Silkworm Silk Matrices Coated with Functionalized Spider Silk

Jun 6, 2019 - Thatikonda, N.; Nilebäck, L.; Kempe, A.; Widhe, M.; Hedhammar, M. Bioactivation of spider silk with basic fibroblast growth factor for ...
0 downloads 0 Views 3MB Size
Download PDF
Article Cite This: ACS Biomater. Sci. Eng. 2019, 5, 3537−3548

pubs.acs.org/journal/abseba

Silkworm Silk Matrices Coated with Functionalized Spider Silk Accelerate Healing of Diabetic Wounds Dimple Chouhan,† Piyali Das,‡ Naresh Thatikonda,§ Samit K. Nandi,‡ My Hedhammar,*,§ and Biman B. Mandal*,†

Downloaded via BUFFALO STATE on July 24, 2019 at 15:01:31 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

†

Biomaterial and Tissue Engineering Laboratory, Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, Guwahati, Assam 781039, India ‡ Department of Veterinary Surgery and Radiology, West Bengal University of Animal and Fishery Sciences, Kolkata, West Bengal 700037, India § Department of Protein Science, School of Engineering Sciences in Chemistry, Biotechnology and Health, KTH Royal Institute of Technology, AlbaNova University Center, Stockholm 106 91, Sweden ABSTRACT: Complex cutaneous wounds like diabetic foot ulcers represent a critical clinical challenge and demand a large-scale and lowcost strategy for effective treatment. Herein, we use a rabbit animal model to investigate efficacy of bioactive wound dressings made up of silk biomaterials. Nanofibrous mats of Antheraea assama silkworm silk fibroin (AaSF) are coated with various recombinant spider silk fusion proteins through silk−silk interactions to fabricate multifunctional wound dressings. Two different types of spider silk coatings are used to compare their healing efficiency: FN-4RepCT (contains a cell binding motif derived from fibronectin) and Lac-4RepCT (contains a cationic antimicrobial peptide from lactoferricin). AaSF mats coated with spider silk show accelerated wound healing properties in comparison to the uncoated mats. Among the spider silk coated variants, dual coating of FN-4RepCT and Lac-4RepCT on top of AaSF mat demonstrated better wound healing efficiency, followed by FN-4RepCT and Lac-4RepCT single coated counterparts. The in vivo study also reveals excellent skin regeneration by the functionalized silk dressings in comparison to commercially used Duoderm dressing and untreated wounds. The spider silk coatings demonstrate early granulation tissue development, re-epithelialization, and efficient matrix remodelling of wounds. The results thus validate potential of bioactive silk matrices in faster repair of diabetic wounds. KEYWORDS: silk fibroin, recombinant spider silk, nanofibrous mat, wound healing, diabetic wounds

■

INTRODUCTION

Diabetic wounds are difficult to manage owing to an extreme level of wound chronicity, hyperglycemia, and bacterial infection.6 The complex and dynamic process of wound healing fails in such wounds due to cell senescence and persistent inflammation.6 Fibroblasts and blood capillaries fail to invade the wound site, preventing development of a contractile granulation tissue.7 Extensive research is being carried out in the field of tissue engineering to enhance the cell migration and cell adherence through functional biomaterials.8 Such biomaterials should confer a physical connection between cells and material and also mediate biochemical signals controlling cell growth, proliferation, and migration.9 The matrix should not only provide mechanical support but also be conducive to rapidly recruit host cells and thereby guide the tissue regeneration. Therefore, development of acellular constructs,

Skin, the largest organ of our body, acts as a protective physical barrier against the outside environment and harmful chemicals.1 Skin injuries impose a great threat to the health of patients, as the body is exposed to harsh external environment and deadly pathogens. Diabetic patients often suffer from chronic cutaneous wounds due to pathophysiological conditions like neuropathy and abnormal cellular activity. Unlike acute wounds, which are healed by the self-repair mechanism of skin tissue, chronic wounds fail to heal by themselves and wound chronicity progresses with time unless treated in an efficient way. Diabetic foot ulcer (DFU) is a major complication for diabetic patients, and the wound chronicity often ends up with the necessity of limb amputation surgeries.2 More than 6 million people are suffering from chronic cutaneous ulcers, and 85% of the limb amputation surgeries are due to DFU.3,4 Despite a variety of available treatments, diabetic wound healing is still a great challenge due to the poor clinical outcomes.5 Toward this goal, we aim to develop bioactive matrices that accelerate the healing process of diabetic wounds. © 2019 American Chemical Society

