Silver Nanowire-Based Fluorescence Thermometer for a Single Cell

Subscriber access provided by Kaohsiung Medical University

Functional Nanostructured Materials (including low-D carbon)

Silver nanowires-based fluorescence thermometer for single cell Congcong Bu, Lixuan Mu, Xingxing Cao, Min Chen, Guangwei She, and Wensheng Shi ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.8b09696 • Publication Date (Web): 06 Sep 2018 Downloaded from http://pubs.acs.org on September 6, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Silver nanowires-based fluorescence thermometer for single cell Congcong Bu,a,b Lixuan Mu,*a Xingxing Cao, a,b Min Chen, a,b Guangwei Shea and Wensheng Shi*a,b a

Key Laboratory of Photochemical Conversion and Optoelectronic Materials, Technical Institute of Physics and Chemistry, Chinese Academy of Sciences, Beijing 100190, China. E-mail: [email protected]; [email protected]; Fax:+86-10-82543513; Tel: +86-10-82543513 b

University of Chinese Academy of Sciences, Beijing 100049, China

ABSTRACT A fluorescence thermometer based on silver nanowires (AgNWs) is realized by assembling Texas Red (TR) marked thermal sensitive DNA stem-loop (TR-DNA stem-loop) on the surface of AgNWs. Temperature configures the structure of the TR-DNA stem-loop and resultantly adjusts the energy transfer between TR and the AgNWs, which could sensitively control the fluorescence intensity of the thermometer. The thermometer is sensitive in the temperature range from 30 ℃ to 40 ℃ with the sensitivity 2.6%/℃. Under an assistance of laser confocal microscopy, a temperature change within the single cell was observed by the monofilament AgNW-based thermometer.

KEY WORDS: Silver nanowires; thermometer; fluorescence; DNA stem-loop; single cell

ACS Paragon Plus Environment

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 24

INTRODUCTION It is known that numerous biochemical processes occur at the microsystems or cells.1 The temperature always plays a critical role in determining the direction and rate of these processes.2 Measuring the temperature of the various locations within the microsystems or cells with high accuracy and spatial resolution is significant for understanding the biochemical processes.3,4 However, as low spatial resolution, the common thermometer such as thermal coupling is not quite adequate to accurately measure the temperature in a cell size.5,6 Benefitting from the development of nanomaterials and nanotechnology, nano-scale thermometers with high sensitivity and spatial resolution can be prospective.7 The nanoparticles have been developed as nano-sized thermometers for the measurement of the cell temperature.8,9 However, in order

to

determine

the

intracellular

temperature,

the

nanoparticles-based

thermometers have to be passively penetrated into the cell by endocytosis. Moreover, the entered nanoparticles would move unceasingly and couldn’t stay at the desired location of cell for a long time. Such situation would be unfavorable for a continuous and steady observation of one nanoparticle, specific location and biochemical processes occurring within the cell.10 Due to the micrometer scale longitudinal dimension, nanowires are readily observed under a microscope and can be immobile at a desired location of the cell.11-13 Furthermore, nanowire could be positively insert into the specific location of cell by micro manipulation.14 Utilizing the nanowires as substrate to assemble nano-sized thermometer would be an alternative strategy to steadily measure the intracellular temperature with high spatial resolution. Among various nanowires, AgNWs with easy preparation and good biocompatibility could be


Page 3 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


utilized as a candidate substrate for the nanowire-based thermometer.15-18 While, it is known that the configuration of DNA stem-loop is sensitively responsive to the temperature.19,20 By linking fluorescence molecule and quencher respectively onto the two endpoints of the DNA stem-loop, a DNA-based thermometer with high sensitivity and biocompatibility could be fabricated. In this work, the TR as fluorescence molecule was covalently decorated on one endpoint of the DNA stem-loop, and the other endpoint was anchored onto the surface of the AgNWs to form the thermometer (TR-DNA-AgNWs). This thermometer concurrently owns the advantages of the AgNWs and DNA-based thermometer. At a low temperature, the DNA stem-loop is closed cycle structure and the TR linked at one endpoint of the DNA stem-loop is close to the surface of the AgNWs. In this configuration, the AgNWs could play the role of the quencher to availably restrain the fluorescence emission from the TR. Oppositely, the TR-DNA stem-loop could be gradually unfolded and the distance between the TR and surface of the AgNWs was enlarged as the increase of temperature. As a result, the quenched fluorescence of the TR could be effectively recovered due to the inhibition of the energy transfer from the TR to the AgNWs. It was found that the present thermometer owns a high sensitivity of 2.6%/°C in the range from 30 °C to 40 °C. Furthermore, based on the monofilament TR-DNA-AgNW thermometer, the temperature variation of single cell can be observed. EXPERIMENTAL SECTION Materials and Instruments



