Simultaneous Inhibition of Tumor Growth and Angiogenesis for

Feb 4, 2014 - downregulation of the survivin protein, and cause remarkable cell arrest and cell ... and inhibit tumor growth and angiogenesis in HCC b...
0 downloads 0 Views 2MB Size
Download PDF
Article pubs.acs.org/molecularpharmaceutics

Simultaneous Inhibition of Tumor Growth and Angiogenesis for Resistant Hepatocellular Carcinoma by Co-delivery of Sorafenib and Survivin Small Hairpin RNA Jianan Shen,† Huiping Sun,†,‡ Qingshuo Meng,† Qi Yin,† Zhiwen Zhang,† Haijun Yu,† and Yaping Li*,† †

Center of Pharmaceutics, Shanghai Institute of Materia Medica, Chinese Academy of Sciences, Shanghai 201203, China School of Pharmacy, Shenyang Pharmaceutical University, Shenyang 110016, China

‡

ABSTRACT: The development of multidrug resistance (MDR) in human hepatocellular carcinoma (HCC) is one of the major obstacles for successful chemotherapy of HCC. Codelivery of sorafenib (SF) and survivin shRNA (shSur) was postulated to achieve synergistic effects in reversing MDR, suppressing tumor growth and angiogenesis. For this purpose, in this work, SF and shSur co-loaded pluronic P85polyethyleneimine/D-α-tocopheryl polyethylene glycol 1000 succinate nanocomplexes (SSNs) were first designed and developed for the treatment of drug resistant HCC. The experimental results showed that SSNs could achieve effective cellular internalization and shSur transfection efficiency, induce significant downregulation of the survivin protein, and cause remarkable cell arrest and cell apoptosis. The tube formulation assay demonstrated that SSNs completely disrupted the enclosed capillary networks formed by human microvascular endothelial cells. The in vivo antitumor efficacy showed that SSNs were superior to that of other treatments on drug resistant hepatocellular tumor models. Therefore, it could be an efficient strategy to co-deliver SF and shSur for therapy of drug resistant HCC. KEYWORDS: sorafenib, survivin shRNA, co-delivery, hepatocellular carcinoma, multidrug resistance

■

INTRODUCTION Hepatocellular carcinoma (HCC), one of the most common malignancies, is the third leading cause of cancer deaths worldwide.1 The number of estimated new cases is >500000 annually,2 and the majority of patients with HCC die within 1 year of diagnosis.3 Besides, HCC is often found at a late stage when the potentially curative therapies, such as chemotherapy, chemoembolization, ablation, and proton beam therapy, have weak effects.4 Obviously, finding a new therapeutic strategy for HCC is urgent. Antiangiogenesis therapies, which inhibit blood vessel formation, could hold promise for the treatment of HCC because the development of HCC depends on a rich blood supply.5 Sorafenib (SF), which could simultaneously block tumor cell proliferation and angiogenesis, could result in an obvious increase in the rate of survival of patients with advanced HCC6 and induce apoptosis in many human tumor cell lines by regulating a series of apoptosis-related factors.7,8 Unfortunately, the development of resistance in HCC became another important obstacle for its successful chemotherapy using SF, whose antitumor efficacy was usually limited because of the appearance of multidrug resistance (MDR) of HCC.9 In this work, a new strategy to synchronously reverse MDR and inhibit tumor growth and angiogenesis in HCC by codelivery of SF and survivin shRNA (shSur) with pluronic P85 (P85)-polyethyleneimine (PEI)/D-α-tocopheryl polyethylene glycol 1000 succinate (TPGS) complex nanoparticles (SSNs) was developed. Survivin shRNA, which could downregulate © XXXX American Chemical Society

survivin protein expression by RNA interference (RNAi) and induce tumor apoptosis, was used to improve the sensitivity of drug resistant HCC. The in vitro cytotoxicity, intracellular distribution, RNA interference, survivin expression, cell cycle, and cellular apoptosis of SSNs on drug resistant HCC cells were investigated, and the in vivo antitumor efficacy was also evaluated. The tube formation assay was performed on human microvascular endothelial cells. SSNs were first expected to simultaneously inhibit the tumor growth and angiogenesis on drug resistant HCC by co-delivery of SF and shSur.

