Single-Molecule DNA Patterning and Detection by Padlock

Apr 4, 2011 - First, DNA patterning on glass surfaces in microchannels was ... A Rapid and Visual Single Primer Isothermal Amplification-Based Method ...
0 downloads 0 Views 4MB Size
Download PDF
ARTICLE pubs.acs.org/ac

Single-Molecule DNA Patterning and Detection by Padlock Probing and Rolling Circle Amplification in Microchannels for Analysis of Small Sample Volumes Yo Tanaka,†,‡ Hui Xi,† Kae Sato,‡,§ Kazuma Mawatari,†,‡ Bj€orn Renberg,† Mats Nilsson,|| and Takehiko Kitamori*,†,‡ †

Department of Applied Chemistry, School of Engineering, The University of Tokyo, 7-3-1 Hongo, Bunkyo, Tokyo 113-8656, Japan Core Research for Evolutional Science and Technology (CREST), Japan Science and Technology Agency, 1-1-2, Otemachi, Chiyoda, Tokyo 100-0004, Japan § Department of Chemical and Biological Sciences, Faculty of Science, Japan Women’s University, 2-8-1 Mejirodai, Bunkyo, Tokyo 112-8681, Japan Department of Genetics and Pathology, Rudbeck Laboratory, Uppsala University, SE-751 85 Uppsala, Sweden

)

‡

ABSTRACT: The rolling circle amplification (RCA) is a versatile DNA amplification method in which a DNA molecule is amplified using a single DNA primer, allowing the product to be counted as a single dot. Circular templates for RCA can arise from padlock probes in highly specific DNA target-mediated ligation reactions. However, improvement of detection efficiency represents an important challenge. In homogeneous assays, the detection efficiency is generally only under 0.1%, mainly because the sample volume is too large compared with the detection volume. Here, we used microchannel surfaces in a glass microchip for DNA detection in small volume samples. First, DNA patterning on glass surfaces in microchannels was demonstrated using chemical surface patterning by UV light. By using a photochemical reaction, we realized DNA patterning in a closed space. Second, RCA was demonstrated using dilutions of target molecules, and a calibration curve was obtained. The highest detection efficiency was 22.5% by virtue of the reduced sample volumes from several hundred microliters to 5.0 nL. Accordingly, a countable number of DNA molecules was successfully detected. This method is suitable for analysis of very small volume samples such as single cells, especially by using extended-nanochannels with dimensions of 101000 nm.

O

btaining information regarding single DNA molecules in individual cells is necessary in biology, medical diagnostics, food production, etc. In particular, counting copy-number variants is a widely desired technique.1 The polymerase chain reaction (PCR) is a commonly used method to analyze DNA. With the use of PCR, small numbers of sample DNA copies can be transformed into abundant quantities for easy detection, allowing for highly sensitive detection of contaminants, gene markers, viruses, and bacteria. Quantification of target DNA becomes the key issue if more than just the presence of a particular analyte is required. In principle, quantitative PCR provides single molecule sensitivity. However, the technique only allows for averaged concentration measurements due to the exponential nature of DNA amplification, and so counting molecules is difficult. By contrast, rolling circle amplification (RCA)2 is a versatile DNA amplification method in which DNA molecules are amplified using a single DNA primer and circularized padlock probes. These probes are oligonucleotides designed r 2011 American Chemical Society

to circularize via ligation in the presence of the correct DNA target sequence in a highly specific reaction. The amplified DNA molecules are detected by hybridizing fluorescent oligonucleotide probes, resulting in the visualization of the amplification products as approximately 1 μm fluorescent spheres that can subsequently be counted.36 In this way, single molecule detection can be achieved with a minimal contribution from nonspecifically bound reagents or from media. However, the reaction products are typically difficult to detect in bulk, as in microtubes, because of their dilution in large amounts of liquid. As a consequence, detection efficiencies are often under 0.1% in homogeneous assays, mainly because sample volumes are too large (∼microliters), due to the size of bulk scale operations compared with the detection volumes. Received: December 4, 2010 Accepted: March 23, 2011 Published: April 04, 2011 3352

dx.doi.org/10.1021/ac103185j | Anal. Chem. 2011, 83, 3352–3357

Analytical Chemistry

ARTICLE

Figure 1. Scheme of DNA patterning method on a microchannel surface using UV light. (A) PEG coupling to APTES immobilized on the glass surface. The carbonyl groups of PEG were covalently bound to amine groups of APTES. (B) BP-NCS UV reaction and patterning onto PEG. The carbonyl groups of BP-NCS were covalently bound to alkyl groups of PEG by UV light. (C) Primer DNA introduction and coupling to BP-NCS. The amine groups of DNA were covalently bound to NCS groups of BP-NCS.