Received: April 13, 2019 Accepted: June 6, 2019 Published: June 6, 2019 3537

DOI: 10.1021/acsbiomaterials.9b00514 ACS Biomater. Sci. Eng. 2019, 5, 3537−3548

Article

ACS Biomaterials Science & Engineering

validated our hypothesis and provided suitable treatment regimes for diabetic foot ulcers at an affordable cost.

which mimic the attributes of wound provisional matrix, is very challenging. In normal wounds, a fibrin clot is formed temporarily at the wound-site that acts as a natural provisional matrix for cellular recruitment. The clot is composed of fibrin in conjugation with fibronectin, which supports cell adhesion, spreading, and proliferation through its cell binding motifs.10 To mimic the cell binding ability of fibronectin, we have developed a recombinantly produced spider silk protein 4RepCT (4RC) conjugated with bioactive motifs. 4RC is a partial dragline silk protein derived from the spider Euprosthenops australis and produced recombinantly via Escherichia coli bacterial system.11,12 4RC and its various silk fusion proteins have an inherent self-assembling property, making them a suitable component for matrix fabrication.13,14 The silk fusion protein utilized in the present study is FN-4RC, which contains the RGD cell binding motif from fibronectin (FN) and thereby holds integrin mediated cell binding properties.14 FN-4RC has previously shown excellent binding of various cells like fibroblasts, keratinocytes, and endothelial cells.14 FN-4RC has also shown better and comparable cell adhesion and proliferation results in comparison to recombinant RGD proteins and natural fibronectin proteins, respectively.14 Further, to combat the bacterial infections, similar recombinant technology was applied to incorporate an antimicrobial motif from lactoferrin to yield Lac-4RC spider silk fusion protein.15,16 Both FN-4RC and Lac-4RC fusion proteins were selected to deliver multifunctional active domains to the final dressing patch. As a proof of concept, we have previously shown efficient use of functionalized spider silk proteins in the form of a thin coating on top of biocompatible bulk substrate made up of silk fibroin (SF) biomaterial.16,17 A bulk material of SF was required because production of a complete construct using spider silk proteins requires high amounts of the recombinant protein, which make the procedure expensive. SF matrices, with favorable biocompatibility and biodegradable properties, can easily be functionalized with bioactivate spider silk fusion proteins owing to the inherent silk−silk interactions.17 In addition, SF is a cost-effective natural biomaterial for which large scale production is feasible owing to the sericulture industries.18,19 In our recent study, we fabricated such bioactive silk matrices that hold cues for higher cell adhesion and rapid cellular recruitment. We developed interactive biomaterials by coating functionalized spider silk proteins on SF matrices, thereby making the procedure inexpensive.16 In our previous work, we examined interactions of spider silk fusion proteins with matrices made of two types of SF proteins, namely, Bombyx mori SF (BmSF) and Antheraea assama SF (AaSF).17 The study revealed enhanced interaction of 4RC with the AaSF matrices in comparison to BmSF matrices as examined through various physical and biological assays.17 Therefore, in the present study, we used only A. assama silk fibroin (AaSF) based mats as bulk material and coated the nanofibrous mats with spider silk fusion proteins to develop bioactive matrices for wound healing applications. Observations obtained under the previous in vitro study provided us evidence about the efficacy of the developed composite materials.16 In this work, we hypothesized that the functionalized silk wound dressings would have a promising wound healing impact on difficult to heal injuries like diabetic wounds. The present study reports angiogenic and faster wound healing effects achieved by the silkworm silk mats coated with bioactive spider silk fusion proteins. The results of this study

