their original sequences to illustrate the effect of different RBS sequences on this multienzyme pathway. The OLMA method we developed enabled one-step construction of a library involving all of the variables mentioned above including significant amounts of oligos like RBS libraries that were difficult to assemble using other conventional methods. After successful construction, the library was screened through processes of on-plate screening (visual selection), high-throughput screening via fluorescenceactivated cell sorting (FACS), and detailed in-depth analysis. The on-plate screening was achieved when colonies were grown on plates with LB-Glu (LB medium supplemented with 20 g/L glucose) solid medium; colonies appeared white when PHB was accumulated intracellularly. PHB stained with lipophilic fluorescence dye BODIPY enabled FACS screening of intracellular PHB contents. Compared with Nile Red, BODIPY was more sensitive and thus more suitable for FACS.18 Since pathways producing different PHB contents were selected via high-throughput screening, the detailed analysis could be further carried out according to various properties of interest. The

properties could be PHB contents, molecular weights, transcriptomic or proteomic patterns affected by different pathways, carbon fluxes, growth rates, titers, byproducts, or other properties of interest. It was successfully demonstrated that the thus constructed pathways produced various intracellular PHB contents, molecular weights, and PHB accumulation patterns as confirmed via gas chromatography (GC), gel permeation chromatography (GPC), and transmission electron microscopy (TEM), respectively. In-silico Design of RBS Libraries. To design the RBS libraries, the 35-bp upstream sequences of phbC, phbA, and phbB were regarded as native RBSs, and their strengths were evaluated using RBS Calculator (reverse engineering mode).16,19 Their strengths indicated by translation initiation rate (T.I.R.) were 1136 (RBSphbC), 2823 (RBSphbA), and 5253 (RBSphbB). On the basis of these results, RBS libraries with wide ranges of specific T.I.R.s for each of the three genes were designed using RBS Calculator (forward engineering with constraints mode). Taking the RBSphbC library as an example, the core region (position −6 to −16) was replaced by an 11-bp random base pair (indicated by N), while the other areas (positions −1 to −5 and −17 to −35) were maintained the same as native RBS. Thus, this generated the f o l lo w i n g d e g e n e r a t e d s e q u e n c e : G G T T C G A A T AGTGACGGCANNNNNNNNNNNAAATC. Taking this degenerated sequence and a desired T.I.R. as input, RBS calculator (forward engineering with constraints mode) would return an RBS sequence with the desired T.I.R. With the same strategy, the RBSphbC library with 10 members of T.I.R. ranging from 0 to 37,000 was established. The RBSphbA library with 10 RBSs ranging from 0 to 25,000, and the RBSphbB one with 10 RBSs C


Research Article

ACS Synthetic Biology Table 1. Strains and Plasmids Used in This Study strain/plasmid E.coli Mach1 T1 pBHR68 pBHR68-GG pRH pSB3A3 pRL pHD pHD-phbC pHD-phbA pPCH pPCL pLibrary-H #N pLibrary-L #N

description

reference

Strains F−φ80(lacZ) ΔM15ΔlacX74hsdR(rk−,mk+) ΔrecA1398 endA1 tonA Plasmids pBlueScript with phbCAB operon from R. entropha, AmpR Golden Gate ligation compatible pBHR68, free of BsaI sites, AmpR recipient plasmid with phbCAB native promoter, Golden Gate ligation fragment for library construction and phbB ORF, ColE1 (derivative) ori, derived from pBHR68, AmpR standard parts backbone plasmids, AmpR

Life Technologies 36 this study this study

Registry of Standard Biological Parts recipient plasmid with phaCAB native promoter, Golden Gate ligation fragment for library construction and phbB ORF, this study derived from pSB3A3, p15A ori, AmpR donor plasmid backbone, BsaI site free, TetR Life Technologies donor plasmid with phbC ORF and BsaI sites, TetR this study donor plasmid with phbA ORF and BsaI sites, TetR this study positive control for Library H, native phbCAB RBSs, derived from pRH, AmpR this study positive control for Library L, native phbCAB RBSs, derived from pRL, AmpR this study plasmid library of phbCAB with different RBSs based on high-copy-number ori, N stands for specific colony number in this study the library, AmpR plasmid library of phbCAB with different RBSs based on low-copy-number ori, N stands for specific colony number in the this study library, AmpR

Table 2. RBS Sequences Designed for RBS Libraries with Their Specific T.I.Rsa RBS #

associated ORF

T.I.R.

sequences

C1 C2 C2.7 C5 C10 C15 C20 C30 C37 C50 A1 A2 A3 A5 A7 A10 A15 A20 A24 B0.5 B1 B1.5 B2 B3 B5 B10 B20 B50

phbC phbC phbC phbC phbC phbC phbC phbC phbC phbC phbA phbA phbA phbA phbA phbA phbA phbA phbA phbB phbB phbB phbB phbB phbB phbB phbB phbB

1013.14 1910.98 2704.86 4881.77 9588.6 14770.3 20447.37 31786 36992 46327 998.05 2075.96 3061.21 5494.36 7319.54 10720 14757 19700 24210 572.06 1060.1 1503.2 1887.05 2988.18 4641.8 9514.13 25607 50296.95