A microchip is a powerful tool that can be used to overcome this problem. Generally, by using a microchip, extremely efficient analytical devices can be created that exploit the advantages of micrometer dimensions, including short diffusion distances, low Reynolds numbers, high interface-to-volume ratios, and small heat capacities compared with conventional laboratory setups.711 By exploitation of these advantages, single molecules can be measured in small aliquots of samples. Previously, we developed a microchip-based RCA system, in which primer DNA molecules that were fixed on the surface and within the pores of agarose microbeads were introduced in a microchip.12 However, it proved difficult to achieve quantitative results based on a calibration curve at low concentrations. This is because it is difficult to define the space volume in which DNA molecules are detected, due to the complicated structure of the pores on the beads, and it is also difficult to confirm if RCA is completely successful within the pore. Here, we propose to pattern and detect DNA on a channel surface to realize quantitative analysis and to analyze samples having any volume simply by changing the channel dimensions and patterning area. To realize this concept, it is important to develop a proper DNA patterning method on a closed glass channel surface. Most conventional molecular patterning methods such as through inkjet printing,13 lithography,14,15 microcontact printing,16 or nanoimprinting17,18 can realize exact patterning, but they are difficult to apply in closed spaces.

Therefore, we here develop a new patterning method using UV light. Although we have previously developed a DNA patterning method in a micro and extended-nanochannel using UV light,19 this was not suitable for RCA because any of the amine groups in DNA molecules may attach to surface chemicals due to photochemical reactions, and DNA molecules fail to be amplified because of these physical obstacles. Moreover, direct UV irradiation would damage DNA molecules. Therefore, a new method must be developed without direct UV irradiation to DNA molecules. The objective of this report was to develop a DNA patterning method on microchannels and to demonstrate RCA for analysis of individual DNA molecules. First, we demonstrated a DNA patterning method on glass surfaces in microchannels using surface chemical patterning by UV light. Second, we demonstrated RCA using the patterned DNA, and we derived a calibration curve to verify single molecule level counting.

’ EXPERIMENTAL SECTION DNA Patterning Method. Here, we describe a method that allows direct immobilization of biological molecules onto the inner walls of microchannels via a photochemical reaction with surface-bound benzophenone (BP). BP was chosen because of its remarkable chemical and photochemical robustness; this molecule is more stable in ambient light than other known 3353

