Sensitive and Specific DNA Detection Based on Nicking

ARTICLE pubs.acs.org/JPCC

Sensitive and Specific DNA Detection Based on Nicking Endonuclease-Assisted Fluorescence Resonance Energy Transfer Amplification Liguang Xu, Yingyue Zhu, Wei Ma, Hua Kuang, Liqiang Liu, Libing Wang,* and Chuanlai Xu School of Food Science and Technology, State Key Lab of Food Science & Technology, Jiangnan University, Wuxi 214122, Jiangsu Province, China

bS Supporting Information ABSTRACT: We report a method for the detection of target DNA through nicking endonuclease (NEase)-assisted fluorescence resonance energy transfer (FRET) amplification. In this study, target DNA with specific recognition nucleotide sequences was used, which could be recognized by NEase. NEase has the sensitivity and specificity to recognize specific nucleotide sequences in double-stranded DNA (the hybridization of linker DNA and target DNA) and cleave only the linker DNA. The released target DNA could then trigger the cleavage of a large molar excess of linker DNA. The more the target DNA and the more the cleaved linker DNA, the less the FRET was induced by the linker DNA. The detection range of this method was found to range from 0.1 to 50 nM, and the limit of detection was 0.077 nM. On the basis of this technology, the interference of other mismatched target molecules could be effectively avoided; even a single-base mutation at the NEase recognition site could be detected. We therefore propose that NEase-assisted FRET, with some modifications, could have a variety of practical applications in the specific and sensitive detection of DNA.

1. INTRODUCTION Sensitive and selective DNA detection has become an increasingly important part of the investigations that lead to clinical diagnoses,1 and the detection of environmental contamination, security-relevant nucleic acids, and genetically modified foods. Numerous approaches have been explored for the detection of DNA. Conventional methods involve the use of molecularfluorophore-labeled nucleic acid probes,2 radioactive [32P]labeled nucleic acid probes,3 and polymerase chain reaction (PCR) and immunoassays.4 These approaches are relatively convenient and provide low detection limits, but they require relatively complex, costly equipment and complex handling procedures. They also run the risk of potential contamination. These drawbacks have, to some extent, limited the practical application of these procedures in resource-limited conditions. To overcome these problems, there is a real need for the development of a simple, sensitive, specific, and convenient homogeneous method for the detection of DNA. Fluorescence resonance energy transfer (FRET, also known as F€orster resonance energy transfer) is a feasible approach to improve the sensitivity and selectivity of DNA detection.58 FRET is a quantum mechanical process which relies on the distance-dependent transfer of energy from a donor to an acceptor through dipoledipole interactions without the emission of a photon.9 To obtain FRET efficiency, the following four conditions should be satisfied. First, the emission spectrum of the donor must overlap with the absorption spectrum of the acceptor. Second, the distance between the donor and the r 2011 American Chemical Society

acceptor must fall within the range of approximately 110 nm. Third, the emission transition dipole moment of the donor is oriented correctly with respect to the absorbance transition dipole moment of the acceptor. Fourthly, the donor should have a high quantum yield.10,11 Emission intensity-based FRET detection takes advantage of the FRET-induced increase in the fluorescence emission from the acceptor and the decrease in the fluorescence emission from the donor.12 The ratio of donor emission to directly excited acceptor emission could be used to evaluate the concentration of perfectly matched target DNA and other substrates.13 The principle behind FRET makes it an ideal technique to be applied to the development of a rapid, simple, sensitive method for the detection of DNA. In the past few years, quantum dots (QDs) have been successfully used as fluorophores for biological imaging and have also been widely used in the fields of chemistry and biomedical science due to their distinct optical characteristics.1418 Compared to the traditional organic fluorophores, QDs have the advantages of size-tunable photoluminescence spectra, broad absorption, narrow emission spectra, and high quantum yields.19,20 These photophysical properties of QDs permit the choice of a wide range of excitation wavelengths to directly excite the dye (acceptor), and narrow bandpass filters for the effective separation of the QDs and the fluorescent dye. In addition, Received: April 18, 2011 Revised: July 1, 2011 Published: July 15, 2011 16315

dx.doi.org/10.1021/jp2036263 | J. Phys. Chem. C 2011, 115, 16315–16321

The Journal of Physical Chemistry C

ARTICLE

Figure 1. Scheme of nicking endonuclease-assisted FRET amplification for the detection of DNA.