■

EXPERIMENTAL SECTION Materials. Sorafenib (SF) was purchased from Xingcheng Chempharm Co., Ltd. (Shanghai, China). P85 was purchased from BASF Ltd. (Shanghai, China). 5-Fluorouracil, TPGS, sulforhodamine B (SRB), DNA-free RNase A, propidium iodide (PI), and Cremophor EL were obtained from SigmaAldrich (St. Louis, MO). Trypsin-EDTA, fetal bovine serum (FBS), and phosphate-buffered saline (PBS) were obtained from Gibco-BRL (Burlington, ON). Coumarin-6 (C-6) was purchased from Acros Organics. Matrigel was purchased from

Special Issue: Recent Molecular Pharmaceutical Development in China Received: October 30, 2013 Revised: January 24, 2014 Accepted: February 4, 2014

A

dx.doi.org/10.1021/mp4006408 | Mol. Pharmaceutics XXXX, XXX, XXX−XXX

Molecular Pharmaceutics

Article

lation efficiency (EE%) of SSNs were calculated by the following equations.

BD Biosciences (San Jose, CA). The RPMI 1640 medium, antibiotics, DNA loading buffer, PicoGreen Kit, YOYO-1, TOTO-3, and Hoechst 33258 were purchased from Invitrogen. Trypan Blue was purchased from TianGen (Beijing, China). DiR iodide was supplied by Fanbo Biochemicals Co. Ltd. (Beijing, China). All other reagents were of analytical grade. P85-PEI was synthesized according to the procedure described in our previous work.10 A plasmid expressing small hairpin RNA against survivin [survivin shRNA (shSur)] and survivin shRNA-EGFP (shSurE) were synthesized by GenePharm Co. Ltd. (Shanghai, China). The plasmid can be delivered into cells to express shRNA and then induce the RNA interference (RNAi) effect.11 The targeted survivin mRNA sequence is GAATTAACCCTTGGTGAAT. The control shRNA-expressing pDNA (NCshRNA) that targets the sequence GTTCTCCGAACGTGTCACGT was also obtained from GenePharm Co. Ltd. The antihuman survivin-fluorescein monoclonal antibody and fluorescein isotype control were purchased from eBioscience. The pDNA was purified with the Plasmid Mega Kit (Qiagen) according to the manufacturer’s instructions. The purity was confirmed by UV spectrophotometry (A260/A280), and the concentration was determined from the absorbance at 260 nm using a UV spectrophotometer (Shimadzu). Cell Culture. Human HCC cell line BEL-7402 and human microvascular endothelial (HMEC-1) cells were obtained from the American Tissue Culture Collection (ATCC, Manassas, VA) and cultured in RPMI 1640 containing 10% FBS (complete 1640 medium) and MCDB131 medium containing 10% FBS, respectively. The 5-fluorouracil (5Fu) resistant human HCC cell line (BEL-7402/5Fu) was obtained from KeyGEN biotech (Nanjing, China) and cultured in complete 1640 medium with 10 μg of 5-fluorouracil/mL. Cells were maintained at 37 °C in a humidified and 5% CO2 incubator. Animals. Male BALB/c nude mice (18−20 g) were purchased from the Shanghai Experimental Animal Center (Shanghai, China). All animal procedures were performed under the guidelines approved by the Institutional Animal Care and Use Committee of the Shanghai Institute of Materia Medica, Chinese Academy of Sciences. Preparation and Characteristics of SSNs. SF-loaded P85-PEI/TPGS nanomicelles (SMs) were prepared by the thinfilm hydration method. Briefly, P85-PEI (50 mg), TPGS (50 mg), and SF (2 mg) were dissolved in 10 mL of methanol in a round-bottom flask. The solvent was evaporated by rotary evaporation at 35 °C for ∼1 h to obtain a solid SF/copolymer matrix. The residual methanol remaining in the film was removed under vacuum overnight at room temperature. Then, the resultant thin film was hydrated with distilled water. SF concentrations were determined using high-performance liquid chromatography (HPLC) analysis as described below. P85PEI/TPGS complex nanoparticles (SSNs) co-loaded with SF and shSur were prepared as follows. shSur was added to different concentrations of SMs to obtain SSNs with the desired polymer/shSur mass ratio, vortexed, and incubated at room temperature for 30 min. The shSur-loaded P85-PEI/TPGS nanoparticles (SNs) were prepared with similar method as SSNs, except that SF was not included in the formulation. NCshRNA loaded P85-PEI/TPGS nanoparticles (nSNs) were prepared with similar method as SNs. The particle size and ζ potential of SSNs with various mass ratios were determined by a Malvern zetasizer ZS 90 analyzer (Malvern). The drug loading efficiency (DL%) and encapsu-