dx.doi.org/10.1021/ac103185j |Anal. Chem. 2011, 83, 3352–3357

Analytical Chemistry photoactive compounds and it can be repeatedly activated at 330365 nm wavelengths in aqueous solution without significant loss of activity.20 In the presence of organic solutes, the excited triplet species of BP react almost exclusively via CH bond insertion and they form covalent linkages with biomolecules. The BP-containing bifunctional reagents are widely employed as photochemical cross-linkers for studying interactions of biological molecules. Immobilized BP has also been used for covalent attachment of polymer films to a solid substrate. We show here that BP can be used for light-directed patterning of DNA inside microchannels and that the molecules immobilized in this way retain their biological activity and can be used in bioassays. The protocol and reaction scheme for patterning DNA are shown in Figure 1. Before chemical modification, a microchannel was filled with freshly prepared piranha solution (7:3 (v/v) of concentrated sulfuric acid and 30% hydrogen peroxide) and incubated for 14 h at room temperature. The microchannel was then flushed consecutively with distilled water (2 mL) and 95% ethanol (2 mL) by using a syringe pump set at 100 μL/min. Next, the microchannel was treated with 3% 3-aminopropyltriethoxysilane (APTES) (Tokyo Chemical Industry) solution in 95% ethanol at a constant reagent flow of 5 μL/min for 2 h to add amine groups to the surface of the microchannel for the next step reaction.21 After that, the microchannel was flushed with ethanol (2 mL) to remove any free APTES, dried, and cured at 115 °C for 2 h. Next, amine-reactive (NHS-activated) polyethylene glycol with terminal methyl groups (MS(PEG)) (Invitrogen) at 250 mM in N,N-dimethylformamide (DMF) (Wako) was introduced by capillary force, and the microchip was kept in humid conditions at room temperature overnight. The modified polyethylene glycol was covalently bound to amine groups of APTES to prevent nonspecific binding of DNA molecules.22 The microchannel was then washed with distilled water with DMF at 20 μL/min for 30 min each, then with 1% triethylamine (Wako) for 5 min in stopped flow to remove the uncoated amino groups, and then it was again washed with distilled water with DMF. After that, BP with NCS group (BP-NCS) (Invitrogen) at 100 mM was introduced by capillary force with a solution into dry DMF. The microchip was then wrapped in aluminum foil until it was irradiated by UV light. After introduction of BP-NCS, the microchip was UV irradiated. The fundamental experimental procedure and the instrument used to obtain the DNA patterning were reported previously.19 Briefly, the irradiation experiments were performed on an inverted microscope model IX60 (Olympus), equipped with a 100 W mercury arc lamp (Ushio), a 365-nm interference filter, and an OHP film mask. The microchannel filled with sample was mounted on a microscope stage equipped with a small ruler, and the microscope objective was focused on the inner microchannel surface using visible light. The patterning was performed by irradiation of the focus zone with the microscope UV source at 250 mW/cm2 for 90 s, followed by manual translation of the stage. Directly after that, the microchannel was washed with DMF and ethanol at 50 μL/min, dried, and stored at 4 °C in the dark. Next, the RCA primer (50 -[EC-NH2]-GACGGGAACTACAAGACGCGTGCTGAAGTCAAGTT-30 , Sigma Genosys) was introduced by capillary force. After the microchannel was washed with DMF at 20 μL/min for 30 min, it was washed with 2 PBS at 20 μL/min for 5 min and 1 PBS at 20 μL/min for

ARTICLE

Figure 2. Scheme of RCA on microchannel glass surface: (A) padlock probe introduction and hybridization to an immobilized primer DNA, (B) target DNA introduction and hybridization to the padlock probe, (C) ligation of the padlock probes, (D) RCA using polymerase, and (E) fluorescent labeling by hybridization of fluorescently labeled DNA.

5 min. Finally, DNA solutions at 10 μM were introduced, and the microchip was kept at room temperature overnight in a humid culture dish. Hybridization Assay. In hybridization assays to confirm primer patterning, the microchannel was pretreated with 2 mL of washing buffer (2 SSC and 0.1% SDS) at 100 μL/min and then filled with a solution of the fluorescence-labeled oligonucleotide that was complementary to the primer sequence (50 -[Cy3]-AACTTGACTTCAGCACGCGT-30 , Sigma Genosys) in hybridization buffer (PBS, 0.5 M NaCl, 20 mM EDTA, 100 μg/mL salmon sperm DNA) at 10 μM. The hybridization was performed at 42 °C for 30 min, and the microchannel was washed with 1 PBS at 20 μL/min for 5 min. RCA Protocol on the Microchannel Surface. The RCA protocol is shown in Figure 2. Here, the target DNA was recognized via hybridization of linear padlock probes to their target sequences, and the probe ends were joined through ligation. The bacteriophage j29 DNA polymerase releases the DNA target strands from the circularized probes in the act of amplification initiated by the immobilized primer DNA strands.23 The primer was used to initiate an RCA reaction, which resulted in a long, single-stranded DNA molecule that could be visualized directly by hybridization with fluorescent DNA probes. Thereby a powerful signal amplification of individual probe molecules could be achieved, allowing their detection by a microscope after fluorescence labeling. In this experiment, primer DNA is extended by polymerase attachment to the 30 end of the primer. On the other hand, target DNA cannot be extended because we use target DNA, which has fluorescein on the 30 end and polymerase cannot attach there. Therefore, primer 3354