The oligonucleotides were synthesized and further purified through HPLC by Sangon Biotech Co., Ltd (Shanghai, China). The oligonucleotide stock solutions (100 µM) were prepared using a tris-EDTA buffer solution (pH = 8.0) and stored at 4 ℃. Silver nitrates, Polyvinylpyrrolidone (PVP-K30), ferric chloride, ethylene glycol, acetone ethanol, monosodium phosphate, dipotassium phosphate, sodium chloride, acetic acid, sodium acetate were all purchased from Beijing Chemical Reagent Company (Beijing, China). Triscarboxyethylphosphine (TCEP) was purchased from Aladdin Co., Ltd (Shanghai, China). Phosphate buffered saline (PBS, NaCl 137 mmol/L, KCl 2.7 mmol/L, Na2HPO4 10 mmol/L, KH2PO4 2 mmol/L, pH=7.4) and tris-EDTA buffer were purchased from Beijing Solarbio Science ＆ Technology Co., Ltd (Beijing, China). Phosphate buffer (PB) was prepared without NaCl. The HeLa cell line was purchased from the cell culture center of the Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences (Beijing, China). Hoechst 33342 was purchased from Beyotime Biotech Co., Ltd (Beijing, China). 3-Dulbecco’s Modified Eagle’s Medium (DMEM) was obtained from the Invitrogen Corporation. Cell counting kit-8 assay (CCK-8) were purchased from Beyotime Institute of Biothechnology. a. OligoTR of different lengths (TR-DNA stem-loop): 15T loop: 5’-TR-ATCTAATCATTATTGTTTTTTTTTTTTTTTACTATTATGTTTAGATTTT TTTTTTT - (CH2)3-SH-3’ 30T loop:


Page 4 of 24

Page 5 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


5’-TR-ATCTAATCATTATTGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTACTATT ATGTTTAGATTTTTTTTTTT - (CH2)3-SH-3’ 45T loop: 5’-TR-ATCTAATCATTATTGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTACTATTATGTTTAGAT TTTTTTTTTT - (CH2)3-SH-3’ b.

OligoT (helper strand)：5’-TTTTTTTTTT- (CH2)3 -SH-3’

Preparation of AgNWs AgNWs were prepared by modified polyol process.21-22 Under a vigorous stirring, 10 ml ethylene glycol solution containing of 165 mg PVP-K30 and 0.81mg FeCl3 were dropwise added into 10 ml AgNO3 (170 mg) ethylene glycol solution. When it became turbid, the solution was transferred to a sealed Teflon reactor. The reactor was heated to 160 oC and kept at this temperature for 3 h. After cooled to the room temperature, the products were repeatedly washed with acetone/ethanol and centrifuged to obtain the AgNWs. The obtained AgNWs were conserved in ethanol for further use. Scanning electron microscope (SEM) and transmission electron microscope (TEM) images of the AgNWs were obtained from the HITACHI S-4800 and JEOL JEM-2100, respectively. Assembly of the TR-DNA stem-loop on the surface of the AgNWs to form the thermometer (TR-DNA-AgNWs) To cleave S-S bond in oligonucleotides, the OligoTR (20 µL, 100 µM) and OligoT (10 µL, 100 µM）were incubated with TECP (reduction agent) in acetate buffer (pH 5.2) for 1 h. The reduced oligoTR and oligoT were mixed with AgNWs (2 mg/ml), the