ATCAGGTTCGAATAGTGACGGCAGAGGAACCGACAAATCATGGCGA ATCAGGTTCGAATAGTGACGGCAACGGAAGGTACAAATCATGGCGA ATCAGGTTCGAATAGTGACGGCATATAACGAGGCAAATCATGGCGA ATCAGGTTCGAATAGTGACGGCAGAAGGCAGGCATAATCATGGCGA ATCAGGTTCGAATAGTGACGGCAACTAAGGGGTCAAATCATGGCGA ATCAGGTTCGAATAGTGACGGCAGGGGGGTACAAGAATCATGGCGA ATCAGGTTCGAATAGTGACGGCAGACAACGGAGGTAATCATGGCGA ATCAGAATAGTGACGGCAAGATAAGAGAGGTATCATGGCGA ATCAGGTTCGAATAGTGACGGCAAGAGAGAGGTACAATCATGGCGA ATCAGGTTCGAATAGTGACGGCATCAAGGAGGATTAATCATGGCGA CTGCAGGTTCCCTCCCGTTTCCATTCTAAGAACTCCACAATGACTG CTGCAGGTTCCCTCCCGTTTCCATTCAGGAGAAATCACAATGACTG CTGCAGGTTCCCTCCCGTTTCCATTACTAAGGACTCACAATGACTG CTGCAGGTTCCCTCCCGTTTCCATTAAGAGGAGTCCACAATGACTG CTGCAGGTTCCCTCCCGTTTCCATTTTAAGGAGCTCACAATGACTG CTGCCCCTCCCGTTTCCAAATAAGGAGCACCACAATGACTG CTGCAGGTTCCCTCCCGTTTCCATTTAAGGAGCAACACAATGACTG CTGCAGGTTCCCTCCCGTTTCCATTAAGGAGTAATCAAAATGACTG CTGCAGGTTCCCTCCCGTTTCCCTCTAAGGAGCACATCAATGACTG GGACCCGGCGACGATAACGAAGCCAGGAGAAAGACGGACATGACTCAG GGACCCGGCGACGATAACGAAGCCAAGGAAAGGACGGACATGACTCAG GGACCCGGCGACGATAACGAAGCCAACAGGGGGACGGACATGACTCAG GGACCCGGCGACGATAACGAAGCCATACAAAGGACGGACATGACTCAG GGACCCGGCGACGATAACGAAGCCACAACAGAGAAGGACATGACTCAG GGACCCGGCGACGATAACGAAGCCAAAAGGGGAACGGACATGACTCAG GGACCCGGCGACGATAACGAAGCCAAATAGGGGACGGACATGACTCAG GGACCCGGCGACGATAACGAAGCCTAAAAGGAGGTCGACATGACTCAG GGACGACGATAACGAAGCCCATAGGGGGGTAAACATGACTCAG

a

Three groups of RBSs designed by RBS Calculator. Letters with underlining indicate sticky-end sequences for proper ligation during OLMA assembly. Letters in bold indicate the translational starting site.

ranging from 0 to 50,000 were also generated (Figure 2B). All of the RBS sequences in the library were listed in Table 2.

on two plasmid backbones: a high-copy-number plasmid with a ColE1 (derivative) origin of replicon (Library H, copy number = 300−50020) and a low-copy-number plasmid with p15A origin of the replicon (Library L, copy number = 10−1220). The other elements in the two plasmids remained the same, including a selection marker (Ampicillin resistance gene) and the structure of the PHB operon. Previously designed RBS sequences were

■

GENERATION OF THE LIBRARY OF PHB PATHWAYS The PHB pathway library with three groups of RBS at the upstream of three genes phbCAB was constructed using the OLMA method introduced earlier.17 The library was built based D


Research Article


Figure 3. Characterization of the PHB pathway activities and correlation between fluorescence intensities and PHB contents. (A) PHB pathway activities and corresponding RBS sequences in Library H. RBS strengths were indicated by shades of color. Fluorescence intensities were shown by brown columns. Two parallel experiments were carried out for each sample. H1−40, selected samples of Library H. H-PC, original phaCAB operon with native RBSs, positive control for Library H. N-PC, negative control for Library H. (B) PHB pathway activities and corresponding RBS sequences in Library L. (C) RBS strengths (T.I.R.) of RBSsphbC (blue), RBSsphbA (green), and RBSsphbB (red) indicated by shades of color. (D) Nonlinear, positive correlation between fluorescence intensity measured by FACS and PHB content (wt %) measured by gas chromatography (FI in D were not comparable with FI in A and B due to different instrument parameters).