dx.doi.org/10.1021/ac103185j |Anal. Chem. 2011, 83, 3352–3357

Analytical Chemistry DNA is not damaged by target DNA extension during RCA reaction. First, the primer was immobilized to the surface of the modified glass using the DNA immobilization methods described above. Next, linear padlock probes (50 -[Phosphate]CGTCAATTGCTGCGGTTAAGAGCGCATGAATCCGTA GTAACTTGACTTCAGCACGCGTGAGGTCGGTACACT CTGCTTCTTCTGCGGGTAA-30 , Sigma Genosys) were introduced into the microchannel at 0.1 μL/min at 1 μM for estimation of the dynamic range, at 100 pM to generate a low concentration calibration curve, and hybridized to the immobilized primer in stopped flow at 37 °C for 60 min with hybridization buffer (EDTA 0.1 mol/L, Tris-HCl 1 mM, NaCl 2.5 mol/L, Tween20 (10%) mixed at 2:2:2:1). Next, the microchannel was washed with 1 PBS at 20 μL/min for 5 min. Target DNA (50 AATAACCGCAGCAATTGACGTTACCCGCAGAAGAAGC ACC-[Fluorescein]-30 , Sigma Genosys) was then introduced at 0.1 μL/min at varying concentrations (much lower than the concentrations of primers and padlock probes) and hybridized to the immobilized padlock probes in stopped flow at 37°C for 60 min with the hybridization buffer. Again, the microchannel was washed by 1 PBS at 20 μL/min for 5 min. Next, the DNA probe was circularized by ligation in a reaction templated by the target sequence. An ampligase solution (0.25 U/μL ampligase (Epicenter Technologies), 0.1 μg/μL BSA, 0.075 M KCl in 1 ampligase buffer) was introduced into the microchannel at 0.1 μL/min. The reactions were carried out in stopped flow at 55 °C, and ligation was terminated by incubation at this temperature for 15 min. Next, the microchannel was washed by 1 PBS at 20 μL/min for 5 min. RCA was carried out by introducing a polymerase solution (0.5 U/μL j29 polymerase (New England Biolabs), 0.1 μg/μL BSA, 0.25 nmol/μL dNTP in 1 j29 polymerase buffer) into the microchannel at 0.1 μL/min. The RCA reaction was carried out at a constant temperature in stopped flow at 37 °C for 60 min. Next, the microchannel was washed with 1 PBS at 20 μL/min for 5 min. Finally, to label amplified DNA molecules, a fluorescent probe DNA (50 -[Alexa594]-AGAGCGCATGAATCCGTAGT-30 , Sigma Genosys) at 2 μM in hybridization buffer was introduced into the microchannel and incubated at 37 °C for 20 min in stopped flow. Next, the microchannel was washed with 1 PBS at 20 μL/min for 30 min to remove excess fluorescent probes. RCA with noncDNA. In order to confirm the specificity of the padlock probe circularization reaction, noncDNA (50 -[EC-NH2]GACGGGAACTACAAGCAACGTGAGTGTTACCAGTG-30 , Sigma Genosys) was used as a negative primer control at 10 pM and compared with a positive control using cDNA. Microchip Experimental Setup. The experimental setup is shown in Figure 3. Here we used glass microchips because of their flexibility regarding surface modification and their suitability for chemical reaction and detection. A syringe pump (KDS Scientific) was used to inject liquid into the microchannels. The microchip has four linear microchannels with a depth and width of 42 and 100 μm, respectively. The desired temperature was maintained using a temperature controller (Cell System). A glass microchip was fabricated using a photolithographic wet etching method.24 The plates were thermally bonded in a furnace to form a microchannel. Briefly, a mechanically polished Pyrex glass substrate (bottom plate) was prepared and annealed before use. Next, Cr and Au layers were evaporatively deposited on the substrate under a vacuum, a positive photoresist was spin-coated

ARTICLE

Figure 3. (A) Illustration of an experimental setup. All solutions are introduced into a microchannel through injectors using a syringe pump. The temperature was maintained by a temperature controller. (B) An actual photo of a 7 cm  3 cm microchip with four linear channels.

on the metal, and UV light was exposed through a photomask. After that, the photoresist was developed, and the metal layers were etched. Then, the bare glass surface with the microchannel pattern was etched with HF solution. After glass-etching, the remaining photoresist was removed. Inlet and outlet holes were drilled on another Pyrex glass substrate (cover plate). Finally, the plates were thermally bonded in a furnace.