concentrations of oligoTR and oligoT were 2 µM and 1 µM, respectively. After incubation for 12 h, 3 M NaCl was added into the system to reach 0.3 M NaCl and the system was incubated for 12 h again. To remove the excess TR-DNA stem-loop, the product was centrifuged and washed three times with PB buffer. Then the TR-DNA-AgNWs were dispersed in PBS buffer for further characterization. All data were obtained from TR-DNA-AgNWs containing 15T loop unless otherwise stated. Characterization of the TR-DNA-AgNWs The fluorescence spectra of TR-DNA-AgNWs and TR-DNA stem-loops were collected from F4600 fluorophorometer equipped with temperature controller and stirrer. The fluorescence emission spectra were collected from 600 nm to 700 nm with 580 nm as excitation wavelength. The lifetime was collected from EDINBURGH FLS980 with temperature controller. Cytotoxicity Assay of TR-DNA-AgNWs HeLa cells were firstly seeded to a 96-well plate with the density of 5 × 103 per well and cultured in the Dulbecco’s modified eagle medium (DMEM) at 37 °C for 24 h. Then, TR-DNA-AgNWs with different concentrations were added to each well, which were incubated with the cells for 24 h. After the incubation, the cells were washed thrice with PBS. Then, cell counting kit-8 (CCK-8) solutions (10% in DMEM, v/v) were added to obtain the value of cell viability. All experiments were performed in triplicate. Confocal Laser Scanning Microscopy (CLSM) Observation The TR-DNA-AgNWs were diluted with PBS buffer and put into a confocal


Page 6 of 24

Page 7 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


microscope dish to image the variation of the fluorescence intensity of monofilament TR-DNA-AgNW with temperature. The HeLa cells were cultured in a confocal microscope dish in DMEM media at 37 ºC in a humidified atmosphere containing 5% CO2 for 24 h for cell attachment. HeLa cells were first treated with 5 µL TR-DNA-AgNWs in DMEM media for 12 h in advance. Then 1 µL Hoechst 33342 (5 mg/ml) was added. After 10 min, the cells were washed with PBS for 5 times before imaging. The TR-DNA-AgNWs in PBS buffer as well as the HeLa cells treated with TR-DNA-AgNWs were imaged using a confocal microscopy (Nikon A1) with an oil 100× objective lens, 405 nm and 560 nm lasers. The temperatures of the sample were controlled by a stage top incubator equipped with four types of heaters (stage, water bath, top cover, and lens heaters) and feedback from a thermocouple. RESULTS AND DISCUSSIONS The SEM and TEM images of AgNWs are shown in Figure 1. From Figure 1, it can be found that the diameter of the AgNWs is 80-150 nm and its length is more than 40 µm. The X ray photoelectron energy spectrum（XPS）is employed to characterize the modification of the AgNWs with the TR-DNA stem-loop. As shown in Figure 2, the data verified that there are almost no P atoms on the surface of the unmodified AgNWs, while the AgNWs that are modified with TR-DNA stem-loops have the characteristic peak of P (133.4 ev, 2p). It is well known that DNA contains P, so the emergence of P atoms demonstrates the TR-DNA stem-loops have been successfully assembled on the surface of the AgNWs.



Figure 1 (a) SEM image and (b) TEM image of AgNWs.

Figure 2 XPS of AgNWs and TR-DNA- AgNWs (P2p).

To investigate the response of the TR-DNA-AgNWs to temperature, the fluorescence spectra of the TR-DNA-AgNWs were investigated under various temperatures (Figure 3a). The dependences of the normalized fluorescence intensity on the temperature were shown in Figure 3b. It can be found that the fluorescence intensity of TR-DNA-AgNWs gradually increased with temperature elevating. Further when the temperature of system was oppositely reduced, the fluorescence intensity gradually decreased. As comparison, the relationship between the fluorescence intensity of the TR-DNA stem-loop and temperature was also measured.


Page 8 of 24

Page 9 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The slightly decreased fluorescence intensities of the TR-DNA stem-loop were observed in the range of 20 oC to 50 oC (Figure 3c). These results demonstrated that the modulation of fluorescence intensity of the TR-DNA-AgNWs is determined by the interaction of AgNWs and TR-DNA stem-loop.