DL% =

weight of the drug in nanocomplexes × 100% weight of the feeding polymer and drug

(1)

EE% =

weight of the drug in nanocomplexes × 100% weight of the feeding drug

(2)

To evaluate the stability of SSNs during in vitro and in vivo experiments, the profiles of SF and shSur being released from SSNs were investigated in Hank’s Balanced Salt Solution (HBSS, pH 7.4), complete 1640 medium, and pH 5.0 medium. SSNs containing 100 μg of SF and 500 μg of shSur were introduced into a dialysis bag (molecular mass cutoff of 7000 Da), and the end-sealed dialysis bag was submerged fully into 5 mL of medium at 37 °C while its contents were stirred at 100 rpm for 72 h. At predetermined time points, the medium was withdrawn and replaced with an equal volume of fresh medium. SF in samples was extracted with methanol and the amount determined by HPLC. The HPLC analysis of SF was conducted on a Sunfire C18 column (5 mm, 4.6 mm × 250 mm, Waters) with a mobile phase consisting of methanol and pure water [70/30 (v/v)] at a flow rate of 1.0 mL/min. The effluents were monitored at 250 nm and quantified by comparing the peak areas with the standard curve. The amount of shSur released in each time interval was determined by the PicoGreen assay. In Vitro Cellular Internalization of SSNs. To track the cellular uptake of SF and shSur in SSNs, SF was replaced with C-6, and RNA was labeled with TOTO-3. BEL-7402 and BEL7402/5Fu cells were seeded in a 24-well plate at a density of 1 × 105 cells per well and allowed to attach for 24 h. SSNs were added to the cells at a shSur concentration of 200 ng/mL and a C-6 concentration of 20 ng/mL for different incubation times (50, 110, and 230 min) at 37 °C. Cells were treated with Hoechst 33342 (6 mg/mL) for 10 min to visualize nuclei. The extracellular fluorescence was quenched with 0.4% trypan blue for 2 min, followed by washing with PBS (pH 7.4). Cells were visualized under a fluorescence microscope (Olympus) to observe the internalization of the nanocomplexes. In Vitro Transfection Experiment. The shRNA transfection experiment was conducted with BEL-7402 and BEL7402/5Fu cells using shSur-E. Cells were seeded in 24-well plates at a density of 1 × 105 cells per well in 500 mL of RPMI 1640 medium. SNs with a shSur-E concentration of 4 mg/mL at various mass ratios were prepared and added to cells for an additional 48 h incubation. The silencing efficiency was visualized through the expression of EGFP using a FACSCalibur system. In Vitro Cytotoxicity. BEL-7402 cells and BEL-7402/5Fu cells were seeded at a density of 1 × 104 cells per well in 96-well culture plates for 24 h under 5% CO2 at 37 °C. The medium was then replaced with fresh culture medium containing various concentrations of polymers, SNs, SF, SF combined with SNs (SF+SNs), SMs, or SSNs. Cells without treatment were used as a control. SNs or SSNs had a shSur concentration of 4 mg/mL. After 48 h, the cell viability was determined by the sulforhodamine B staining assay.12 Survivin Expression Analysis. BEL-7402 cells and BEL7402/5Fu cells seeded on the 24-well plates were treated with SF, SNs, nSNs, SF+SNs, SMs, or SSNs (SF concentration of 500 ng/mL and shSur concentration of 4 μg/mL) at 37 °C for 48 h. Cells that were not treated were used as a control. At the end of the incubation, cells were trypsinized, collected, and B

dx.doi.org/10.1021/mp4006408 | Mol. Pharmaceutics XXXX, XXX, XXX−XXX

Molecular Pharmaceutics

Article

Figure 1. (A) Particle size and ζ potential of SSNs. (B) In vitro release profile of SF and shSur from SSNs in pH 5.0 medium, 1640 medium with 10% FBS, or HBSS at 37 °C. Data are means ± the standard deviation (n = 3).