’ RESULTS AND DISCUSSION DNA Patterning in Microchannels. In order to detect target DNA in quite small sample volumes (∼nanoliters) by the RCA method, the primer DNA must be patterned on the surface of the appropriate area of the microchannel in the first step, before addition of hybridizing padlock probes and target DNA followed by RCA. Therefore, we developed a procedure for primer DNA patterning by light. After immobilization of the primer DNA by light, the microchip was incubated with a fluorescent labeled cDNA probe to reveal the DNA patterning on the microchannel surfaces. The result of DNA patterning inside microchannels by light is shown in Figure 4. The complementary fluorescent labeled DNA bound to the immobilized DNA, visualized as a white band, clearly demonstrates the patterning where the microchannel had been illuminated. However, although the width of the UV exposed area was only 50 μm, the white band spanned about 1.2 mm. This is probably because the UV irradiation condition (UV intensity, reflection prevention, etc.) was not optimized. The corresponding volume against this patterning length (1.2 mm) is 5.0 nL. Therefore, it was demonstrated that sample volumes of 5.0 nL can be measured using this method. RCA Demonstration in Microchannels. After patterning the primer DNA, we next investigated target-mediated padlock probe circularization and RCA in microchannels. The introduced target DNA concentration ranged from 100 fM to 10 nM in order to estimate the dynamic range of this method. A no-target control was included as a blank. Except at the highest concentration (10 nM), the RCA products were clearly visualized as fluorescent dots, as shown in Figure 5A. There were no fluorescent dots when no target DNA had been added. The number of fluorescent dots increased roughly in proportion to the target DNA concentration, almost reaching a plateau around 1 nM. In low target concentrations such as 100 fM and 10 pM, the size of the dots appeared large. 3355

dx.doi.org/10.1021/ac103185j |Anal. Chem. 2011, 83, 3352–3357

Analytical Chemistry

ARTICLE

Figure 6. Result of a control experiment consisting of RCA using noncDNA at the target DNA concentration of 10 pM. Microchannel fluorescence was observed. (A) Result using cDNA and (B) result using noncDNA.

Figure 4. Result of DNA patterning in a microchannel using a photo mask. (A) Bright field observation. UV was illuminated only inside of the broken lines. (B) Fluorescent observation. The white band indicates the patterned DNA.

Figure 7. Calibration curve of RCA ranging from 50 fM to 10 pM. Each plot indicates the experimental value. The line indicates the theoretical value.

Figure 5. (A) Result of RCA at various concentrations of target DNA molecules, ranging from 100 fM to 10 nM and 0 M. Microchannel fluorescence was observed. (B) Pictures indicating the patterned area and dot density distribution at 100 fM.

This is because dots appeared on both the upper and bottom surfaces of the microchannel, and it was difficult to focus both surfaces due to the short focus distance of the objective lens ( 40, Olympus). At higher target concentrations (100 pM, 1 nM, 10 nM), unfocused dots appeared as homogeneous background fluorescence. Accordingly, some of the dots were not recorded, and measurement at these concentrations was therefore outside the dynamic range. Therefore, we investigated RCA results in a low target concentration range (around 1 pM) in order to derive a calibration curve. Moreover, as shown in Figure 5B, clear unevenness of the dot density could not be found in the patterned area. Therefore, we assumed that the expanding of the patterning area did not affect the quantification. Result of RCA with noncDNA. To verify that the observed dots were produced by RCA, the specificity of RCA was checked using noncomplementary primer DNA. Results are shown in Figure 6. Only a few dots were observed in the negative control, and the difference between this result and the positive control was obvious. This result demonstrated the specificity of the primer and padlock probe reaction.

Calibration Curve. A calibration curve revealing counts of RCA products with inputs of target DNA from 50 fM to 10 pM is shown in Figure 7. The detection efficiency was calculated by dividing the experimental value (dots in the patterned area) by the theoretical value. The theoretical value was calculated by multiplying the volume in the patterned area (5.0 nL) by the introduced target DNA concentrations. As a result, the dot numbers increased when the target DNA concentrations increased. In this experiment, a small number (around 10) of molecules were counted. In such a few number counting, the measured values follow Poisson distribution rather than normal distribution. Therefore, it is difficult to attach error bars. At low target concentrations, the dots were close to the theoretical value line and the detection efficiency exceeded 10%, with a maximum detection efficiency of 22.5% for 100 fM targets. This high efficiency was achieved mainly because the volume of the patterned area in a microchannel is far smaller than that of microtubes that are normally used for experimentation. The efficiency still did not reach 100%. Since the primer and padlock probe concentrations were much higher than target DNA, the dominant problem to improve the detection efficiency is hybridization efficiency between target DNA and padlock probes. The main point is that the distance between the target DNA and microchannel surfaces immobilized with padlock probes is large due to the large volume of the microchannel, and therefore the hybridization efficiency between target DNA and padlock probes should become low. To achieve even higher detection efficiency, still smaller channels should be used. Despite this high detection efficiency, the dot numbers were very small at the low target concentration, thus this assay did not provide higher sensitivity than the reported homogeneous assay (about 10 fM limit of detection),3 but it did enable analysis of much smaller volumes, 3356