Figure 3 (a) The fluorescence spectra of the TR-DNA-AgNWs under the excitation of 580 nm at various temperature. (b) The dependence of the normalized fluorescence intensity on the temperature. (c) Normalized fluorescence intensity of TR-DNA stem-loop under different temperature.



In order to clarify the mechanism of response of the TR-DNA-AgNWs to the temperature, the fluorescence decays of TR in the TR-DNA stem-loop and TR-DNA-AgNWs were investigated under different temperature and the results are shown in Figure 4. It can be found that, at 20 oC, the lifetime of the TR fluorescence was sharply reduced after the TR-DNA stem-loops were assembled onto the surface of AgNWs (Figure 4a). This observation reveals that energy transfer between AgNWs and TR fluorescence molecule occurred.23 Figure 4a Inset provides the fluorescence lifetimes of the TR in the TR-DNA stem-loop and TR-DNA-AgNWs under the different temperature. It can be found that the fluorescence lifetime of the TR in TR-DNA-AgNWs was gradually prolonged with temperature elevating. However, the fluorescence lifetimes of the TR in the TR-DNA stem-loop slightly decreased when temperature increased, which is from the activation enhancement of the non-radiative transition by the elevation of the temperature.24 Based on the fluorescence lifetimes, the efficiencies of the energy transfer under the different temperature could be calculated according to the equation η = 1-τ/τ0,25 where η is the efficiency of the energy transfer, τ0 and τ are the fluorescence lifetimes of the TR before and after the TR-DNA stem-loops assembled on the surface of AgNWs. As showed in Figure 4b, the efficiencies of the energy transfer are gradually reduced from 86% to 56% as the increase of the temperature from 20 oC to 50 oC, with the distance between TR and AgNWs from 3.4 nm to 19.4 nm calculated according to the literature.26


Page 10 of 24

Page 11 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4 (a) The fluorescence decay curves of TR in TR-DNA stem-loops and TR-DNA-AgNWs at 20 oC. Inset: Lifetimes of TR in TR-DNA stem-loops and TR-DNA-AgNWs under different temperature.

(b) Efficiency of energy transfer

between TR and AgNWs in TR-DNA-AgNWs according to η = 1-τ/τ0. Increasing the temperature could gradually extend the TR-DNA stem-loops on the surface of the AgNWs and the distance between the TR and AgNWs was resultantly increased. Such increase would lower the efficiency of the energy transfer from the TR to the AgNWs and recover the fluorescence emission from the TR. The rationale of the thermometer was shown in Scheme 1. The TR-DNA stem-loop is closed cycle state at low temperature and the TR is close to the surface of the AgNWs. In this status, the energy transfer between the AgNWs and TR occurs and the fluorescence emission from TR would be quenched. When the temperature is elevated, the TR-DNA stem-loop is at open cycle state. The TR is away from the surface of the



AgNWs and the efficiency of the energy transfer is brought down. The fluorescence of the TR-DNA -AgNWs is recovered.

Scheme 1 Rationale of TR-DNA-AgNWs response to temperature.

In rationale, lengthening the DNA sequence could inhibit energy transfer more efficiently in an open cycle state and improve the response to temperature. We prepared TR-DNA-AgNWs with different lengths of DNA sequences containing 15T, 30T, 45T loop and investigated the energy transfer efficiency. Efficiencies of the energy transfer is listed in the Table S1. As we anticipated, the energy transfer efficiency is actually decreased in open cycle state when the DNA sequence is lengthened. However, it was found that the energy transfer efficiency in closed cycle state also decreased. This unproleptic phenomenon might be attributed to second structure of a longer sequence which affects the energy transfer efficiency in closed cycle state. And the DNA sequence containing 45T is still 40% efficiency of energy transfer in open cycle state, which reveals that the longest sequence howbeit is in the quenching range. It has been reported the distance of energy transfer was enhanced to 70 nm-100 nm when the Au or Ag nanoparticle were used as energy transfer