Zhang et al. found that single-QD-incorporated nanosensors could significantly reduce the background fluorescence and enhance energy-transfer efficiency. The characteristics of QDs make them as excellent donors for FRET-based sensors.21,22 Restriction endonucleases are commonly used to cleave double- or single-stranded DNA at specific nucleotide recognition sequences. Nicking endonuclease (NEase) is a specific type of restriction endonuclease that recognizes a particular nucleotide sequence in double-stranded DNA and cleaves only one specific strand of the double-stranded DNA.23,24 Recently, the single-stranded cleavage activities of NEase have been used to develop a sensitive method for detecting unique DNA sequences that contain a NEase recognition site.25 Although a high sensitivity of the target DNA could be achieved, some drawbacks exist using colorimetric DNA detection based on gold nanoparticles (GNPs): (1) The thiol-modified DNA requires the deprotection with some special procedure before GNPs conjugation. (2) It needs salt aging, sonication, and other procedures to boost the conjugation in the procedure of GNPs conjugation with thiolmodified ssDNA.26 (3) Thiol-modified DNA could bind with GNPs unspecifically and make GNPs easy to aggregate in the hybridization buffer, so this colorimetric method based on GNPs is easy to produce the false negative results.27,28 Therefore, in this study we used NEase signal amplification (NESA) for DNA detection using FRET. Here, we demonstrate a sensitive, simple, specific, homogeneous FRET sensor to detect DNA (Figure 1). Briefly, we choose CdTe QDs with an emission maximum at 537 nm as the donor and rhodamine B with an emission maximum at 583 nm as the acceptor in the FRET system. First, two different sets of oligonucleotides were conjugated with the QDs and rhodamine B to form the QD and rhodamine probes, respectively. In this study, the linker DNA, which is designed to be complementary to the target DNA, hybridizes to the target DNA. The target DNA contains a full recognition site for NEase. NEase recognizes specific nucleotide sequences in double-stranded DNA (hybridization of the target DNA and the linker DNA) and cleaves only the linker DNA. After cleavage, the fragments of the linker DNA spontaneously dissociate from the target DNA.

Subsequently, the released target DNA could then hybridize to another linker DNA and induce the second cycle of cleavage. Therefore, each target DNA could go through many cycles, resulting in the cleavage of a large molar excess of linkers. After denaturation of NEase, the QD probes and the rhodamine probes were added into this system. The probes could hybridize with the uncleaved linker DNA. The rhodamine B (acceptor) molecules could provide an efficient energy transfer channel to the QDs (donor). If the linker DNA is noncomplementary to the target DNA, FRET between QDs and rhodamine B will occur. Thus, we could therefore determine the amount of target DNA in the sample through detecting the FRET signal. This strategy provided a useful tool for monitoring genetically modified foods, for clinical diagnosis, and for the detection of security-relevant nucleic acid targets.

2. EXPERIMENTAL SECTION 2.1. Reagents and Instruments. Oligonucleotides used in this study were synthesized and purified using HPLC by Sangon Biotechnology Co., Ltd. (Shanghai, China). The sequence of DNA probes is shown in Table 1. The different target DNAs were resuspended to a concentration of 100 μM in ultrapure water. Nt.AlwI was purchased by New England Biolabs (Ipswich, MA), which could recognize a specific target DNA sequence (GATCC). Cadmium chloride (CdCl2 3 2.5H2O), tellurium powder (99.999%), 3-mercaptopropionic acid (MPA; >99%), sodium borohydride, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC), N-hydroxysuccinimide (NHS), and rhodamine B were all purchased from Sigma-Aldrich (St. Louis, MO). Milli-Q ultrapure water (18.2 MΩ) was used in all experiments. All other reagents were of analytical grade and were used as received. The absorbance spectra of the samples were acquired using a UNICO 2100 PC UV/vis/NIR spectrophotometer, and quartz cuvettes of an optical path length of 1 cm were used. The emission spectra of the samples were acquired using a RF-5301PC spectrofluorophotometer (Shimadzu, Japan) at ambient temperature (25 °C). 16316

dx.doi.org/10.1021/jp2036263 |J. Phys. Chem. C 2011, 115, 16315–16321


ARTICLE

Table 1. Sequences of Synthesized Oligonucleotidesa oligonucleotides linker DNA(24-mer)

a

sequence (50 to 30 )

modification

AAAGAATGGATCAAGAGGTCCTTC

target DNA(24-mer)

GAAGGACCTCTTGATCCATTCTTT

oligo 1(15-mer)

GATCCATTCTTTCTA

30 -labeled with amido group

oligo 2(15-mer)

CTAGAAGGACCTCTT

50 -labeled with amido group

oligo 3(24-mer)

GAAGGACCTCTTGATCGATTCTTT

oligo 4(24-mer)

GAAGGACCTCTTGATGCATTCTTT

oligo 5(24-mer)

GAAGGACCTCTTGAACCATTCTTT

oligo 6(30-mer)

TGTGAAGGACCTCTTGATCCAATCTTTCGC

The NEase recognition sites and mismatch positions of the target DNA are highlighted in boldface type and italic type, respectively.