dx.doi.org/10.1021/ac103185j |Anal. Chem. 2011, 83, 3352–3357

Analytical Chemistry namely, a countable number of molecules were detected in small volume samples (5.0 pL) for the first time. In this system, the liquid flow was stopped during the capture of target DNA molecules. Therefore, target DNA did not hybridize to padlock probes during flowing because hybridization takes at least several minutes. Thus, the actual volume of liquid concerning detection was just assumed as the same as the volume in the primer patterned area in the microchannel (5.0 pL), not a total volume of introduced liquid. For the real application, a new method to handle this very small volume sample (5.0 pL) is required. Even compared with a recently reported on-chip detection system for measuring small sample volumes via digital RT-PCR using a microchamber array,25 the latter sample volume is 7.5 μL, which is far larger than the sample volume in the present system (5.0 nL). With the use of this method, even a few molecules in very small samples, such as a few cells, could be detected.

’ CONCLUSIONS In this report, we developed a DNA patterning method on microchannels and demonstrated RCA for single DNA analysis. First, we demonstrated a DNA patterning method on glass surfaces in microchannels using chemical surface patterning by UV light. With the use of multiple immobilization of APTES, PEG, and BP-NCS, DNA patterning in the closed space was realized, although the patterned area spread beyond the designated area. It was demonstrated that 5.0 nL sample volumes can be measured using this method. Second, padlock probing followed by RCA using the patterned DNA was demonstrated for a range of target DNA concentrations, and a calibration curve was obtained. The dot numbers increased in proportion to the target DNA concentrations, and a maximum detection efficiency of 22.5% was observed, more than 200 times higher compared with that reported for a homogeneous assay using a microtube (lower than 0.1%). Accordingly, we have for the first time demonstrated detection of countable numbers of DNA in small volume (nanoliter) samples. Even though only microchannels were used in this report, this UV light-based DNA patterning method can be applied to glass channels of any size. So far, we have succeeded in fabricating glass microchips incorporating extended-nano (101000 nm) channels and we have also developed fluidic control methods.2628 With the use of quite small volumes (∼femtoliters) in such ultrasmall channels, analysis of very small volume samples, lower than the picomolar level, and even higher detection efficiencies near 100% can be expected, due to the extremely short diffusion distance within an extended-nanochannel. This technique should prove useful for individual single cell analysis, leading to new insights in fundamental cell biology. Furthermore, other biological samples such as viruses or bacteria would be captured and analyzed with very small samples by similar methodology. ’ AUTHOR INFORMATION Corresponding Author

*E-mail: [email protected]. Phone: þ81-3-5841-7231. Fax: þ81-3-5841-6039.

’ ACKNOWLEDGMENT This work was partially supported by the JSPS Core-to-Core Program and the NEDO Industrial Technology Research Assistance

ARTICLE

Project. The authors greatly thank Prof. Ulf Landegren in the Department of Genetics and Pathology, Rudbeck Laboratory, Uppsala University, Sweden, for useful discussions.