Page 12 of 24

Page 13 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


acceptor.27. The ideal length in open cycle state is 19nm, 24nm, 29nm for DNA sequences containing 15T, 30T, 45T loop, respectively. The length is in the range of energy transfer distance less than 70 nm. Moreover, the DNA sequences in open cycle state are not entirely extended in actual. These reasons determine the energy transfer is not entirely inhibited. In comparison, the TR-DNA-AgNWs containing 15T loop owns better properties. Therefore, we further investigated the response of TR-DNA-AgNWs containing 15T loop to temperature. In order to use TR-DNA-AgNWs as a thermometer, a refined dependence of the TR-DNA-AgNWs on the temperature was investigated from 30 oC to 40 oC. As shown in Figure 5a, a linear relationship between the fluorescence intensity and the temperature (left axis) as well as the calculated temperature resolutions (right axis) were presented. It can be found that present thermometer owns a sensitivity of 2.6%/oC and a temperature resolution of about 0.5oC calculated according to literature,28 which is similar to the previously reported (Table S2). The result of the thermal cycle testing was showed in Figure 5b. After 3 cycles, an insignificant fluctuation of the fluorescence intensity was observed at the equal temperature, which revealed the favorable reversibility of present thermometer. The stability of the thermometer in various ionic strength and pH was further investigated and the results were shown in Figure 5c and Figure 5d. As the increase of the NaCl concentration, the sensitive interval of the thermometer exhibits a shift to the high temperature. The shift of response curve with the variation in the NaCl concentration is attributed to electrostatic repulsions between PO4- anions in DNA sequence. After NaCl is added in



the solution, Na+ could partially compensate negative electron of PO4- and decrease the repulsive force. Therefore, the melting temperature of the DNA sequence is elevated. So the response curve is shifted with the NaCl concentration. But the shape of the curves remains constant (Figure 5c). Moreover, the TR-DNA-AgNWs nearly exhibit a consistent performance at the pH of 7.0, 7.4, 8.0 and 9.0 (Figure 5d). And the protein (10% BSA) on the dependence of the normalized fluorescence intensity on the temperature are also investigated and the results are shown in the Figure 5e. BSA have little influence on the response of TR-DNA-AgNWs to temperature. The relative fluorescence intensity of TR-DNA-AgNWs with different metal ions has little change in Figure 5f. These results demonstrated that the thermometer owns favorable stability and anti-interferences ability.


Page 14 of 24

Page 15 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure5 (a) The linear response of relative fluorescence intensity of TR-DNA-AgNWs to temperature (left axis, square points) as well as the calculated temperature resolutions (right axis, triangle points). (b) The relative fluorescence intensity of TR-DNA-AgNWs with heating-cooling cycles at 20 oC and 50 oC. The dependence of the normalized fluorescence intensity on the temperature with (c) various concentrations of NaCl (0.1M, 0.2M, 0.3M); (d) different pH situations (pH = 7.0, 7.4, 8.0 and 9.0); (e) 0.01 M PBS buffer containing 0 or 10% BSA. (f) the relative fluorescence intensity of TR-DNA-AgNWs with 50µM different metal ions: 1. Blank,



2. Na+, 3. K+, 4. Mg2+, 5. Ca2+, 6. Cu2+, 7. Ni2+, 8. Mn2+, 9. Fe3+, 10. Zn2+, 11. Co2+, 12. Ag+.

The monofilament TR-DNA-AgNW as thermometer was investigated in PBS buffer. The Figure 6a shows the bright field image of the monofilament TR-DNA-AgNW at the room temperature and the Figure 6b-d show the fluorescent images of the monofilament TR-DNA-AgNW at different temperature (30 oC, 35 oC, 40 oC). It can be observed that the fluorescence images of the monofilament TR-DNA-AgNW gradually brightened with temperature increasing. The integrated fluorescence intensities scanned from the point S to the point E in Figure 6b-d were measured. As shown in Figure 6e, the integrated fluorescence intensity of the monofilament TR-DNA-AgNW gradually increased with the same trend in TR-DNA-AgNWs suspension solution when the temperature was elevated. For further application of TR-DNA-AgNWs in cells, we investigate the cytotoxicity of TR-DNA-AgNWs with the CKK-8 method and the results are shown in Figure 7. The viability of HeLa cells is 94% after incubation for 24h with 0.1mg/mL TR-DNA-AgNWs. These results showed that the TR-DNA-AgNWs is low-cytotoxic in low concentration.