■

MATERIALS AND METHODS

Isolation of Antheraea assama Silk Fibroin (AaSF). To isolate AaSF, fifth instar A. assama silkworms procured from local sericulture farms of Assam in India were sacrificed. AaSF was directly isolated from the silk glands of larva according to previously described protocol.20,21 Protein was carefully extracted out from the glands using forceps. The isolated silk protein was gently washed multiple times and then dissolved in 1% (w/v) sodium dodecyl sulfate (SDS) (Himedia, India) aqueous solution. Subsequently, the dissolved silk solution was dialyzed against double distilled water using a 12 kDa cellulose dialysis membrane (Sigma-Aldrich, USA) for 4−5 h at 4 °C with frequent water change after every hour. The aqueous solution of AaSF thus obtained was 3% (w/v), as measured by the gravimetric method. Fabrication of AaSF Nanofibrous Mats. Silk based nanofibrous mats were fabricated as previously established.16 Solutions of AaSF (3% w/v) and poly(vinyl alcohol) (PVA) (13% w/v; procured from LobaChemiePvt. Ltd., India) were blended in equal volume to achieve a ratio of 4:1 (PVA/SF) (w/w) with an optimum viscosity for electrospinning to obtain smooth nanofibrous mat. Following parameters were applied to the electrospinning instrument (E-spin nanotech, India) to ensure electrospinning of an AaSF-PVA blend solution: voltage = 25 ± 3 kV, flow rate = 0.800 ± 0.100 mL/h, tip to collector distance (d) = 15 cm, and rotating speed of drum collector = 500 rpm. Subsequently, β-sheet in the AaSF electrospun mat was induced by incubating it in 70% ethanol (EtOH) for 2 h. The nanofibrous mat thus fabricated was washed four to five times with sterile water to remove residual ethanol. To further sterilize, the nanofibrous mat was placed under ultraviolet (UV) lamp for 20−30 min prior to coating process. Coating of AaSF Dressings with Recombinant Spider Silk Proteins. Two types of recombinant spider silk fusion proteins were used to coat the SF nanofibrous mats, namely, FN-4RC (cell-binding motif with the sequence TGRGDSPA from fibronectin fused to 4RepCT) and Lac-4RC (antimicrobial motif of lactoferrin with the sequence FKCRRWQWRMKKLG fused to 4RepCT). Both the recombinant spider silk fusion proteins were provided from Spiber Technologies AB, Sweden. The recombinant proteins were diluted in 20 mM Tris, pH 8.0 to obtain 0.1 mg/mL solutions prior to their coating. Dip coating method was performed, wherein the pre-wet AaSF nanofibrous mats were dipped into spider silk solution and incubated at room temperature for 1 h. Subsequently, the spider silk solution was removed, and nanofibrous mats were washed with Tris buffer twice. The coated mats were stored in wet conditions at 4 °C prior to application on the wounds. In Vivo Study Design in Diabetic Animal Model and Treatment with Nanofibrous Mat Dressing. The animal experiments on diabetic animal model were performed in accordance with ‘‘Principles of laboratory animal care” from the Institutional Animal Ethical Committee (IAEC), West Bengal University of Animal and Fishery Sciences (WBUAFS), West Bengal, India (Permit No. Pharma/ IAEC/136 dated 30.6.2014). The New Zealand white healthy rabbits (1.5−1.8 kg) were acclimatized 1 week prior to study. Diabetic conditions were induced in all the animals using Alloxan based treatment following the standard protocol.22,23 Briefly, acepromazine (1 mL/kg) was administered subcutaneously to sedate the rabbits, and hair at the back of their ears was shaved off. A required dose of Alloxan in 30 mL of saline (Sigma-aldrich, USA) (150 mg/kg) was subsequently administered at a rate of 1.5 mL/min via ear vein. Following the alloxan treatment, rabbits were given water containing glucose (12 g/L) for a period of 48 h to ensure induction of diabetes condition. Diabetes disease in the animals was confirmed by checking the blood glucose using test strips and meter (Accuchek_test advantage meter, Accuchek_advantage II strips, Roche Diagnostics, U.K.). Alloxan-treated rabbits with blood glucose level more than 300 mg/dL were considered as diabetic or hyperglycemic animals in comparison to the normal healthy rabbits (glucose level 120−150 mg/dL). The diabetic 3538