In Vivo Antitumor Efficacy. Subcutaneous tumors on the right flank of male nude mice were initiated by the injection of 2 × 106 viable BEL-7402 cells or BEL-7402/5Fu cells in a volume of 0.1 mL. Tumors were allowed to reach a volume of approximately 100−200 mm3. Mice with BEL-7402 tumor or BEL-7402/5Fu tumor were separately randomly assigned to seven groups (n = 6) and were injected through the tail vein every 4 days four times with saline, SF (dissolved in ethanol and cremophor EL), SNs, SF+SNs, SMs, or SSNs (SF concentration of 10 mg/kg and shSur concentration of 2 mg/ kg). The SF suspension was administered to mice by oral gavage at a dose of 10 mg/kg 16 times every day. The animal weight and tumor volume were measured until the tumor volume reached 2000 mm3, and then the animals were sacrificed for humane reasons. The individual tumor volume (V) was calculated using the formula V = (L × W2)/2, where the length (L) is the longest diameter and the width (W) the shortest diameter perpendicular to the length. Statistical Analysis. Statistical analysis was performed using a Student’s t test. The differences were considered significant for p < 0.05 (one asterisk) and very significant for p < 0.005 (two asterisks). The IC50 values were calculated by nonlinear regression analysis with GraphPad Prism version 5.0.

resuspended in 100 mL of fixation medium for a 15 min incubation. Then, cells were washed, centrifuged, and added to 100 mL of permeabilization medium and the anti-human survivin-fluorescein monoclonal antibody or fluorescein isotype control at 37 °C for 1 h. The cell resuspension was finally subjected to a FACSCalibur system and analyzed with CellQuest. Cell Cycle Analysis. BEL-7402 cells and BEL-7402/5Fu cells seeded on the 24-well plates were treated with SF, SNs, SF +SNs, SMs, or SSNs (SF concentration of 500 ng/mL and shSur concentration of 4 μg/mL) at 37 °C for 48 h. Cells that were not treated were used as a control. At the end of the incubation, cells were fixed with 70% cold ethanol at 4 °C for 24 h. Then, cells were collected, washed, incubated with RNase A (0.1 mg/mL) for 30 min at 37 °C, and stained with PI (0.1 mg/mL) for 30 min in the dark. The percentage of cells in each phase of the cell cycle was evaluated using ModFit. Nuclear Morphology Analysis. BEL-7402 cells and BEL7402/5Fu cells seeded on the 24-well plates were treated with SF, SNs, SF+SNs, SMs, or SSNs (SF concentration of 500 ng/ mL and shSur concentration of 4 μg/mL) at 37 °C for 48 h and then stained with Hoechst 33342 in the dark at 37 °C for 30 min. Then the nuclear morphology was observed using a fluorescence microscope (Olympus). Tube Formation Assay. HMEC-1 cells seeded on the 24well plates were treated with SF, SNs, SF+SNs, SMs, or SSNs (SF concentration of 500 ng/mL and shSur concentration of 4 μg/mL) at 37 °C for 48 h. Then, cells were moved onto 96-well plates (3 × 104 cells/well) coated with 50 μL of Matrigel (BD Biosciences) and incubated for an additional 6 h. The enclosed networks of tubes were photographed. In Vivo Biodistribution. Tumors on the right flank of male nude mice were initiated by injection of 2 × 106 viable BEL7402 cells or BEL-7402/5Fu cells in a volume of 0.1 mL. Tumors were allowed to grow to a volume of >200 mm3. Nude mice with BEL-7402 tumor or BEL-7402/5Fu tumor were separately randomly assigned to three groups and injected through the tail vein with SSNs loading both Dir and YOYO-1labeled shSur, Dir-labeled shSur, or YOYO-1-labeled shSur (shSur-Y) at a dose of 10 mg of Dir/kg or 2 mg of shSur/kg. Mice were sacrificed 2 h after administration, and the heart, liver, spleen, lung, kidney, and tumor were excised, washed with cold saline, and observed using an FXPRO in vivo fluorescence imaging system (Carestream).