Page 16 of 24

Page 17 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6 (a) The bright field image of the monofilament TR-DNA-AgNW at the room temperature. (b), (c), (d) The images of monofilament TR-DNA -AgNW with confocal fluorescence microscopy under different temperature, (b) 30 oC, (c) 35 oC, (d) 40 oC, 560 nm laser as excitation. Scale bar, 5 µm. (e) Normalized integrated fluorescence intensity of monofilament TR-DNA-AgNW scanning from the point S to the point E in (b), (c) and (d). The error bars are obtained by selecting different locations of point S and point E on the monofilament TR-DNA-AgNW three times (black

line)

and

by

triplicate

measurements

of

different

monofilament

TR-DNA-AgNWs (red line).

Figure 7 HeLa cell viability after treated with TR-DNA-AgNWs for 24 h. The viability of the control cells was considered 100%. All error bars represent the standard deviation determined from three independent assays.



To realize the temperature detection of a single cell, the HeLa cells were incubated with the TR-DNA-AgNWs and its cell nucleus were stained with the Hoechst dye. As shown in Figure 8a, the TR-DNA-AgNWs has penetrated into the HeLa cells after co-incubation for 12 h. Figure 8b and Figure 8c show the fluorescent images of the cells with monofilament TR-DNA-AgNW at 26 oC and 38 oC, respectively. The blue emission from cell nucleus and red emission from monofilament TR-DNA-AgNW were observed from both images. It can be found that the fluorescence intensities of the cell nucleus have hardly changed. However the fluorescence intensities of the monofilament TR-DNA-AgNW increased after raising the temperature. The integrated fluorescence intensities scanned from the point S to the point E in Figure 8b and 8c were also measured. As shown in Figure 8d, the integrated fluorescence intensity increased by approximately 35% when temperature increased from 26 oC to 38 oC. Compared with the suspension solution, there is an enhancement effect in the cell, probably because the intracellular environment is different from the solution. So for the next step we need to calibrate in different cell lines for more accurate results.

Figure 8 (a) The bright field image of the monofilament TR-DNA-AgNW in a HeLa


Page 18 of 24

Page 19 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


cell at the room temperature. (b and c) The fluorescence images of monofilament TR-DNA-AgNW in a HeLa cell at (b) 26 oC,

(c) 38 oC, 405 nm and 560 nm laser as

excitation. Scale bar, 5 µm. (d) Normalized integrated fluorescence intensity of monofilament TR-DNA-AgNW scanning from the point S to the point E in (b) and (c). The error bars is obtained by selecting different location of point S and point E three times.

CONCLUSIONS In conclusion, the AgNWs-based thermometer was constructed by assembling TR marked DNA stem-loop onto the surface of the AgNWs.

The temperature response

is achieved by configuration of DNA stem-loop under different temperature adjusting energy transfer between AgNWs and TR molecules. The thermometer has a good linear response to temperature from 30 oC to 40 oC which covers the range of psychological temperature. The monofilament TR-DNA-AgNW thermometer is successfully applied to observe temperature variation of a single cell. The thermometer presented here would offer a new method for temperature detection in single cell, which may be extendable to other sensors for intracellular specific targets. ASSOCIATED CONTENT Supporting Information Efficiency of energy transfer between TR and AgNWs in TR-DNA-AgNWs; comparison of different thermometers



Page 20 of 24

AUTHOR INFORMATION Corresponding Author Email: [email protected], [email protected]

ORCID Lixuan Mu: 0000-0002-6613-5368 Wensheng Shi: 0000-0001-5747-4862

Notes The authors declare no competing financial interest.

ACKNOWLEDGEMENTS This

work

was

supported

by

National

Key

R&D

Program

of

China

(2016YFA0200800); NSFC (51672284); Beijing Natural Science Foundation (2181002);

Chinese

Academy

of

Sciences

(1A1111KYSB20180017,

QYZDJ-SSW-JSC032, XDB17000000).