reflecting PHB accumulation. In Library-H, approximately 1/4 pathways showed stronger FI compared with H-PC (positive control, which was recombinant containing the pathway with native RBSs). The highest one, namely, sample H25 with FI = 68089 ± 582, showed 25% stronger than H-PC (FI = 56877 ± 1471), and 5.6 times stronger than the lowest sample H5 with FI = 12080 ± 433. In Library-L, 33 out of 42 samples showed higher FI than L-PC, while the highest sample L25 with FI = 16431 ± 586 was 3.5 times stronger than L-PC (FI = 4682 ± 172) and 25.7 times than the lowest sample L14 (FI = 639 ± 87). These results indicated significant impacts of enzyme activities generated from RBS strengths on PHB pathway activities. RBS constructed in this study led to continuous changes of PHB accumulation from zero to very high level of 92% CDW, enabling systematic investigation on activities of PHB pathways and more importantly, other similar multiple-enzyme reactions. No clear relationships between RBSphbA or RBSphbB and pathway activities were identified, while RBSphbC had a slightly positive correlation with pathway activities, especially in Library L. High activity of PhbC seemed essential for high PHB pathway activity (and thus more PHB accumulation). Since no clear relationship involving all three genes were found, the complete rational design of PHB pathway aiming at a high PHB accumulation or other performances was not possible in this complex metabolic context. Meanwhile, the semirational approach in this study combining rational library design and high-throughput screening starting from a successfully constructed library was more suitable for optimization of this multiple enzymes pathway. With the proper library design strategy, the high efficient library construction and screening method developed here was able to find the optimized PHB

synthesized as double-strand oligos-DNA with proper stickyends, and they were ligated with all the other donor plasmids and recipient plasmids in a single OLMA reaction. Each positive plasmid in the library contains three RBS randomly picked from the three groups of the RBS library. Since 10 different RBS were designed for each group, the capacity of the library is 1,000 combinations. Two libraries (Library L and Library H) with 1000 combinations were successfully constructed (Figure 2B). Visual Selection and High-Throughput Screening of Recombinants with PHB Pathways. Colonies accumulating PHB can be distinguished from nonaccumulating ones according to color and transparency. When grown in LB-Glu solid medium, colonies accumulating PHB with more than 10% PHB content showed white color without transparency compared with control colonies with poor PHB accumulation or without PHB at all (Figure 2C). The level of white color and nontransparency increased slowly along with increasing of PHB contents. Approximately 50 colonies from Library L and another 50 from Library H were visually selected based on various degrees of whiteness and transparency. Each colony contained a specific plasmid with unique PHB pathways. All of the selected colonies were cultivated in the LB-Glu medium separately in 96-deep-well plates for studying PHB accumulations. The culture broth was then stained with lipophilic fluorescence dye BODIPY 493/503 (Life Technologies, US) and analyzed by FACS; their RBS regions were sequenced to identify their strengths. Characterization of PHB Pathway Activities. Relationships between RBS strengths and levels of PHB accumulations were established based on fluorescence intensities (FI) (Figure 3A and B). Darkness on the left indicates the strengths of their RBSsphbC/A/B and the right columns showed corresponding FI E


Research Article


Figure 4. PHB content analysis. Selected samples from Libraries H and L with different fluorescence intensities were further cultivated in shake flasks and their PHB accumulations analyzed. Samples were sorted according to their PHB contents. Among them, sample H36 showed the highest PHB content of 92%, while sample L-PC showed the lowest (10.2%). Three parallel experiments were carried out for each sample. H-PC, positive control of Library H. L-PC, positive control of Library L.

Figure 5. TEM images of cells with 0%−92% PHB contents. Nine samples with continuous increasing PHB contents were analyzed under TEM; all images were taken under the same magnification (40,000X for A-I, 20,000X for J, K). Sample names and corresponding PHB contents were listed here: (A) H-NC, 0%. (B) L-PC, 10%. (C) L13, 18%. (D) L3, 45%. (E) L32, 52%. (F) H31, 66%. (G) H-PC, 72%. (H) H23, 85%. (I) H36, 92%. (J) H23, 85% (20,000×). (K) H36, 92% (20,000×).

synthesis pathway without considering complex interactions among heterologous pathways and complicated metabolic backgrounds. Correlation Between FI and PHB Contents. To illustrate the accuracy of high-throughput screening, several samples selected from the library were cultivated in shake flasks and their

PHB accumulation analyzed by FACS and the traditional GC method at the same time. Since samples with continuous and broad range of pathway activities were obtained for the first time, a correlation was established between PHB contents and FI (Figure 3D). Results showed a nonlinear and positive correlation rather than the positive linear correlation reported earlier.18 F


Research Article


Table 3. Cell Growth, PHB Accumulation, and Molecular Weights of Selected Samples from Library-L and Library-Ha No.

CDW (g·L−1)

PHB (wt %)

RBSphbC

Mn (×106)

Mw (×106)

Mw/Mn

L29 L19 L36 L37 L32 L-PC H-PC H01 H36 H32 H30

4.66 ± 0.71 4.36 ± 0.19 4.55 ± 0.35 4.09 ± 0.52 6.01 ± 0.25 2.41 ± 0.24 9.71 ± 0.25 9.75 ± 0.12 10.21 ± 0.16 10.67 ± 0.07 9.71 ± 0.37

45.16 ± 1.49 30.87 ± 3.15 32.41 ± 0.88 29.12 ± 2.49 52.93 ± 0.85 11.34 ± 1.40 70.90 ± 1.74 66.48 ± 4.67 91.60 ± 0.64 87.30 ± 1.92 61.29 ± 0.75