DOI: 10.1021/acsbiomaterials.9b00514 ACS Biomater. Sci. Eng. 2019, 5, 3537−3548

Article

ACS Biomaterials Science & Engineering condition of rabbits was monitored for a period of 4 weeks prior to commencing the wound healing experiment. The animals were then randomized into three groups for time points (day 7, day 14, and day 21). For anesthesia, animals were given a cocktail dose of saline containing xylazine hydrochloride (6 mg/kg) (Xylaxin, Indian Immunologicals, India) and ketamine hydrochloride (33 mg/kg) (Ketalar, Parke-Davis, India) while the experiment was performed. During the wound creation process, proper aseptic conditions were taken, and hair of mid thoraco-lumbar region of dorsal surface was shaved off. Skin was wiped with 70% ethanol, and full thickness wounds were created using a biopsy punch of 12 mm diameter. A total number of 36 animals were used in the study, and six wounds were created in each rabbit corresponding to each treatment: (1) uncoated AaSF mat, (2) AaSF-FN (mat coated with FN-4RC), (3) AaSF-Lac (mat coated with Lac-4RC), (4) AaSF-FN-Lac (mat coated with both FN-4RC and Lac-4RC), (5) positive control group taken as commercially available Duoderm wound dressing (DD), and (6) untreated group (UNT). The Duoderm dressing (ConvaTec Duoderm extra thin CGF dressing) used in the study was procured from Ortho Care Pvt. Ltd. via Amazon online store (https://www.amazon.com). Meloxicam (Melonex, Intas-Polivet, India) (0.2 mg/kg) was given as analgesic postsurgery for three consecutive days. All the dressing patches were replaced with fresh ones after every 3 days until 12 days postoperation. Glucose level of all the animals was monitored regularly and found to be in the range of 300 to 350 mg/dL throughout the study. No abnormality was found during the surgery or postoperation, and animals were separately placed in individual cages. Wound Healing Estimation. Wound healing efficacy of various treatments was evaluated by measuring the wound size of diabetic wounds. Photographs of the wounds taken periodically were analyzed using ImageJ software, which measured the wound diameter and wound area. The following formula was used to calculate the wound closure:

The sections were rehydrated prior to incubating in blocking serum for 30 min at RT. Subsequently, primary antibodies were applied on the sections for 1 h at 37 °C. The sections were then incubated with biotinylated universal secondary antibody. After washing, the ABC reagent containing avidin-horseradish peroxidase was applied to the section and incubated for 30 min at RT. Finally, peroxidase substrate 3,3′- diaminobenzidine (DAB) reagent was applied, which developed a brown reaction product. The sections were then counterstained with hematoxylin to stain nuclei and incubated for 15 min prior to dehydration and mounting. To examine matrix remodeling, the sections of healed tissues collected on day 21 were analyzed following the similar process using monoclonal primary antibody against collagen type I (Col I) and collagen type I (Col III) procured from Abcam, U.K. The images were taken using the bright field microscope. qRT-PCR Analysis. To determine the gene expression of ECM related proteins, skin biopsies were collected on specific time points, namely, day 7, 14, and 21, and preserved in −20 °C using RNA later (Sigma-Aldrich, USA). The tissue was homogenized in TRIzol reagent (Sigma-Aldrich, USA), and mRNA was isolated following the standard protocol. Briefly, the homogenized tissues were incubated with TRIzol reagent for 30 min at RT and centrifuged at 13 000 rpm for 10 min in 4 °C. mRNA was collected from the supernatant obtained. Subsequently, chloroform was added to the mRNA containing solution and centrifuged at 13 000 rpm for 15 min at 4 °C. The upper aqueous phase was collected in fresh tube, which contained mRNA and then treated with isopropanol. The mixture was then centrifuged again and mRNA pellet was obtained. The mRNA was further dissolved in RNAase free water and concentration of mRNA was measured. Complementary DNA (cDNA) was synthesized using reverse transcription kit (Applied Biosystems, USA) and PCR equipment (Takara, Japan) according to the manufacturer’s instructions. Real-time PCR reactions were performed on the obtained cDNA using SYBR Green PCR Mastermix (Applied Biosystems, USA). Primers listed in Table 1