’ REFERENCES (1) Feuk, L.; Carson, A. R.; Scherer, S. W. Nat. Rev. Genet. 2006, 7, 85–97. (2) Lizardi, P. M.; Huang, X.; Zhu, Z.; Bray-Ward, P.; Thomas, D. C.; Ward, D. C. Nat. Genet. 1998, 19, 225–232. (3) Jarvius, J.; Melin, J.; G€oransson, J.; Stenberg, J.; Fredriksson, S.; Gonzalez-Rey, C.; Bertilsson, S.; Nilsson, M. Nat. Methods 2006, 3, 725–727. (4) Melin, J.; Jarvius, J.; G€oransson, J.; Nilsson, M. Anal. Biochem. 2007, 368, 230–238. (5) Ericsson, O.; Jarvius, J.; Schallmeiner, E.; Howell, M.; Nong, R. Y.; Reuter, H.; Hahn, M.; Stenberg, J.; Nilsson, M.; Landegren, U. Nucleic Acids Res. 2008, 36, e45. (6) G€oransson, J.; W€ahlby, C.; Isaksson, M.; Howell, W. M.; Jarvius, J.; Nilsson, M. Nucleic Acids Res. 2009, 37, e7. (7) West, J.; Becker, M.; Tombrink, S.; Manz, A. Anal. Chem. 2008, 80, 4403–4419. (8) Ohno, K.; Tachikawa, K.; Manz, A. Electrophoresis 2008, 29, 4443–4453. (9) Whitesides, G. M. Nature 2006, 442, 368–373. (10) Kitamori, T.; Tokeshi, M.; Hibara, A.; Sato, K. Anal. Chem. 2004, 76, 52A–60A. (11) Tanaka, Y.; Sato, K.; Shimizu, T.; Yamato, M.; Okano, T.; Kitamori, T. Biosens. Bioelectron. 2007, 23, 449–458. (12) Sato, K.; Tachihara, A.; Renberg, B.; Mawatari, K.; Sato, K.; Tanaka, Y.; Jarvius, J.; Nilsson, M.; Kitamori, T. Lab Chip 2010, 10, 1262–1266. (13) Park, J. U.; Lee, J. H.; Paik, U.; Lu, Y.; Rogers, J. A. Nano Lett. 2008, 8, 4210–4216. (14) Mooney, J. F.; Hunt, A. J.; Mcintosh, J. R.; Liberko, C. A.; Walba, D. M.; Rogers, C. T. Proc. Natl. Acad. Sci. U.S.A. 1996, 93, 12287–12291. (15) Jiang, J.; Li, X.; Mak, W. C.; Trau, D. Adv. Mater. 2008, 20, 1636–1643. (16) Kane, R. S.; Takayama, S.; Ostuni, E.; Ingber, D. E.; Whitesides, G. M. Biomaterials 1999, 20, 2363–2376. (17) Hoff, J. D.; Cheng, L. J.; Meyh€ofer, E. L.; Guo, J. L.; Hunt, A. J. Nano Lett. 2004, 4, 853–857. (18) Cao, H.; Yu, Z.; Wang, J.; Tegenfeldt, J. O.; Austin, R. H.; Chen, E.; Wu, W.; Chou, S. Y. Appl. Phys. Lett. 2002, 81, 174. (19) Renberg, B.; Sato, K.; Mawatari, K.; Idota, N.; Tsukahara, T.; Kitamori, T. Lab Chip 2009, 9, 1517–1523. (20) Banks, P. R.; Paquette, D. M. Bioconjugate Chem. 1995, 6, 447–458. (21) Morikawa, K.; Mawatari, K.; Kato, M.; Tsukahara, T.; Kitamori, T. Lab Chip 2010, 10, 871–875. (22) Konno, T.; Kurita, K.; Iwasaki, Y.; Nakabayashi, N.; Ishihara, K. Biomaterials 2001, 22, 1883–1889. (23) Baner, J.; Nilsson, M.; Mendel-Hartvig, M.; Landegren, U. Nucleic Acids Res. 1998, 26, 5073–5078. (24) Hibara, A.; Tokeshi, M.; Uchiyama, K.; Hisamoto, H.; Kitamori, T. Anal. Sci. 2001, 17, 89–93. (25) Warren, L.; Bryder, D.; Weissman, I. L.; Quake, S. R. Proc. Natl. Acad. Sci. U.S.A. 2006, 103, 17807–17812. (26) Hibara, A.; Saito, T.; Kim, H.-B.; Tokeshi, M.; Ooi, T.; Nakao, M.; Kitamori, T. Anal. Chem. 2002, 74, 6170–6176. (27) Tamaki, E.; Hibara, A.; Kim, H.-B.; Tokeshi, M.; Kitamori, T. J. Chromatogr., A 2006, 1137, 256–262. (28) Tsukahara, T.; Hibara, A.; Ikeda, Y.; Kitamori, T. Angew. Chem., Int. Ed. 2007, 46, 1180–1183.

3357

dx.doi.org/10.1021/ac103185j |Anal. Chem. 2011, 83, 3352–3357