15000 15000 15000 20000 37000 1000 1000 2000 20000 15000 37000

2.89 2.89 3.03 2.93 2.47 2.68 1.69 1.17 1.36 1.23 0.88

6.77 5.62 5.32 4.94 4.41 4.35 3.55 3.24 3.04 2.99 2.66

2.35 1.95 1.76 1.68 1.78 1.62 2.10 2.77 2.23 2.44 2.96

a

L#, samples from Library-L (low-copy-number plasmid library). H#, samples from Library-L (low-copy-number plasmid library). L-PC, positive control for Library-L. H-PC, positive control for Library-H. Mn, number-average molecular weight. Mw, weight-average molecular weight. CDW and PHB content data were generated from three parallel experiments.

areas were cytoplasm. Clearly increasing cell sizes and PHB granule sizes related to increasing PHB contents could be observed. For samples with lower than 52% PHB content, PHB granules were only stored in a fraction of cells; cell shapes appeared normal and undamaged (Figure 5A−E). Heterogeneity of PHB accumulation between cells was significant. When more than 60% PHB was accumulated, PHB granules were visible in most cellular spaces, and some cells started to be broken, leaking PHB granules extracellularly (Figure 5F and G). With over 80% PHB accumulation, cell sizes expanded significantly to accommodate more PHB, and the cytoplasm was pushed to the cell edge (Figure 5H and J). For sample H36 with 92% PHB content, both large cells with one giant PHB granule and PHB granules released from broken cells were observed; the cytoplasm was hardly seen (Figure 5I and K). The heterogeneity of PHB accumulation among individual cells in the same population was significant both in Library-L and Library-H samples. Some samples (Figure 5D and E) were observed with only a fraction of cells accumulated with PHB; other samples (Figure 5G and I) showed significant differences in cell sizes and PHB granule sizes. In contrast, natural PHB producers generated roughly similar cell shape, granule size, and similar PHB contents.22 The differences observed here could be attributed to the instability of PHB pathway activity, a result of the unstable plasmid distribution between daughter cells during cell division.23 These results indicated the necessity of inserting the heterologous pathway onto the chromosome to ensure the stability of pathway activity for industrial applications. Molecular Weights of PHB Produced in Different Pathways. Another 11 samples from both Library-H or Library-L were selected for molecular weight study. PHB produced from each sample was purified after PHB content analysis, and their number-average molecular weight (Mn) and weight-average molecular weight (Mw) were studied using gel permeation chromatography (GPC) (Table 3). All selected Library-L samples showed higher molecular weights than Library-H samples, indicating that the PHB synthetic pathway expressed on low-copy-number plasmids tended to accumulate higher molecular weight PHB. In general, strengths of RBSphbC exhibited a negative effect on molecular weights in each library: stronger RBSphbC led to lower Mw. Strong RBSphbC (T.I.R. = 37000) in samples H30 and L32 showed the lowest Mw among their library. This trend was more significant in Library-L samples and was not applicable to positive control ones. No relationship between RBSphbA/RBSphbB and molecular weight was found.

Although no mathematical model was found to elucidate this nonlinear correlation, it was still convincing due to a large number of data reflecting continuously increasing PHB contents from 0% to >90% achieved for the first time. Generally, this positive correlation ensured the feasibility of high-throughput screening of strong PHB producers. Quantitative Analysis of PHB Contents in Recombinants with Selected Pathways. Approximately 20 samples from two libraries were chosen for further analysis. Shake flask studies were carried out in the LB-Glu medium for PHB accumulation. PHB weights and residual cell masses were analyzed via gas chromatography (Figure 4). All selected LibraryH samples showed higher PHB contents than Library-L ones. Comparison of H-PC (content = 71 ± 2.1%) and L-PC (content = 10.2 ± 1.7%) revealed that a high plasmid copy number was crucial for sufficient PHB accumulation when heterologously expressing native phbCAB operon in E. coli, which was consistent with earlier studies.21 In Library-L, simply modifying RBSs from native ones without changing other sequences in the operon was able to increase PHB content approximately five times. Compared with H-PC, PHB content of sample H36 in Library-H increased 29% to a level of 92%, which could be the limit for PHB accumulation under shake flask conditions. Meanwhile, residual cell masses (CDW-PHB) remained relatively the same in low PHB content samples and decreased in high PHB content samples, demonstrating the metabolic burden of highly active PHB accumulation on cell growth (Figure 4). Residual cell masses of H36 and H-PC were 0.86 ± 0.08 g/L and 2.83 ± 0.28 g/L, respectively. Metabolic burden also resulted in plasmid instability, and sequential cultivations of the same sample led to reducing PHB accumulation, while retransformation of the plasmid restored the pathway activity (data not shown). For the selected samples, high-throughput screening results agreed with their corresponding quantitative analysis with some exceptions like H36 and H31. Differences in these samples were caused by cultural condition alterations between 96-deep-well plates and shake flasks, and culture conditions affected the supply of reducing power for the PhbB catalyzing reduction reaction. Pathways with weak RBSphbB were likely to be more sensitive to the deficiency of reducing power, like those in the case of H36 and H31 (Figures 3 and 4). PHB Accumulation Patterns of Cells with 0−90% PHB Contents. Nine samples with continuous increasing PHB contents were investigated under TEM (Figure 5). Brighter areas inside the cells were PHB granules accumulated while darker G