Wound area (%) = A t /A × 100

Table 1. Primer Sequences Used for the Gene Expression Study

Where At was the area of wound at time (t) and A was the wound area at the time of wound creation. Histological Study. Histological examination was performed by collecting the skin biopsies at predefined time points, namely, day 7, 14, and 21 postwounding. The biopsies of healing tissues were washed with sterile saline and preserved using 10% neutral buffer formalin (NBF; Sigma-Aldrich USA). Subsequently, the tissue samples were washed with sterile water 4−5 times and dehydrated using a series of graded ethanol. The dehydrated samples were then embedded in hot paraffin wax and blocks were made. Sections of 5−10 μm thickness were prepared using tissue microtome (Leica) and put on glass slides. The sections were stained with hematoxylin and eosin (HE) according to the manufacturer’s protocol. General morphological observations of the wounded tissue were carried out by microscopic analysis using bright field microscope (EVOS FL, Life technologies, USA). Immunofluorescence Staining. Similar types of paraffin embedded tissue sections (5−7 μm) prepared from skin biopsies were used for immunofluorescence study. Briefly, the sections were rehydrated using series of graded ethanol and permeabilized with 0.1% Triton X-100 in PBS for 10 min. Subsequently, blocking was done using 1% bovine serum albumin (BSA) by incubating for 1 h. The sections were then incubated with specific primary antibody for 1 h at 37 °C. Angiogenesis in the healed tissues (from the biopsies collected on day 7) was determined by staining the sections using anti-CD 31 procured from Abcam, U.K. As secondary antibody, goat antirat IgG conjugated with Phycoerythrin (Sigma-Aldrich, USA) was used. Counter staining of nuclei was done by Hoechst 33342 (Invitrogen, USA). Images were taken using a fluorescent microscope (EVOS FL, Life technologies, USA). Subsequently, calculation of vessel density was performed by counting the CD31+ blood vessels in five different locations per section. Average vessel density was quantified by considering four sections obtained from the wound biopsies of each group. Immunohistochemistry (IHC) Assay. The tissue sections made from the skin biopsies were further analyzed by IHC. Evaluation of cytokeratin 10 (CK 10) and cytokeratin 14 (CK 14) was performed using IHC kit (Vectastain Elite Universal ABC kit, Vectors lab, U.K.).

target gene

primer sequence

rabbit GAPDH

F 5′−TCGGCATTGTGGAGGGGCTC −3′ R 5′−TCCCGTTCAGCTCGGGGATG −3′ F 5′−CCTGGCACCCCAGGTCCTCA −3′ R 5′−TCGCTCCCAGGGTTGCCATC −3′ F 5′−AAGCCCCAGCAGAAAATTG −3′ R 5′−TGGTGGAACAGCAAAAATCA −3′

rabbit Col-I rabbit Col-III

were used for examining the gene expressions. The expression of collagen type I, collagen type III, and glyceraldehyde-3-phosphatedehydrogenase (GAPDH) mRNA transcripts was analyzed. The average threshold cycle (Ct) value of a gene of interest (GOI) obtained after the real time reaction was normalized against that of GAPDH gene. Further, fold change of GOI transcript levels between the sample groups were compared with control (untreated group) following the standard formula.24 Fold change of the specific sample relative to the control (untreated group here) was calculated as fold change = 2−ΔΔCt , where ΔΔCt = ΔCt(sample) − ΔCt(control) and ΔCt = Ct(GOI) − Ct(GAPDH) Statistical Analysis. All the in vivo experiments were performed for n = 4 animals on each time point. Quantitative data were expressed as mean ± standard deviation as calculated by Microsoft Excel. Further data analysis was carried out using statistical software Origin 9.0 (Origin lab Corporation, USA) at both significant (∗ p ≤ 0.05) and highly significant (∗∗ p ≤ 0.01) levels. The data between groups and within groups were compared at significance level by performing one-way analysis of variance (ANOVA) followed by Tukey’s test. 3539

DOI: 10.1021/acsbiomaterials.9b00514 ACS Biomater. Sci. Eng. 2019, 5, 3537−3548

Article

ACS Biomaterials Science & Engineering

Figure 1. Schematic representation of the experimental design depicting (a) methodology to fabricate bioactive silk dressings by coating spider silk fusion proteins on top of SF nanofibrous mats and (b) strategy of treating cutaneous wounds in a diabetic rabbit model using silk dressings; diabetes condition was established for 28 days prior to wounding, dressing was changed every 3rd day until day 12, and groups were terminated on day 7, 14, and 21 as represented by (T) in the image.

Figure 2. (a) Representative gross images of wounds showing wound morphology by different treatments at various time-points during the course of diabetic wound healing; scale bar = 10 mm; (b) graphical representation of wound area at various time-points calculated using ImageJ software demonstrating wound closure rate by different treatments, ∗∗ represents p ≤ 0.01.

■

RESULTS

such as high water absorption capacity, good water vapor transmission rate (2000−2500 g m−2 day−1), long-term integral stability (negligible mass loss in nonproteolytic solution and 30−35% mass loss in highly proteolytic solution), sufficient stretchability (316.12 ± 33.24% elongation at break and 15.35 ± 0.8 MPa tensile strength), nanofiber diameter ranging from 50− 250 nm, large surface area to volume ratio, and highly porous structures (pore size