REFERENCES (1) Higgins, A. Z.; Karlsson, J. O. M. Effects of Intercellular Junction Protein Expression on Intracellular Ice Formation in Mouse Insulinoma Cells. Biophys. J.

2013, 105, 2006-2015. (2) Lowell, B. B.; Spiegelman, B. M. Towards a Molecular Understanding of Adaptive Thermogenesis. Nature 2000, 404, 652-660. (3) Albers, A. E.; Chan, E. M.; McBride, P. M.; Ajo-Franklin, C. M.; Cohen, B. E.; Helms, B. A. Dual-Emitting Quantum Dot/Quantum Rod-Based Nanothermometers with Enhanced Response and Sensitivity in Live Cells. J. Am. Chem. Soc. 2012, 134, 9565-9568. (4) Vetrone, F.; Naccache, R.; Zamarron, A.; Juarranz de la Fuente, A.; Sanz-Rodriguez, F.; Martinez Maestro, L.; Martin Rodriguez, E.; Jaque, D.; Garcia


Page 21 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Sole,

J.;

Capobianco,

J.

A.

Temperature

Sensing

Using

Fluorescent

Nanothermometers. ACS Nano 2010, 4, 3254-3258. (5) Jaque, D.; del Rosal, B.; Martin Rodriguez, E.; Martinez Maestro, L.; Haro-Gonzalez, P.; Garcia Sole, J. Fluorescent Nanothermometers for Intracellular Thermal Sensing. Nanomedicine 2014, 9, 1047-1062. (6) Brites, C. D. S.; Lima, P. P.; Silva, N. J. O.; Millan, A.; Amaral, V. S.; Palacio, F.; Carlos, L. D. Thermometry at the Nanoscale. Nanoscale 2012, 4, 4799-4829. (7) Bai, T.; Gu, N. Micro/Nanoscale Thermometry for Cellular Thermal Sensing.

Small 2016, 12, 4590-610. (8) Walker, G. W.; Sundar, V. C.; Rudzinski, C. M.; Wun, A. W.; Bawendi, M. G.; Nocera, D. G. Quantum-Dot Optical Temperature Probes. Appl. Phys. Lett. 2003, 83, 3555-3557. (9) Yu, P.; Wen, X.; Toh, Y.-R.; Tang, J. Temperature-Dependent Fluorescence in Au10 Nanoclusters. J Phys. Chem. C 2012, 116, 6567-6571. (10) Takei, Y.; Arai, S.; Murata, A.; Takabayashi, M.; Oyama, K.; Ishiwata, S. i.; Takeoka, S.; Suzuki, M. A Nanoparticle-Based Ratiometric and Self-Calibrated Fluorescent Thermometer for Single Living Cells. ACS Nano 2014, 8, 198-206. (11) Gao, Y.; Longenbach, T.; Vitol, E. A.; Orynbayeva, Z.; Friedman, G.; Gogotsi, Y. One-Dimensional Nanoprobes for Single-Cell Studies. Nanomedicine 2014, 9, 153-168. (12) Miao, R.; Mu,L.X.; Zhang, H.Y.; Xu, H. T.; Zhou, B. J.; She, G. W.; Wang, P. F.; Shi, W. S. Facile Method for Modification of the Silicon Nanowires and Its Application in Fabrication of pH-Sensitive Chips. ACS Appl. Mater. Interfaces 2013,

5, 1741−1746. (13)Yuan, H.; Lu, Y.; Wang, Z.; Ren, Z.; Wang, Y.; Zhang, S.; Zhang, X.; Chen, J. Single Nanoporous Gold Nanowire as a Tunable One-Dimensional Platform for Plasmon-Enhanced Fluorescence. Chem. Commun. 2016, 52, 1808-1811. (14) Lu G.; De Keeramaecker H.; Su L.; Kenens B.; Rocha S.; Fron E.; Chen C.; Van Dorpe P.; Mizuno H.; Hofkens J.; Hutchison J. A.; Uji-I H. Live ‐ Cell SERS Endoscopy Using Plasmonic Nanowire Waveguides. Adv. Mater. 2014, 26, ACS Paragon Plus Environment


Page 22 of 24

5124-5128. (15) Xia, Y.; Xiong, Y.; Lim, B.; Skrabalak, S. E. Shape-Controlled Synthesis of Metal Nanocrystals: Simple Chemistry Meets Complex Physics? Angew. Chem. Inter.