Research Article

ACS Synthetic Biology According to previous studies,13,24 the PHB titer and molecular weight had a trade-off relationship. By weakening the activity of PhbC, PHB synthase, ultrahigh molecular weight PHB, can be produced along with decreasing of PHB content, while increasing the activity of PhbC produces more PHB with a low molecular weight. Because of this trade-off relationship, efficient production of ultrahigh molecular weight PHB remains difficult. In this work, by adjusting the activities of PhbC and PhbA/B simultaneously, a higher PHB content with an ultrahigh molecular weight PHB was achieved in sample L29, which accumulated 45% of PHB with Mw of 6.77 × 106 without any other optimization on culture condition or enzyme structure. So far, this was the highest PHB content with such ultrahigh molecular weight of more than 6 × 106 Mw produced from shake flask studies. Discussion. The aim of this work was to optimize PHB production in an efficient way by benefiting from philosophies of synthetic biology. As a carbon and energy storage compound, accumulation of PHB is highly related to the carbon flux inside the cell. Because of the complicated metabolic background, it is difficult to optimize the PHB synthetic pathway by a rational design approach. Therefore, the semirational approach combining library design, construction, and proper screening is a reasonable way to achieve this optimization. Among different genetic elements that can be involved in library design, RBS is a choice due to its short sequence and strong impact on enzymatic activities. Since RBS related library construction is laborintensive work, we applied a one-step OLMA method to simplify the process. A library consisting of high or low plasmid copy numbers and RBS with different strengths for each of the three PHB synthesis genes was successfully constructed using the OLMA method. The subsequent screening processes were further simplified by visual selection according to the white color of PHB accumulating colonies when grown in a glucose-rich medium and high-throughput screening by FACS. Recombinant E. coli containing various pathways with desired properties were selected from the library through visual selection, highthroughput screening, and detailed analysis. 0%−92% PHB contents in CDW were produced by the selected recombinants. PHB with various weight-average molecular weights (Mw) of 2.7−6.8 × 106 were also efficiently produced in relatively high contents. These results suggested that the semirational approach is an efficient and convenient way for multienzyme pathways optimization as one can achieve the desired pathway without considering complex interactions among heterologous pathways and host differences as well as very complicated metabolic backgrounds. This study only dealt with three key PHB synthesis genes phbC, phbA, and phbB. Since many other genes including phaP, phaM, and phaZ have also been found to affect PHA (PHB) synthesis,25−27 they can be included to expand the multipleenzyme pathway for enhanced PHB synthesis. Other products involving multiple gene containing pathways such as ectoin,28 amino acids,29 succinate,30 fatty acids,31 and even steroids32 can also be optimized using a similar approach. This remains a subject for further exploration.

as two recipient plasmids for RBS library construction in highcopy-number and low-copy-number plasmids, respectively. Plasmid pHD carrying phbC and phbA ORFs were used as a donor for the library construction. The libraries generated were named pLibrary-H (high-copy-number library) and pLibrary-L (low-copy-number library) (Table 1). Culture Media and Cell Cultivation. For molecular cloning, all of the strains were cultured in Luria−Bertani (LB) medium. In shake flask experiments for PHB accumulation, the strains were first streaked or spread onto a LB-Glu (LB with 20 g/ L glucose) plate and placed at 37 °C overnight. Single colonies were picked from the plate and transferred into 5 mL of LB medium in a 14 mL round-bottomed tube (BD Biosciences) and cultured in a shaker in 37 °C and 200 rpm overnight. Subsequently, 200 μL of broth was transferred into 20 mL of LB medium in a 100 mL conical flask and cultivated under the same condition until the optical density at 600 nm (OD600) reached 0.6−1.0 (∼6 h). Then, 2.5 mL of broth was transferred into 50 mL of LB-Glu medium in a 500 mL conical flask and cultivated under the same condition for 24 h. In a 96 deep well plate, cultivation was conducted for high-throughput screening of PHB accumulation strains, and single colonies were picked and transferred into 96 deep well plates with 1 mL of LB medium in each well. The plate was then cultured in a 96 well plate shaker at 37 °C, 1000 rpm overnight. After that, 50 μL of broth was transferred into another deep well containing 1 mL of LB-Glu medium and cultivated for another 24 h. All of the media above also contained appropriate antibiotics (100 mg/L Ampicillin). OLMA Based One-Step Library Construction. The procedure of library construction followed the general protocol of OLMA described previously.17 During this process, a recipient plasmid (pRH or pRL), two donor plasmids (pHD-phbC and pHD-phbA), and three groups of synthetic double-strand oligos containing different RBSs were assembled in one reaction simultaneously. The fragment between native phbCAB promoter and ORF phbB (RBSphbC-ORFphbC-RBSphbA-ORFphbA-RBSphbB) in pBHR68-GG was replaced by a synthetic DNA fragment containing two BsaI restriction sites to generate recipient plasmid pRH (Figure S1). Subsequently, the whole fragment (phbCAB promoter-BsaI fragment-ORFphbB) was amplified and ligated into pSB3A3 to generate recipient plasmid pRL (Figure S1). Donor plasmids pHD-phbC and pHD-phbA were constructed by ligating ORFphbC and ORFphbA from pBHR68-GG into pHD via Gibson assembly (Figure S2). In-silico designed RBSsphbC, RBSsphbA, and RBSsphbB were synthesized (Invitrogen) in two reverse complemented singlestrand oligos. The sequences of each oligo were designed with proper sticky-ends in the 5′-end for further reaction. Each pair of oligos was dissolved in TE (Tris-EDTA) buffer, annealed at 90 °C for 5 min (concentration was 1 μM for each oligo), and then cooled to 4 °C at 0.1 °C/s to generate double-stranded RBS fragments with proper sticky-ends. After dilution 10 times, the double-strand fragments were further phosphorylated using T4 PNK (New England Biolabs) according to the manufacturer’s instructions. Each group of phosphorylated oligos was mixed together. The OLMA reaction solution (total volume is 20 μL) contained the following components: recipient plasmid (50 ng), two donor plasmids (150 ng for each), three groups of oligo mixture (1.3 μL for each group), BasI (1 μL, New England Biolabs), T4 DNA Ligase (1 μL, New England Biolabs), and 10× T4 DNA ligase buffer (2 μL, New England Biolabs). The reaction