2.2. Synthesis of the CdTe Quantum Dots. CdTe, with an emission maximum at 537 nm, was prepared according to our previously described procedure.14,15,29 Briefly, NaHTe aqueous solution was prepared by the reaction of NaBH4 (0.0480 g, 0.89 mM) with tellurium powder (0.0480 g, 0.375 mM) in 2.0 mL of water in an ice-bath. After the tellurium was completely reduced, the CdTe QDs were synthesized. First, 26 μL of 3-mercaptopropionic acid (MPA, 6 mM) was added to 50 mL of 2.0 mM CdCl2 solution, and the pH was adjusted to 9.0 by the addition of 1 M NaOH solution. The resulting clear solution was bubbled with nitrogen for ∼30 min. Then, 2.0 mL of freshly prepared NaHTe was vigorously mixed with the CdCl2MPA solution, and the mixture was transferred to a reactor. Finally, the reactor was heated to 160 °C for 40 min to obtain CdTe QDs with an emission maximum at 537 nm. 2.3. Preparation of the QD Probes. The carboxyl groups of the CdTe QDs were activated by 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) and N-hydroxysuccinimide (NHS) and linked with the amine group of DNA through the formation of an amide linkage.30,31 Briefly, 37 μL of Tris-HCl (pH 7.2, 10 mM) were mixed with the QD solution (10 μL). Then, 1.5 μL of 100 μM EDC and 1.5 μL of 150 μM NHS were added to the mixture. After activation for about 15 min, 5 μL of oligo 1 (30 -labeled with amido group, 100 μM) was added to the activated QD solution and allowed to react for 8 h at room temperature with gentle shaking. In order to remove the excess DNA, the QD probes were ultrafiltered by using Millipore’s Amicon Ultra centrifugal filter units with 10 000 molecular weight cutoff (3500 rpm for 15 min) and washed three times with the Tris-HCl buffer. The concentration of QD probes was measured according to the fluorescence method.3234 The procedure for calculating the concentration QD probes is described in the Supporting Information. The modified QDs were then stored in the dark at 4 °C prior to use. 2.4. Preparation of the Rhodamine B Probes. Rhodamine B was conjugated to oligo 2 in the presence of water-soluble EDC and NHS under the following conditions. In a typical experiment, 37 μL of Tris-HCl (pH 7.2, 10 mM) was mixed with the solution of rhodamine B (10 μL, 1.6 mM). Then, 5 μL of 2 mM EDC and 5 μL of 3 mM NHS were added to this mixture. After activation for about 15 min, 7 μL of oligo 2 (50 -labeled with amido group, 100 μM) was added to the activated rhodamine B solution and allowed to react for 8 h at room temperature. After the reaction, Millipore’s Amicon Ultra centrifugal filter units with 3000 molecular weight cutoff (5000 rpm for 20 min) were used to separate the free RB with the RB probes. After the ultrafiltration, the RB probes were washed three times with the Tris-HCl buffer. The concentration of rhodamine in the RB probes was calculated