■

RESULTS Physicochemical Characteristics of SSNs. The particle size and ζ potential of SSNs are shown in Figure 1A. SSNs could co-load SF and shSur into nanocomplexes with small particle size (∼130 nm) with positive surface charges (∼27 mV) at mass ratio of 2 or higher. For gene loaded nanoparticles, the surface charges were common up to +20 mV or higher.13−15 The particle size decreased and the surface charge increased with the increasing mass ratio of polymer and shRNA, which revealed that SSNs could simultaneously incorporate SF and condense shSur into more compact nanocomplexes when the mass ratio was over 2. The DL% and EE% of SSNs were 2.03 and 95.16%, respectively. The in vitro release profile of SSNs in HBSS, 1640 medium with 10% FBS, and pH 5.0 media is shown in Figure 1B. SSNs were stable in HBSS during a 72 h incubation, and no precipitation was observed. The release of SF and shSur from SSNs in 1640 medium with 10% FBS was faster than that in HBSS. However, the rates of release of SF and shSur in 1640 medium with 10% FBS were only 33.5 and 31.6% within 72 h, C

dx.doi.org/10.1021/mp4006408 | Mol. Pharmaceutics XXXX, XXX, XXX−XXX

Molecular Pharmaceutics

Article

Figure 2. Cellular internalization of SSNs on BEL-7402 cells and BEL-7402/5Fu cells at different time points. SF was replaced by C-6 (green), and shSur was labeled with TOTO-3 (red). Hoechst 33342 was used to stain the nucleus (blue). The scale bar represents 20 μm.

Figure 3. Fluorescent images (A) and quantitative measurements (B) of in vitro RNA interference of SNs on BEL-7402 cells and BEL-7402/5Fu cells at different mass ratios. Data are means ± the standard deviation (n = 3). The scale bar represents 50 nm.

phobic drugs,17 was used to track the cellular internalization of SF. TOTO-3, an intercalating dye with a high affinity for DNA,18 was used to label shSur and to detect the uptake of shSur in SSNs. Figure 2 shows that both BEL-7402 and BEL7402/5Fu cells exhibited gradual increases in green and red fluorescence intracellularly with an increase in time. Colocalization of green and red fluorescence was exhibited on two cells at the whole time, indicating that SSNs could well co-load and codeliver SF and shSur into cells. In Vitro Transfection Experiment. To determine the surviving downregulation ability of shSur-loaded SSNs, the in vitro shRNA transfection efficiency was detected on both BEL7402 cells and BEL-7402/5Fu cells using enhanced green fluorescence protein (EGFP)-encoded shSur, which was used to directly reflect the tendency to express shSur. Figure 3 shows that SSNs could achieve more efficient transfection on BEL-

respectively, revealing that SSNs had a high drug encapsulation efficiency and tight shRNA condensing capacity. To predict the release profile of SSNs in vivo, we also investigated the release behavior of SSNs in the media at pH 5.0, which could simulate the lysosome environment of the cells.16 More than 82% of SF and 76% of shSur were released from SSNs within 72 h. It could be deduced that SSNs were more stable in the extracellular environment and induced enhanced release in tumor cells. Therefore, SSNs could be an ideal delivery system resulting from their easy preparation, small particle size, positive surface charge, and high encapsulation efficiency. In Vitro Cellular Internalization of SSNs. The cellular SF and shSur uptake of SSNs was performed using C-6-replaced SF- and TOTO-3-labeled shSur on BEL-7402 cells and BEL7402/5Fu cells (Figure 2). C-6, a hydrophobic fluorescent dye with physicochemical properties similar to those of hydroD

dx.doi.org/10.1021/mp4006408 | Mol. Pharmaceutics XXXX, XXX, XXX−XXX

Molecular Pharmaceutics

Article

Figure 4. In vitro cytotoxicity of polymers at various concentrations against BEL-7402 cells (A) and BEL-7402/5Fu cells (B) during a 48 h incubation. (C) In vitro cytotoxicity of SNs on BEL-7402 and BEL-7402/5Fu cells. (D and E) In vitro cytotoxicity of various formulations of SF after a 48 h incubation with BEL-7402 cells and BEL-7402/5Fu cells, respectively. Data are means ± the standard deviation (n = 6).