■

METHODS Strains and Plasmids. All the strains and plasmids used in this study are listed in Table 1. E. coli Mach1 T1 was used for all of the plasmid and library construction and as a host for the expression of the PHB production pathway. Plasmid pBHR68 [ColE1 (derivative) ori] and pSB3A3 (p15A ori) were modified H


Research Article

ACS Synthetic Biology mixture was treated according to the standard Golden Gate Reaction:33 5 min at 37 °C for enzyme digestion, 10 min at 16 °C for ligation, cycled 10 times, then heated to 37 °C for 15 min for a final digestion, 50 °C for 5 min, and then 80 °C for 5 min for its inactivation. Four microliters of the reaction solution was transformed into E. coli Mach1 T1 competent cells (Life Technologies) according to the manufacturer’s instructions. The cells were spread on LB-Glu solid medium with antibiotic for screening. Cells Staining with BODIPY Fluorescent Dye and Flow Cytometric Analysis. The pretreatment processes of cells for staining was modified from a previously reported protocol.18 After cultivation, the cultures were diluted 10 times to an OD600 of 0.6−1.0 and cooled on ice for 10 min. One milliliter of the cells was harvested by centrifugation (5 min, 3,000g, 4 °C) and resuspended in 1 mL of ice-code TSE buffer (10% (w/v) sucrose, 10 mM Tris−HCl (pH 7.5), and 2.5 mM Na−EDTA) and placed on ice for 10 min. After centrifugation (5 min, 3,000g, 4 °C) and resuspension in 1 mL of ice-cold H2O, 5 μL of BODIPY 493/503 fluorescent dye (Life Technologies) dissolved in DMSO (1 μg/μL) was added and mixed by vortexing. The mixtures were placed in the dark (5 min, room temperature) and then centrifuged (5 min, 3,000g, 4 °C) and washed twice with 1 mL of ice-cold H2O. The pretreated cells were measured using a BD LSRFortessa flow cytometer (BD Bioscience). BODIPY excitation was visible at 488 nm; the emission signals were captured on an FITC channel; all FITC, FSC (forward scatter), and SSC (side scatter) signals were recorded in the exponential mode using BD FACSDiva 8.0 software (BD Bioscience). A total of 300,000 events were analyzed. Cell Dry Weight, True Cell Mass, and PHB Content. After cultivation, 25 mL of cultures were harvested by centrifugation (10 min, 4,700g) and washed with H2O twice; the pellets were lyophilized overnight before measuring the CDW. Then, 30−50 mg of the lyophilized pellets and 20−30 mg of PHB standard sample (Sigma-Aldrich) were weighed and methanolyzed with benzoic acid as an internal standard. PHB content was determined via gas chromatography (GC-2014, Shimadzu, Japan) after methanolysis.34 The PHB content (wt %) was defined as the ratio of PHB concentration to CDW; the true cell mass was defined as the CDW minus PHB concentration. Transmission Electron Microscopy. One milliliter of culture was harvested via centrifugation (1 min, 10,000g) after cultivation and fixed in 2.5% (v/v) glutaraldehyde (4 h, 4 °C). After embedding samples in resin, resin sections of about 80 nm in thickness were cut using an ultramicrotome (Lecia, Germany) and examined under Hitachi H-7650B TEM (Hitachi, Japan) at the voltage of 80 kV. PHB Molecular Weight Studies. Intracellular PHB was extracted from lyophilized cells using chloroform, followed by precipitation using five times the volume of cold ethanol. The molecular weights of PHB were obtained via gel permeation chromatography (GPC) (Shimadzu, Japan) equipped with an Agilent PL gel 10 μm Mixed-B column (Agilent Technologies, US) and chloroform as solvent.35 Polystyrenes (Sigma-Aldrich, US) with different molecular weights were used as standard samples.