according to the fluorescence method. The procedure for calculation of the concentration QD probes is described in the Supporting Information. The rhodamine probes were then stored at 4 °C prior to use. 2.5. Characterization of FRET in the CdTe QDLinker DNARB Conjugation. To further confirm that the observed FRET signal was due to specific DNA hybridization, four different molar ratios of QD and rhodamine B probes were mixed in PCR tubes in a final volume of 10 μL. Linker DNA (1.5 μL of 1 μM) was added to the solution and reacted at 58 °C for 5 min. Then, 10 μL of the resulting mixtures was diluted with 990 μL of Tris-HCl (pH 7.2, 10 mM) in a quartz cuvette (c = 1 cm). After equilibration at 25 °C for 2 min, the samples were analyzed twice using a spectrofluorophotometer. 2.6. DNA Detection Based on Nicking EndonucleaseAssisted FRET Amplification. In a typical procedure, 10 NEBuffer 2 (2 μL), a linker strand (1.5 μL, 1 μM), and a specified amount of target DNA were added to a PCR tubes in a final volume of 20 μL. Seven target DNA solutions at the following concentrations were tested: 0, 0.1, 1, 5, 10, and 50 nM. The different concentrations of target DNA were prepared by diluting the 100 μM solution of target DNA with ultrapure water. The NEase (1 μL, 20 units) was added to the solution after incubation at 58 °C. After 90-min incubation, NEase was denatured at 80 °C for 20 min. Then, 5 μL of the CdTe QDs and 5 μL of the rhodamine B probes were added and mixed by gentle shaking. After the mixture was allowed to stand at 58 °C for 5 min, 10 μL of the resulting mixtures was diluted with 990 μL Tris-HCl (pH 7.2, 10 mM) in a quartz cuvette (c = 1 cm). After equilibration at 25 °C for 2 min, the samples were analyzed twice using a spectrofluorophotometer. Each concentration was tested three times using the NEase-assisted FRET amplification procedure. 2.7. Specificity of Our DNA Detection Assay. To examine the selectivity of our assay for the detection of mismatched target DNA, we conducted a comparative study on two different types of target DNA strands from mismatched target DNA: one with a single-base mismatch at the NEase recognition site and one with additional sequences at the ends of mismatched target DNA. The different target DNA strands were used at a final concentration of 1 nM.

3. RESULTS AND DISCUSSION 3.1. Spectrum of Quantum Dots and Rhodamine B. The formation of MPA-modified CdTe QDs was confirmed by UVvisible absorption and fluorescence emission spectra. The sizes of the CdTe QDs and the concentrations of QD solutions were estimated from the first adsorption peaks in the UVvisible 16317



Figure 2. Normalized UVvis absorption and fluorescence emission spectra of rhodamine B and MPA-capped CdTe QDs.

Figure 3. Fluorescence spectra of the QDDNA conjugate after hybridization with rhodamine BDNA (RBDNA) at different molar ratios. The system was excited at the wavelength of 225 nm.

spectra and several empirical equations reported previously.35 The size of the CdTe QDs was about 2.27 nm, and the concentration of the quantum dots was about 10 μM. Greenemitting QDs (an emission maximum at 537 nm) were used as the energy donor in this study and were efficiently excited by a laser with a 225 nm emission. The absorption and fluorescence emission spectra of rhodamine B and MPA-capped CdTe QDs are shown in Figure 2. The significant overlap between the CdTe QD emission spectrum (excited by 225 nm) and the rhodamine B absorption spectrum allowed FRET to occur between the CdTe QDs and rhodamine B in the CdTe QDlinker DNA rhodamine B conjugation. The overlap between CdTe QDs (excited by 225 nm) and rhodamine B emission was only small, allowing effective separation. Therefore, rhodamine B emission could be observed, mainly due to energy transfer from CdTe QD to rhodamine B. 3.2. Characterization of FRET in the CdTe QDLinker DNARhodamine B Conjugation. As shown in Figure 3, there is minimal spectral cross-talk between CdTe QDs and rhodamine B emissions. Furthermore, the CdTe QDs had a broad absorption spectrum allowing for an excited wavelength at 200350 nm, which correlates with a low absorbance of rhodamine B; therefore,

ARTICLE

Figure 4. Emission spectra of nicking endonuclease-assisted FRET detection following the addition of the target DNA at different concentrations as shown in the inset. The ratio of quantum dots to rhodamine B was 1:150. The fluorescence intensity of the quantum dots at 537 nm increased while the fluorescence intensity of the rhodamine B molecules decreased. The system was excited at a wavelength of 225 nm.

a low signal-to-noise ratio could be obtained. As we know, the distance between the donor and the acceptor, within the range of approximately 110 nm, is the key parameter to ensure the FRET process. The length of 24-bases double-stranded DNA (linker DNA hybridization with two type probes) is about 8 nm.36 So, we chose the 24-mer single-stranded DNA as the target DNA and linker DNA. The numbers of the DNAs on every single quantum dot are about 3.1 according to the fluorescence method. Similarly, the concentration of RB probes is 12.3 μM. Figure 3 shows the variance of CdTe QD fluorescence and rhodamine B fluorescence as a function of the ratio of rhodamine B probes to CdTe QD probes. As the rhodamine B-labeled DNA to CdTe QD ratio increased, the CdTe QD fluorescence decreased, while the rhodamine B fluorescence increased, indicating the FRET between CdTe QDs and rhodamine B in the CdTe QDlinker DNArhodamine B conjugation. Furthermore, it confirmed that the CdTe QDs were the donor and rhodamine B was the acceptor in this FRET system. This experiment therefore confirmed that the observed FRET signal is indeed due to specific hybridization between the QDs and rhodamine B probes and the linker DNA. 3.3. Sensitive DNA Detection Using Nicking Endonuclease-Assisted FRET Amplification. FRET has been widely used in FRET imaging37 and therefore the development of biosensors.3840 In order to improve the sensitivity and specificity of DNA detection, we developed NEase-assisted FRET amplification. When the linker DNA and the target DNA were mixed in sample solution, the linker DNA hybridized to perfectly matched target DNA to form double-stranded DNA. The double-stranded DNA then contained a full recognition site for NEase. The NEase cleaved the linker DNA, and the released target DNA could then hybridize to other linker DNAs. As shown in Figure 1, NEase, which is sequence-dependent and “reused”, could be used to “recycle” the target DNA in each cycle, and the target DNA could therefore go through many cycles and result in the cleavage of a large molar excess of linker DNAs by NEase through repeated target-templated strand-scission cycles. So, it could lead to an improvement in the sensitivity relative to traditional fluorescence methods. After denaturation of NEase, 16318