drug resistance to SF. SMs with IC50 values of 0.60 and 3.02 μg/mL against BEL-7402 cells and BEL-7402/5Fu cells, respectively, showed enhanced cytotoxicity compared with free SF, indicating that SF loaded into micelles induced stronger cytotoxicity. Co-administration of free SF and SNs against BEL-7402 cells showed similar cytotoxicity with free SF. For BEL-7402/5Fu cells, the IC50 value of that was slightly lower than that of free SF. Combining the results of in vitro cellular internalization and the shRNA transfection experiment, we inferred that the enhanced cellular uptake and shRNA transfection efficacy of nanocomplexes on BEL-7402/5Fu cells caused distinct cytotoxicity on drug resistant cells. Dramatically, SSNs displayed more remarkable cytotoxicity than free SF. The IC50 values of SSNs were 13.82- and 45.5-fold lower than that of free SF against BEL-7402 cells and BEL-7402/5Fu cells, respectively, which exhibited the synergistic effects of micelles induced by the enhanced cytotoxicity of SF and available shRNA transfection efficacy. These results revealed that SSNs could increase the cytotoxicity of SF on both BEL-7402 cells and BEL-7402/5Fu cells. Survivin Expression Analysis. The level of survivin protein expression on BEL-7402 cells and BEL-7402/5Fu cells was determined by flow cytometry using a fluorescencelabeled anti-survivin antibody (Figure 5). It was observed that the level of survivin expression on BEL-7402/5Fu cells was significantly higher than that on BEL-7402 cells, which suggested that the overexpression of survivin was one of the mechanisms drug resistance of human HCC. On BEL-7402 cells, both SNs group and SF+SNs group exhibited weak downregulation effects of survivin, which did not bring any cytotoxicity to sensitive hepatocellular cancer cells. Cells treated with SNs or SF+SNs exhibited a distinct fluorescent peak shift to the left in the histogram, which represented the effective downregulation of survivin on BEL-7402/5Fu cells, but the level of survivin expression of BEL-7402/5Fu cells treated with nSNs was not significantly different from that of the control group, suggesting that the downregulation of survivin was caused by shSur inducing RNAi effects rather than nano-

7402/5Fu cells than on BEL-7402 cells, which was consistent with the results of cellular internalization experiments. The transfection efficiency exhibited a gradual increase with an increasing polymer/shSur-E mass ratio on BEL-7402/5Fu cells, but in BEL-7402 cells, the best transfection efficiency of shSur was performed at a mass ratio of 8. The decreased transfection efficiency of shSur at a mass ratio of 10 could result from the introduction of growth inhibition effects by the nanocarriers. In Vitro Cytotoxicity. The cytotoxicity of polymers against BEL-7402 cells and BEL-7402/5Fu cells at different concentrations was evaluated to detect the safe concentration of nanocarriers. Panels A and B of Figure 4 show that polymers exhibited negligible cytotoxicity on two cells at ≤0.01 mg/mL, which suggested that all carriers at these concentrations were safe. It was observed that the cytotoxicity of P85 to BEL-7402 cells increased at ≥0.01 mg/mL, which could contribute to pluronics inducing cell growth inhibition effects on tumor cells, which were significantly weaker on normal cells.19 Figure 4C shows the effects of SNs on BEL-7402 cells and BEL-7402/5Fu cells. SNs exhibited some cytotoxicity at ≥5 μg/mL on both types of cells. To avoid interference to the chemotherapeutic effect of SF, 4 μg shSur/mL was chosen as the final shSur concentration. The cytotoxicities of various formulations of SF on BEL7402 cells and BEL-7402/5Fu cells are shown in panels D and E of Figure 4, respectively, and the IC50 values of various formulations are listed in Table 1. The IC50 value of SF on BEL-7402/5Fu cells was 5.22 times higher than that on BEL7402 cells, which suggested that BEL-7402/5Fu cells exhibited Table 1. IC50 Values of Various Formulations against BEL7402 Cells and BEL-7402/5Fu Cells IC50 (μg/mL) BEL-7402 BEL-7402/5Fu