Ed. 2009, 48, 60-103. (16) Sun, Y. Silver Nanowires - Unique Templates for Functional Nanostructures.

Nanoscale 2010, 2, 1626-1642. (17) Wei, Y.; Chen, S. L. ; Li, F. C.; Lin, Y.; Zhang, Y.; Liu, L. Highly Stable and Sensitive Paper-Based Bending Sensor Using Silver Nanowires/Layered Double Hydroxides Hybrids. ACS Appl. Mater. Interfaces 2015, 7, 14182−14191. (18) Mandal, B.; Rameshbabu, A. P.; Soni, S. R.; Ghosh, A.; Dhara, S.; Pal, S. In Situ Silver Nanowire Deposited Cross-Linked Carboxymethyl Cellulose: A Potential Transdermal Anticancer Drug Carrier. ACS Appl. Mater. Interfaces 2017, 9, 36583−36595. (19) Chen, C.; Wang, W.; Wang, Z.; Wei, F.; Zhao, X. S. Influence of Secondary Structure on Kinetics and Reaction Mechanism of DNA Hybridization. Nucleic Acids

Res. 2007, 35, 2875-2884. (20) Owczarzy, R. Melting Temperatures of Nucleic Acids: Discrepancies in Analysis.

Biophys. Chem. 2005, 117, 207-15. (21) Sun, Y. G.; Gates, B.; Mayers, B.; Xia, Y. N. Crystalline Silver Nanowires by Soft Solution Processing. Nano Lett. 2002, 2, 165-168. (22) Piatkowski, D.; Hartmann, N.; Macabelli, T.; Nyk, M.; Mackowski, S.; Hartschuh,

A.

Silver

Nanowires

as Receiving-Radiating

Nanoantennas

in

Plasmon-Enhanced Up-Conversion Processes. Nanoscale 2015, 7, 1479-1484. (23) Clapp, A. R.; Medintz, I. L.; Mattoussi, H. Forster Resonance Energy Transfer Investigations Using Quantum-Dot Fluorophores. Chemphyschem 2006, 7, 47-57. (24) Huang, H.; Li, H.; Wang, A. J.; Zhong, S. X.; Fang, K. M.; Feng, J. J. Green Synthesis of Peptide-Templated Fluorescent Copper Nanoclusters for Temperature Sensing and Cellular Imaging. Analyst 2014, 139, 6536-41. (25) Biju, V.; Itoh, T.; Baba, Y.; Ishikawa, M. Quenching of Photoluminescence in Conjugates of Quantum Dots and Single-Walled Carbon Nanotube. J Phys. Chem. B ACS Paragon Plus Environment

Page 23 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2006, 110, 26068-26074. (26) Xie, J.; Jiang, X. X.; Zhong, Y. L.; Lu, Y. M.; Wang, S. Y.; Wei, X. P.; Su, Y. Y.; He, Y. Stem-Loop DNA-Assisted Silicon Nanowires-Based Biochemical Sensors with Ultra-High Sensitivity, Specificity, and Multiplexing Capability. Nanoscale 2014, 6, 9215-9222. (27) Ray, P. C.; Fortner, A.; Darbha, G. K. Gold Nanoparticle Based FRET Assay for the Detection of DNA Cleavage. J Phys. Chem. B 2006, 110, 20745-20748. (28) Uchiyama, S.; Tsuji, T.; Ikado, K.; Yoshida, A.; Kawamoto,K.; Hayashic, T.; Inada, N. A Cationic Fluorescent Polymeric Thermometer for the Ratiometric Sensing of Intracellular Temperature. Analyst 2015, 140, 4498–4506.



TOC


Page 24 of 24

Silver Nanowire-Based Fluorescence Thermometer for a Single Cell

Recommend Documents