Figure 5. A standard curve of the nicking endonuclease-assisted FRET signal versus different concentrations of DNA. The limit of detection of this method is 0.077 nM. Fdye/FQDs is the ratio of the fluorescence intensity of rhodamine B at 583 nm to that of the quantum dots at 537 nm.

the QDs and the rhodamine B probes could hybridize to uncleaved linker DNA. It is therefore possible to detect target DNA by determining a change in QD and rhodamine B fluorescence. Because of the sequence-specificity of this enzyme, we thus explored NEase to develop this detection method for the improvement of the sensitivity and specificity of target DNA detection. A competitive assay was carried out to detect target DNA under optimized conditions (data not shown). A standard solution of target DNA at a known concentration was used in the detection assay using a RF-5301PC spectrofluorophotometer. The rhodamine B fluorescence (an emission maximum at 583 nm) was excited by the CdTe QDs (an emission maximum at 537 nm) via energy-transfer under an excitation light fixed at 225 nm. Figure 4 shows the emission spectra of NEase-assisted FRET detection following the addition of the target DNA at different concentrations, as shown in the inset. The more the target DNA and the more the cleaved linker DNA, the less the FRET was triggered by the linker DNA conjugated to the QDs with rhodamine B. Hence, we found that the fluorescent intensity of the rhodamine B molecules decreased while the fluorescent intensity of the QDs increased due to the increased concentration of target DNA. Quantitative determination of the target DNA was also established based on changes in the fluorescence ratio (Fdye/ FQDs) within the range of 0.150 nM of DNA (Figure 5). Fdye and FQDs were the emission peaks of the rhodamine B molecules at 583 nm (acceptor), and the QDs at 537 nm (donor), respectively. The curve was fitted using linear regression analyses, with an origin of 7.5. Figure 5 indicates that the detection range of this method is from 0.1 to 50 nM, and the sensitivity for detection of target DNA is 0.077 nM. The sensitivity of detection of target DNA of about 0.077 nM was calculated as LOD = 3.3SD/S, where SD is the standard deviation of blank measurements (n = 10) and S is the slope of the calibration curve. More specifically, the calibration curve displayed excellent linearity with an R2 of 0.9853. The Fdye/FQDs ratio was dependent on the target DNA concentration. For an unknown concentration of sample, the concentration of the target DNA can be calculated from the following equation: Y = 0.75465 lg(X) + 2.52379, where X is the concentration of the sample and Y is the Fdye/FQDs ratio. Thus, the proposed method can be applied practically.

ARTICLE

Figure 6. Specificity of the developed method. Oligo 3, oligo 4, and oligo 5 are oligonucleotides with a single mismatch at different positions of the NEase recognition site. The length of oligo 6 (containing NEase recognition sites, 30 mer) is longer relative to that of the target DNA (24 mer).