SF

SMs

SF+SNs

SSNs

4.01 20.93

0.60 3.02

6.45 13.15

0.29 0.46 E

dx.doi.org/10.1021/mp4006408 | Mol. Pharmaceutics XXXX, XXX, XXX−XXX

Molecular Pharmaceutics

Article

increased the S phase of two cells, while SMs obviously decreased the S phase. Cells treated with SNs significantly decreased the G0/G1 phase and caused S phase arrest, and the obvious apoptosis peak at the sub-G0 phase due to the effective downregulation of survivin expression.21 The group of SF+SNs increased this effect on BEL-7402/5Fu cells but had effects similar to those of the group of SNs on BEL-7402 cells, which was consistent with the results of in vitro cytotoxicity experiments. SSNs revealed better cell arrest efficacy with enhanced synergic effects induced from SF and shSur. Nuclear Morphology Analysis. Either introduction of SF or downregulation of shSur had been reported to be associated with cell apoptosis.3 To investigate whether SSNs could induce cell apoptosis, the nuclear morphology was observed using a fluorescence inversion microscope system (Figure 7). After being incubated with SF, the cells did not show any morphological change in nuclei at an SF concentration of 0.5 μg/mL. The group of SMs exhibited the obvious chromatin condensation and membrane blebbing on BEL-7402 cells but had a slight impact on BEL-7402/5Fu cells, which indicated that BEL-7402 cells were more sensitive to enhanced apoptosis effects of SF. BEL-7402/5Fu cells treated with SNs or SF+SNs caused remarkable nuclear condensation and nuclear fragmentation, which was induced by the downregulation of survivin. In contrast, cells exposed to SNs or SF+SNs showed no change in nuclear morphology compared with that of untreated cells, indicating that though SNs changed the cell cycle of sensitive cancer cells, they did not induce cell apoptosis. Tube Formation Assay. The tube formation assay was performed on HMEC-1 cells to determine the effect of SSNs on angiogenesis in vitro. As shown in Figure 8, either SF or SNs exhibited negligible tube formation inhibition effects, but SFloaded SMs significantly inhibited the tube formation of cells, which suggested that the increased level of cellular uptake of SF-loaded SMs enhanced the angiogenesis inhibition efficacy. Cells treated with SF+SNs exhibited a slight inhibition of tube formation, which revealed that shSur induced cell apoptosis or cell arrest effects enhanced the angiogenesis inhibition efficacy of SF. Dramatically, SSNs completely disrupted the enclosed capillary networks formed by the HMEC-1 cells. As a result, SSNs co-loading SF and shSur could be a powerful approach to the treatment of drug resistant human HCC by the simultaneous blocking of tumor cell proliferation and angiogenesis In Vivo Biodistribution. To investigate the in vivo biodistribution of SSNs, SF was replaced by Dir and RNA

Figure 5. Fluorescence intensity histogram of survivin protein expression on BEL-7402 cells (A) and BEL-7402/5Fu cells (B) treated with various formulations.

complexes themselves. Obviously, SMs could also reduce the level of survivin expression of cells. It was reported that SFassociated apoptosis decreased the protein levels of survivin.20 Therefore, it could be inferred that the enhanced SF-mediated downregulation of survivin was caused by an increased level of SF uptake in two cells. Although both SSNs and SF+SNs showed the synergistic effect of shSur inducing RNAi effects and SF inducing apoptosis, the intensity of SF inducing apoptosis was different. Co-delivery of SF and shSur by SSNs revealed the best inhibition compared with the inhibition seen with all the other treatments. They induced more survivin downregulation than SF+SNs because SSNs loaded SF into the nanoparticles whereas SF+SNs were the physical combination of free SF and SNs. Therefore, the level of survivin expression of cells treated with SSNs was much lower than that of the cells treated with SF+SNs. Cell Cycle Analysis. Figure 6 shows the cell cycle distribution of BEL-7402 cells and BEL-7402/5Fu cells treated with various formulations. It was observed that SF slightly

Figure 6. Cell cycle distribution of BEL-7402 cells and BEL-7402/5Fu cells treated with various formulations. F

dx.doi.org/10.1021/mp4006408 | Mol. Pharmaceutics XXXX, XXX, XXX−XXX

Molecular Pharmaceutics

Article

Figure 7. Nuclear morphologic analysis of BEL-7402 cells and BEL-7402/5Fu cells treated with various formulations.

Figure 8. Tube formation of HMEC-1 cells treated with various formulations.

Figure 9. Fluorescence images of tissues and tumors of nude mice with BEL-7402 tumor (A) or BEL-7402/5Fu tumor (B) at 4 h after intravenous administration of SSNs, Dir, and shSur-Y. SSNs were excited twice to observe the distribution of Dir (SSNs-D) and YOYO-1-labeled shSur (SSNsY), respectively. Lanes 1−6 show heart, liver, spleen, lung, kidney, and tumor, respectively. The dark red color shows the strongest signal intensity and the dark blue color the weakest, as shown by the bar.