■

■

Primers used for RBS library construction (PDF) Structures of various vectors used for OLMA reactions and the procedure of OLMA reaction (PDF)

AUTHOR INFORMATION

Corresponding Authors

*(C.L.) E-mail: [email protected]. *(G.-Q.C.) E-mail: [email protected]. Author Contributions

L.T. and Y.J. contributed equally to this work. T.L., C.L., and G.Q.C. designed the research. T.L., Y.Z., and X.Z. performed the library design and construction. T.L., J.Y., and R.S. performed all of the other experiments and analyzed all data. T.L. and G.Q.C. wrote the article. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS We are grateful to the Center of Biomedical Analysis, Tsinghua University for the TEM studies. Plasmid pBHR68 was kindly donated by Professor Alexander Steinbüchel of Münster University in Germany. This research was financially supported by the National Natural Science Foundation of China (Grant nos. 31430003 and 31270146).

■

ABBREVIATIONS PHA, polyhydroxyalkanoates; PHB, poly(3-hydroxybutyrate); FI, fluorescence intensities; TEM, transmission electron microscopy; GC, gas chromatography; GPC, gel permeation chromatography; RBS, ribosomal binding sites; T.I.R., translation initiation rate; FACS, fluorescence-activated cell sorting

■

REFERENCES

(1) Wang, Y., Yin, J., and Chen, G.-Q. (2014) Polyhydroxyalkanoates, challenges and opportunities. Curr. Opin. Biotechnol. 30, 59−65. (2) Chen, G.-Q. Q. (2009) A microbial polyhydroxyalkanoates (PHA) based bio- and materials industry. Chem. Soc. Rev. 38, 2434−2446. (3) Sudesh, K., Abe, H., and Doi, Y. (2000) Synthesis, structure and properties of polyhydroxyalkanoates: biological polyesters. Prog. Polym. Sci. 25, 1503−1555. (4) Leong, Y. K., Show, P. L., Ooi, C. W., Ling, T. C., and Lan, J. C. (2014) Current trends in polyhydroxyalkanoates (PHAs) biosynthesis: insights from the recombinant Escherichia coli. J. Biotechnol. 180, 52−65. (5) Peña, C., Castillo, T., García, A., Millán, M., and Segura, D. (2014) Biotechnological strategies to improve production of microbial poly-(3hydroxybutyrate): a review of recent research work. Microb. Biotechnol. 7, 278−293. (6) Slater, S. C., Voige, W. H., and Dennis, D. E. (1988) Cloning and expression in Escherichia coli of the Alcaligenes eutrophus H16 poly-betahydroxybutyrate biosynthetic pathway. J. Bacteriol. 170, 4431−4436. (7) Li, T., Chen, X.-b. B., Chen, J.-c. C., Wu, Q., and Chen, G.-Q. Q. (2014) Open and continuous fermentation: products, conditions and bioprocess economy. Biotechnol. J. 9, 1503−1511. (8) Choi, J., and Lee, S. Y. (1999) Factors affecting the economics of polyhydroxyalkanoate production by bacterial fermentation. Appl. Microbiol. Biotechnol. 51, 13−21. (9) Jung, I. L., Phyo, K. H., Kim, K. C., Park, H. K., and Kim, I. G. (2005) Spontaneous liberation of intracellular polyhydroxybutyrate granules in Escherichia coli. Res. Microbiol. 156, 865−873. (10) Wang, F., and Lee, S. Y. (1998) High cell density culture of metabolically engineered Escherichia coli for the production of poly(3hydroxybutyrate) in a defined medium. Biotechnol. Bioeng. 58, 325−328. (11) Du, G., Chen, J., Yu, J., and Lun, S. (2001) Continuous production of poly-3-hydroxybutyrate by Ralstonia eutropha in a two-stage culture system. J. Biotechnol. 88, 59−65.