3.4. The Specificity of Our DNA Detection Assay. To further validate the sequence-specificity of the detection system, we applied the assay to the detection of several different target DNA strands (Oligo 3, oligo 4, oligo 5, and oligo 6). The sequences of these target DNAs are shown in Table 1. These target DNAs comprised three single-stranded DNAs with single-base mutations at the NEase recognition site. Figure 6 shows the change in the Fdye/FQDs ratio upon addition of different target DNAs. Upon addition of a final concentration of 1 nM of the different target DNAs, the Fdye/FQDs ratio obtained with DNA containing the single-base mutation was twice as high as the Fdye/FQDs ratio with the perfectly matched target DNA. Therefore, the DNA strand containing the single-base mutation could inhibit the cleavage of the linker DNA. In all cases, the mismatched target DNA was quickly detected by FRET-based NEase signal amplification. Oligo 6 is longer relative to that of the complementary target DNA; thus, oligo 6 hybridized with linker DNA was relatively difficult than that of the complementary target DNA due to its intrinsic conformational flexibility in the solution.41 Because of the difference in the hybridized efficiency, the cleaved linker DNA with oligo 6 could be lower than that of the complementary target DNA; thus, the value of FRB/FQDs of oligo 6 could be higher than that of the complementary target DNA. The principle behind this detection assay is the recognition of different target DNAs by NEase, which can detect a single-base mismatch at the NEase recognition site. The sequence-specificity of NEase therefore improves the specificity of the detection assay. The novel DNA detection assay developed in this study therefore allows for highly specific target DNA determination, which may have a number of important practical applications.

4. CONCLUSION NEase has the sensitivity and specificity to recognize a particular nucleotide sequence in double-stranded DNA and cleave only one specific strand of the DNA. On the basis of this, we developed a rapid, sensitive, simple, specific, homogeneous NEase-assisted FRET sensor to detect target DNA. Our findings demonstrated the quantitative detection of target DNA within a detection range of 0.150 nM and a detection limit of 0.077 nM. The target DNA, which contained a single-base mismatch at the NEase recognition site, was successfully detected using this technology. Thus, our findings indicate that NEase-assisted FRET, with some modifications, could be used as a universal 16319


The Journal of Physical Chemistry C method and applied to clinical diagnosis and the detection of environmental contaminants, security-relevant nucleic acid targets, and genetically modified foods.

’ ASSOCIATED CONTENT

bS

Supporting Information. Additional detail on the characterization of QDs and RB probes. This material is available free of charge via the Internet at http://pubs.acs.org.

’ AUTHOR INFORMATION Corresponding Author

*E-mail: [email protected].

’ ACKNOWLEDGMENT This work is financially supported by the National Natural Science Foundation of China (21071066, 20835006, 91027038), the 11th Five Years Key Programs for Science and Technology Development of China (2010AA06Z302, 2008BAK41B03, 2009BAK61B04, 2010GB2C100167), and grants from Natural Science Foundation of Jiangsu Province, MOF and MOE (BK2010001, BK2010141, 2010DFB3047, JUSRP11019, 201110060, 201110016, 201110061). ’ REFERENCES (1) Wang, H.; Yeh, Y.-S.; Barbara, P. F. HIV-1 Nucleocapsid Protein Bends Double-Stranded Nucleic Acids. J. Am. Chem. Soc. 2009, 131 (42), 15534–15543. (2) Grossmann, T. N.; R€oglin, L.; Seitz, O. Triplex Molecular Beacons as Modular Probes for DNA Detection. Angew. Chem., Int. Ed. 2007, 46 (27), 5223–5225. (3) Valentine-Thon, E.; Steinmann, J.; Arnold, W. Detection of hepatitis B virus DNA in serum with nucleic acid probes labelled with 32P, biotin, alkaline phosphatase or Sulphone. Mol. Cell. Probes 1991, 5 (4), 299–305. (4) Wei, Q.; Lee, M.; Yu, X.; Lee, E. K.; Seong, G. H.; Choo, J.; Cho, Y. W. Development of an open sandwich fluoroimmunoassay based on fluorescence resonance energy transfer. Anal. Biochem. 2006, 358 (1), 31–37. (5) Li, M.; He, F.; Liao, Q.; Liu, J.; Xu, L.; Jiang, L.; Song, Y.; Wang, S.; Zhu, D. Ultrasensitive DNA Detection Using Photonic Crystals. Angew. Chem., Int. Ed. 2008, 47 (38), 7258–7262. (6) Talavera, E. M.; Bermejo, R.; Crovetto, L.; Orte, A.; Alvarez-Pez, J. M. Fluorescence Energy Transfer Between Fluorescein Label and DNA Intercalators to Detect Nucleic Acids Hybridization in Homogeneous Media. Appl. Spectrosc. 2003, 57, 208–215. (7) Algar, W.; Massey, M.; Krull, U. Fluorescence Resonance Energy Transfer and Complex Formation Between Thiazole Orange and Various Dye-DNA Conjugates: Implications in Signaling Nucleic Acid Hybridization. J. Fluoresc. 2006, 16 (4), 555–567. (8) Peng, H.; Zhang, L.; Kj€allman, T. H. M.; Soeller, C. DNA Hybridization Detection with Blue Luminescent Quantum Dots and Dye-Labeled Single-Stranded DNA. J. Am. Chem. Soc. 2007, 129 (11), 3048–3049. (9) Lee, J.; Govorov, A. O.; Kotov, N. A. Bioconjugated Superstructures of CdTe Nanowires and Nanoparticles: Multistep Cascade F€orster Resonance Energy Transfer and Energy Channeling. Nano Lett. 2005, 5 (10), 2063–2069. (10) Jares-Erijman, E. A.; Jovin, T. M. FRET imaging. Nat. Biotechnol. 2003, 21 (11), 1387–1395. (11) Wallrabe, H.; Periasamy, A. Imaging protein molecules using FRET and FLIM microscopy. Curr. Opin. Biotechnol. 2005, 16 (1), 19–27. (12) Selvin, P. R. The renaissance of fluorescence resonance energy transfer. Nat. Struct. Mol. Biol. 2000, 7 (9), 730–734.