G

dx.doi.org/10.1021/mp4006408 | Mol. Pharmaceutics XXXX, XXX, XXX−XXX

Molecular Pharmaceutics

Article

Figure 10. Antitumor effects (A and C) and body weight changes (B and D) after different treatments of nude mice bearing BEL-7402 tumor (A and B) or BEL-7402/5Fu tumor (C and D) after a schedule of multiple doses. Data are means ± the standard deviation (n = 6).

was labeled with YOYO-1. The group of SSNs was excited twice through different excitation wavelengths to observe the Dir distribution (SSNs-D) and YOYO-1-labeled shSur distribution (SSNs-Y), respectively. After 4 h, the distribution of SSNs was higher in liver and tumor on mice bearing BEL7402 tumor and BEL-7402/5Fu tumor (Figure 9). The SSNs-D group showed the same distribution behavior as the SSNs-Y group on both two tumor models, which indicated that SSNs could co-load drug and shRNA and deliver them to the same target tissue. Although the free Dir group and the shSur-Y group also were more highly distributed in liver, the tumor signal could not be found. The remarkable accumulation of SSNs in the tumor could be attributed to the enhanced permeability and retention (EPR) effect of nanoparticles.22 Notably, the Dir group or SSNs-D group on two tumor models exhibited obvious accumulation of Dir in lung tissue. This phenomenon could be due to the slow metabolism of Dir itself in lung tissue. Therefore, it could be inferred that SSNs could significantly enhance the tumor target effect of free SF and would exhibit the synergistic effects of SF-related antitumor efficacy and shSur-related apoptosis on both drug sensitive and resistant HCC. In Vivo Antitumor Efficacy. The average tumor size and body weight were evaluated in mice bearing BEL-7402 tumor or BEL-7402/5Fu tumor to monitor the antitumor efficacy and the toxicity of SSNs. As shown in panels A and C of Figure 10, animals treated with SF by oral administration or injection both exhibited antitumor efficacy, which was more effective on the BEL-7402 tumor model than on the BEL-7402/5Fu tumor model because of the appearance of drug resistance to SF on

the BEL-7402/5Fu tumor model. Besides, the group of SNs showed the obvious antitumor efficacy on the drug resistant tumor model but negligible effects on the drug sensitive tumor model, which confirmed further that the BEL-7402/5Fu tumor model had a strong resistance to SF and a high level of expression of survivin. Animals treated with SF+SNs showed no significant difference compared with the SF group on two tumor models. However, SSNs co-loaded with SF and shSur exhibited superior antitumor efficacy. The tumor volume of the group of SSNs on the BEL-7402/5Fu tumor model was 16% of the SF injection group and 19% of the oral administration group. The tumor volume of the group of SSNs on the drug sensitive tumor model was 21% of the SF injection group and 27% of the oral administration group. These results demonstrate that the antitumor efficacy of SSNs was superior to that of all other treatments on drug resistant hepatocellular tumor models because of the enhanced tumor cytotoxicity, effective downregulation of survivin expression, and remarkable inhibition of tumor angiogenesis. Furthermore, the group of SMs showed similar antitumor effects with SSNs on the BEL7402 tumor model and slightly weaker effects than SSNs on the BEL-7402/5Fu tumor model, which was consistent with the results of in vitro cytotoxicity experiments. The body weights of mice that had been treated with SMs or SSNs in two models showed a slight decrease at the beginning of the administration and no significant difference from those of other groups at the end of the experiment (Figure 10B,D). H

dx.doi.org/10.1021/mp4006408 | Mol. Pharmaceutics XXXX, XXX, XXX−XXX

Molecular Pharmaceutics

■

■

DISCUSSION

Article

AUTHOR INFORMATION

Corresponding Author

For the treatment of drug resistant tumors, the chemotherapeutic drug alone usually shows little effect. The field of RNA nanotechnology is emerging.23−26 Co-delivery of a drug and RNA tends to be more effective.10,14 Therefore, the SSNs co-loaded with SF and shSur were designed and developed in this work to treat drug resistant HCC. The results of physicochemical experiments showed that SSNs could form small particles (∼130 nm) with positive surface charges (∼27 mV) at a mass ratio of ≥2. It was reported that the nanocomplexes with