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acssynbio.6b00083. I


Research Article

ACS Synthetic Biology (12) Wang, F., and Lee, S. Y. (1997) Production of poly(3hydroxybutyrate) by fed-batch culture of filamentation-suppressed recombinant Escherichia coli. Appl. Environ. Microbiol. 63, 4765−4769. (13) Hiroe, A., Tsuge, K., Nomura, C. T., Itaya, M., and Tsuge, T. (2012) Rearrangement of gene order in the phaCAB operon leads to effective production of ultrahigh-molecular-weight poly[(R)-3-hydroxybutyrate] in genetically engineered Escherichia coli. Appl. Environ. Microbiol. 78, 3177−3184. (14) Agus, J., Kahar, P., Abe, H., Doi, Y., and Tsuge, T. (2006) Molecular weight characterization of poly[(R)-3-hydroxybutyrate] synthesized by genetically engineered strains of Escherichia coli. Polym. Degrad. Stab. 91, 1138−1146. (15) Farasat, I., Kushwaha, M., Collens, J., Easterbrook, M., Guido, M., and Salis, H. M. (2014) Efficient search, mapping, and optimization of multi-protein genetic systems in diverse bacteria. Mol. Syst. Biol. 10, 731. (16) Salis, H. M., Mirsky, E. A., and Voigt, C. A. (2009) Automated design of synthetic ribosome binding sites to control protein expression. Nat. Biotechnol. 27, 946−950. (17) Zhang, S., Zhao, X., Tao, Y., and Lou, C. (2015) A novel approach for metabolic pathway optimization: Oligo-linker mediated assembly (OLMA) method. J. Biol. Eng. 9, 23. (18) Lee, J. H., Lee, S. H., Yim, S. S., Kang, K. H., Lee, S. Y., Park, S. J., and Jeong, K. J. (2013) Quantified high-throughput screening of Escherichia coli producing poly(3-hydroxybutyrate) based on FACS. Appl. Biochem. Biotechnol. 170, 1767−1779. (19) Borujeni, A. E., Channarasappa, A. S., and Salis, H. M. (2014) Translation rate is controlled by coupled trade-offs between site accessibility, selective RNA unfolding and sliding at upstream standby sites. Nucleic Acids Res. 42, 2646−2659. (20) Sambrook, J., and Russell, D. (2001) Molecular Cloning: A Laboratory Manual. 2001, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. (21) Lee, S. Y., Yim, K. S., Chang, H. N., and Chang, Y. K. (1994) Construction of plasmids, estimation of plasmid stability, and use of stable plasmids for the production of poly(3-hydroxybutyric acid) by recombinant Escherichia coli. J. Biotechnol. 32, 203−211. (22) Potter, M., Madkour, M. H., Mayer, F., and Steinbuchel, A. (2002) Regulation of phasin expression and polyhydroxyalkanoate (PHA) granule formation in Ralstonia eutropha H16. Microbiology 148, 2413− 2426. (23) Summers, D. K., and Sherratt, D. J. (1984) Multimerization of high copy number plasmids causes instability: CoIE1 encodes a determinant essential for plasmid monomerization and stability. Cell 36, 1097−1103. (24) Choi, J.-i., and Lee, S. Y. (2004) High level production of supra molecular weight poly (3-hydroxybutyrate) by metabolically engineered Escherichia coli. Biotechnol. Bioprocess Eng. 9, 196−200. (25) Sznajder, A., Pfeiffer, D., and Jendrossek, D. (2015) Comparative proteome analysis reveals four novel polyhydroxybutyrate (PHB) granule-associated proteins in Ralstonia eutropha H16. Appl. Environ. Microbiol. 81, 1847−1858. (26) Pfeiffer, D., and Jendrossek, D. (2014) PhaM is the physiological activator of poly (3-hydroxybutyrate) (PHB) synthase (PhaC1). Ralstonia eutropha, Appl. Environ. Microbiol. 80, 555−563. (27) Jendrossek, D., Hermawan, S., Subedi, B., and Papageorgiou, A. C. (2013) Biochemical analysis and structure determination of Paucimonas lemoignei poly(3-hydroxybutyrate) (PHB) depolymerase PhaZ7 muteins reveal the PHB binding site and details of substrate-enzyme interactions. Mol. Microbiol. 90, 649−664. (28) Ning, Y., Wu, X., Zhang, C., Xu, Q., Chen, N., and Xie, X. (2016) Pathway construction and metabolic engineering for fermentative production of ectoine in Escherichia coli. Metab. Eng. 36, 10−18. (29) Schneider, J., Niermann, K., and Wendisch, V. F. (2011) Production of the amino acids l-glutamate, l-lysine, l-ornithine and larginine from arabinose by recombinant Corynebacterium glutamicum. J. Biotechnol. 154, 191−198. (30) Lin, H., Bennett, G. N., and San, K. Y. (2005) Metabolic engineering of aerobic succinate production systems in Escherichia coli to

improve process productivity and achieve the maximum theoretical succinate yield. Metab. Eng. 7, 116−127. (31) Xu, P., Gu, Q., Wang, W., Wong, L., Bower, A. G., Collins, C. H., and Koffas, M. A. (2013) Modular optimization of multi-gene pathways for fatty acids production in E. coli. Nat. Commun. 4, 1409. (32) Donova, M. V., and Egorova, O. V. (2012) Microbial steroid transformations: current state and prospects. Appl. Microbiol. Biotechnol. 94, 1423−1447. (33) Engler, C., Kandzia, R., and Marillonnet, S. (2008) A one pot, one step, precision cloning method with high throughput capability. PLoS One 3, e3647. (34) Braunegg, G., Sonnleitner, B., and Lafferty, R. M. (1978) A rapid gas chromatographic method for the determination of poly-βhydroxybutyric acid in microbial biomass. Eur. J. Appl. Microbiol. 6, 29−37. (35) Meng, D. C., Shi, Z. Y., Wu, L. P., Zhou, Q., Wu, Q., Chen, J. C., and Chen, G. Q. (2012) Production and characterization of poly(3hydroxypropionate-co-4-hydroxybutyrate) with fully controllable structures by recombinant Escherichia coli containing an engineered pathway. Metab. Eng. 14, 317−324. (36) Spiekermann, P., Rehm, B. H., Kalscheuer, R., Baumeister, D., and Steinbüchel, A. (1999) A sensitive, viable-colony staining method using Nile red for direct screening of bacteria that accumulate polyhydroxyalkanoic acids and other lipid storage compounds. Arch. Microbiol. 171, 73−80.

J


Semirational Approach for Ultrahigh Poly(3-hydroxybutyrate

Recommend Documents