ARTICLE

(13) Zhou, D.; Ying, L.; Hong, X.; Hall, E. A.; Abell, C.; Klenerman, D. A Compact Functional Quantum DotDNA Conjugate: Preparation, Hybridization, and Specific Label-Free DNA Detection. Langmuir 2008, 24 (5), 1659–1664. (14) Peng, C.; Li, Z.; Zhu, Y.; Chen, W.; Yuan, Y.; Liu, L.; Li, Q.; Xu, D.; Qiao, R.; Wang, L.; Zhu, S.; Jin, Z.; Xu, C. Simultaneous and sensitive determination of multiplex chemical residues based on multicolor quantum dot probes. Biosens. Bioelectron. 2009, 24 (12), 3657–3662. (15) Chen, W.; Xu, D.; Liu, L.; Peng, C.; Zhu, Y.; Ma, W.; Bian, A.; Li, Z.; Yuanyuan; Jin, Z.; Zhu, S.; Xu, C.; Wang, L. Ultrasensitive Detection of Trace Protein by Western Blot Based on POLY-Quantum Dot Probes. Anal. Chem. 2009, 81 (21), 9194–9198. (16) Rasnik, I.; McKinney, S. A.; Ha, T. Surfaces and Orientations: Much to FRET about?. Acc. Chem. Res. 2005, 38 (7), 542–548. (17) Liu, X.; Jiang, H.; Lei, J.; Ju, H. Anodic Electrochemiluminescence of CdTe Quantum Dots and Its Energy Transfer for Detection of Catechol Derivatives. Anal. Chem. 2007, 79 (21), 8055–8060. (18) Cui, R.; Pan, H.-C.; Zhu, J.-J.; Chen, H.-Y. Versatile Immunosensor Using CdTe Quantum Dots as Electrochemical and Fluorescent Labels. Anal. Chem. 2007, 79 (22), 8494–8501. (19) Feng, C. L.; Zhong, X. H.; Steinhart, M.; Caminade, A. M.; Majoral, J. P.; Knoll, W. Graded-Bandgap Quantum- Dot-Modified Nanotubes: A Sensitive Biosensor for Enhanced Detection of DNA Hybridization. Adv. Mater. 2007, 19 (15), 1933–1936. (20) Feng, C. L.; Zhong, X. H.; Steinhart, M.; Caminade, A.-M.; Majoral, J. P.; Knoll, W. Functional Quantum-Dot/Dendrimer Nanotubes for Sensitive Detection of DNA Hybridization. Small 2008, 4 (5), 566–571. (21) Zhang, C. Y.; Yeh, H. C.; Kuroki, M. T.; Wang, T. H. Singlequantum-dot-based DNA nanosensor. Nat. Mater. 2005, 4 (11), 826–831. (22) Shi, L.; De Paoli, V.; Rosenzweig, N.; Rosenzweig, Z. Synthesis and Application of Quantum Dots FRET-Based Protease Sensors. J. Am. Chem. Soc. 2006, 128 (32), 10378–10379. (23) Higgins, L. S.; Besnier, C.; Kong, H. The nicking endonuclease N.BstNBI is closely related to Type IIs restriction endonucleases MlyI and PleI. Nucleic Acids Res. 2001, 29 (12), 2492–2501. (24) Zuo, X.; Xia, F.; Xiao, Y.; Plaxco, K. W. Sensitive and Selective Amplified Fluorescence DNA Detection Based on Exonuclease III-Aided Target Recycling. J. Am. Chem. Soc. 2010, 132 (6), 1816–1818. (25) Xu, W.; Xue, X.; Li, T.; Zeng, H.; Liu, X. Ultrasensitive and Selective Colorimetric DNA Detection by Nicking Endonuclease Assisted Nanoparticle Amplification. Angew. Chem., Int. Ed. 2009, 48 (37), 6849–6852. (26) Hurst, S. J.; Lytton-Jean, A. K. R.; Mirkin, C. A. Maximizing DNA loading on a range of gold nanoparticle sizes. Anal. Chem. 2006, 78 (24), 8313–8318. (27) Li, H.; Rothberg, L. Colorimetric detection of DNA sequences based on electrostatic interactions with unmodified gold nanoparticles. Proc. Natl. Acad. Sci. U.S.A. 2004, 101 (39), 14036–14039. (28) Xu, L.; Zhu, Y.; Ma, W.; Chen, W.; Liu, L.; Kuang, H.; Wang, L.; Xu, C. New Synthesis Strategy for DNA Functional Gold Nanoparticles. J. Phys. Chem. C 2011, 115 (8), 3243–3249. (29) Chen, W.; Jiang, Y.; Ji, B.; Zhu, C.; Liu, L.; Peng, C.; Jin, M. K.; Qiao, R.; Jin, Z.; Wang, L.; Zhu, S.; Xu, C. Automated and ultrasensitive detection of methyl-3-quinoxaline-2-carboxylic acid by using gold nanoparticles probes SIA-rt-PCR. Biosens. Bioelectron. 2009, 24 (9), 2858–2863. (30) Chan, W. C. W.; Nie, S. Quantum Dot Bioconjugates for Ultrasensitive Nonisotopic Detection. Science 1998, 281 (5385), 2016–2018. (31) Selvan, S. T.; Tan, T. T. Y.; Yi, D. K.; Jana, N. R. Functional and Multifunctional Nanoparticles for Bioimaging and Biosensing. Langmuir 2009, 26 (14), 11631–11641. (32) Demers, L. M.; Mirkin, C. A.; Mucic, R. C.; Reynolds, R. A.; Letsinger, R. L.; Elghanian, R.; Viswanadham, G. A Fluorescence-Based Method for Determining the Surface Coverage and Hybridization Efficiency of Thiol-Capped Oligonucleotides Bound to Gold Thin Films and Nanoparticles. Anal. Chem. 2000, 72 (22), 5535–5541. 16320



ARTICLE

(33) Wang, L.; Chen, W.; Ma, W.; Liu, L.; Ma, W.; Zhao, Y.; Zhu, Y.; Xu, L.; Kuang, H.; Xu, C. Fluorescent strip sensor for rapid determination of toxins. Chem. Commun. 2011, 47 (5), 1574–1576. (34) Sun, D.; Gang, O. Binary heterogeneous superlattices assembled from quantum dots and gold nanoparticles with DNA. J. Am. Chem. Soc. 2011, 133 (14), 5252–5254. (35) Yu, W. W.; Qu, L.; Guo, W.; Peng, X. Experimental Determination of the Extinction Coefficient of CdTe, CdSe, and CdS Nanocrystals. Chem. Mater. 2003, 15 (14), 2854–2860. (36) Schallhorn, K. A.; Freedman, K. O.; Moore, J. M.; Lin, J.; Ke, P. C. Single-molecule DNA flexibility in the presence of base-pair mismatch. Appl. Phys. Lett. 2005, 87 (3), 033901–033903. (37) Medintz, I. L.; Uyeda, H. T.; Goldman, E. R.; Mattoussi, H. Quantum dot bioconjugates for imaging, labelling and sensing. Nat. Mater. 2005, 4 (6), 435–446. (38) Ai, H.-w.; Hazelwood, K. L.; Davidson, M. W.; Campbell, R. E. Fluorescent protein FRET pairs for ratiometric imaging of dual biosensors. Nat. Methods 2008, 5 (5), 401–403. (39) Lu, S.; Wang, Y. In Application of FRET biosensors and computational analysis for live cell imaging; Savitsky, A. P.; Wang, Y., Eds.; SPIE: San Jose, CA, 2009; pp 71910812. (40) Ko, S.; Grant, S. A. A novel FRET-based optical fiber biosensor for rapid detection of Salmonella typhimurium. Biosens. Bioelectron. 2006, 21 (7), 1283–1290. (41) Murphy, M. C.; Rasnik, I.; Cheng, W.; Lohman, T. M.; Ha, T. J. Probing single-stranded DNA conformational flexibility using fluorescence spectroscopy. Biophys. J. 2004, 86 (4), 2530–2537.

16321


Sensitive and Specific DNA Detection Based on Nicking

Recommend Documents